I 1111111111111111 11111 111111111111111 IIIII IIIII IIIII 11111 lll111111111111111
`US007244605B2
`
`c12) United States Patent
`Harris et al.
`
`(IO) Patent No.:
`(45) Date of Patent:
`
`US 7,244,605 B2
`Jul. 17, 2007
`
`(54) POLYPEPTIDES HAVING
`BETA-GLUCOSIDASE ACTIVITY AND
`POLYNUCLEOTIDES ENCODING SAME
`
`(75)
`
`Inventors: Paul Harris, Carnation, WA (US);
`Elizabeth Golightly, Reno, NV (US)
`
`(73) Assignee: Novozymes, Inc., Davis, CA (US)
`
`( *) Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by O days.
`
`(21) Appl. No.: 10/976,660
`
`(22)
`
`Filed:
`
`Oct. 28, 2004
`
`(65)
`
`Prior Publication Data
`
`US 2005/0214920 Al
`
`Sep. 29, 2005
`
`Related U.S. Application Data
`
`(60)
`
`Provisional application No. 60/515,482, filed on Oct.
`28, 2003.
`
`(51)
`
`Int. Cl.
`C12N 9/26
`C12N 9/00
`C12N 1120
`C12N 15100
`C07H 21104
`(52) U.S. Cl. ................ .
`
`(2006.01)
`(2006.01)
`(2006.01)
`(2006.01)
`(2006.01)
`435/201; 435/183; 435/252.33;
`435/320.1; 536/23.2
`(58) Field of Classification Search ................ 435/183,
`435/201, 252.33, 320.1, 252.3; 536/23.2
`See application file for complete search history.
`
`(56)
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`6,087,131 A
`
`7 /2000 Gunata et al.
`
`2004/0248258 Al* 12/2004 Miyiran et al.
`
`FOREIGN PATENT DOCUMENTS
`
`WO
`WO
`
`WO 01/36586
`WO 02/095014
`
`5/2001
`11/2002
`
`OTHER PUBLICATIONS
`
`Kawaguchi et al. Accession P48825. Feb. 1, 1996.*
`Iwashita et al. Accession Jul. 1, 1997.*
`Ximenes et al., 1996, Current Microbiology 32: 119-123.
`Hang and Woodams, 1994, Lebensmittel-Wissenschaft and
`Technologie 27: 587-589.
`Kitpreechavanich et al., Agricultural and Biological Chemistry 50:
`1703-1712.
`Kawaguchi et al., "Cloning and sequencing of the cDNA encoding
`beta-glucosidase 1 fromAspergillus aculeatus", Gene, vol. 173, No.
`2, Sep. 16, 1996, p. 287-288.
`Fontaine et al., "Differential patterns of activity displayed by two
`exo-beta-1, 3-gluconases associated with the Aspergillus fumigatus
`cell wall", Journal of Bacteriology, vol. 179, No. 10, 1997, p.
`3154-3163.
`Woodward et al., "Fungal and other Beta-D-Glucosidases- Their
`properties and applications", Enzyme and Microbial Technology,
`Stoneham MA, US, vol. 4, Mar. 1982, p. 73-79.
`
`* cited by examiner
`
`Primary Examiner-Tekchand Saidha
`Assistant Examiner----Christian Fronda
`(74) Attorney, Agent, or Firm-Robert L. Starnes
`
`(57)
`
`ABSTRACT
`
`The present invention relates to isolated polypeptides having
`beta-glucosidase activity and
`isolated polynucleotides
`encoding the polypeptides. The invention also relates to
`nucleic acid constructs, vectors, and host cells comprising
`the polynucleotides as well as methods for producing and
`using the polypeptides.
`
`7 Claims, 13 Drawing Sheets
`
`

`

`O'I = UI = N
`
`~
`~
`'N
`-....l
`
`d r.,;_
`
`Fig. 1A
`
`GATAACGGGGCTCTCAGCCAGATGGCAGATGTTGCATCTCAATCCAGGTGAGTGCGGGCTCTTAGAAAAAGAACGTTCTCTGAATGAAGTTTTTTAACCA 1900
`
`S N G G N V F A V T
`
`I
`
`I Q R E V
`
`W G S G T A N F P Y L V T P E Q A
`
`CTGGGGTAGTGGTACTGCCAACTTCCCTTACCTTGTCACCCCCGAGCAGGCTATCCAGCGAGAGGTCATCAGCAACGGCGGCAATGTCTTTGCTGTGACT 1800
`E V K V G V L G E D A G S N P W G A N G C P D R G C D N G T L A M A
`AGGTTAAAGTGGGTGTTCTCGGTGAAGACGCTGGTTCCAACCCGTGGGGTGCTAACGGCTGCCCCGACCGCGGCTGTGATAACGGCACTCTTGCTATGGC 1700
`
`D N G A L S Q M A D V A S Q S S
`
`~
`
`....
`0 ....
`....
`.....
`rJJ =(cid:173)
`
`('D
`('D
`
`....
`2' :-'
`
`-....J
`0
`0
`N
`~-....J
`
`~ = ~
`
`~
`~
`~
`•
`00
`
`e •
`
`GTCAATGTGCAGCGCAGTCACTCTCAGATCATCCGTGAGATTGGTGCCGCTAGTACAGTGCTCTTGAAGAACACGGGTGCTCTTCCTTTGACCGGCAAGG 1600
`
`I G A A S T V L L K N T G A L p· L T G K
`
`I R E
`
`I
`
`V N V Q R S H S Q
`
`P P N F S S W T R D E Y G W E H S A V S E G A W T K V N D F
`
`I
`
`L R
`
`TCTTCGTATTCCCCCTAACTTCAGCTCCTGGACCCGGGATGAGTACGGCTGGGAGCATTCTGCTGTCTCCGAGGGAGCCTGGACCAAGGTGAACGACTTC 1500
`N L T V S V L N G T V P A W R V D D M A V R
`ACCTAACTGTCAGTGTTCTTAACGGCACCGTTCCAGCCTGGCGTGTCGATGACATGGCTGTTCGTATCATGACCGCGTACTACAAGGTTGGTCGTGACCG 1400
`
`I M T A Y Y K V G R D R
`
`AGCGCTCACCACAGCGGTGTCGGCGCTGCCCTCGCTGGGTTGGATATGTCGATGCCTGGAGACATTTCCTTCGACGACGGACTCTCCTTCTGGGGCACGA 1300
`
`S F D D G L S F W G T
`
`I
`
`S A H H S G V G A A L A G L D M S M P G D
`
`CAATCAAATCAACAACAGCTACGGTTGTCAAAACAGTCAAACTCTCAACAAGCTCCTCAAGGCTGAGCTGGGCTTCCAAGGCTTCGTCATGAGTGACTGG 1200
`
`I N N S Y G C Q N S Q T L N K L L K-A E L G F Q G F V M S D W
`
`N Q
`
`AGATGCTGTGCGCGGTAAGATTTTCCGTAGACTTGACCTCGCGACGAAGAAATCGCTGACGAACCATCGTAGCTGGCGTTGGCGCTGTCATGTGTTCCTA 1100
`
`A G V G A V M C S Y
`
`D A V R
`
`PFA
`
`DDKTMHELYLW
`
`GGATGACAAGACCATGCACGAGTTGTACCTTTGGTGAGTAGTTGACACTGCAAATGAGGACCTTGATTGATTTGACTGACCTGGAATGCAGGCCCTTTGC 1000
`T A K H Y
`CTGCCAAGCATTACATTCTGAATGAACAGGAGCATTTCCGACAGGTTGGCGAGGCCCAGGGATATGGTTACAACATCACGGAGACGATCAGCTCCAACGT 900
`
`S N V
`
`S
`
`I
`
`I T E T
`
`I L N E Q E H F R Q V G E A Q G Y G Y N
`
`I A
`
`I Q D A G V
`
`I K G
`
`I W E G F S P D P V L T G V L F A E T
`
`G G R
`
`GGCGGCAGAATCTGGGAAGGCTTCTCTCCTGATCCGGTTCTCACTGGTGTACTTTTCGCCGAAACTATCAAGGGTATCCAAGACGCGGGTGTGATTGCTA 800
`
`CGCCTACCTTCGTGGCAAGGCCATGGGTGAGGAATTCAACGACAAGGGCGTGGACATTTTGCTGGGGCCTGCTGCTGGTCCTCTCGGCAAATACCCGGAC 700
`
`I L L G P A A G P L G K Y P D
`
`A Y L R G K A M G E E F N D K G V D
`
`S D L N S A F P A G T N V A A T W D K T L
`
`CAGTCCTTGTATTATGTGCTGATGATTGTCTCTGTATAGCTGACCTCAACTCCGCCTTCCCTGCTGGTACTAATGTCGCCGCGACATGGGACAAGACACT 600
`
`I R F
`
`I N W G L C G Q D S P L G
`
`L G
`
`GCTAAAACGCGGTGGTGCAGACTTGGTATCAACTGGGGTCTTTGTGGCCAGGATTCCCCTTTGGGTATCCGTTTCTGTGAGCTATACCCGCGGAGTCTTT 500
`
`ACTGACCATCTACACAGATGGGAAATGGACCGATGCGTCGGTCAAACCGGCAGCGTTCCCAGGTAAGCTTGCAATTCTGCAACAACGTGCAAGTGTAGTT 400
`
`W E M D R C V G Q T G S V P R
`
`GCCGTCGAGATCGTTTCTCAGATGACACTGGCGGAGAAGGTTAACCTTACAACGGGTACTGGGTGGGTTGCGACTTTTTTGTTGACAGTGAGCTTTCTTC 300
`
`I V S Q M T L A E K V N L T T G T G
`
`A V E
`
`E L A F S P P F Y P S P W A D G Q G E W A D A H R R
`
`CAATAGTCATGGAAATAATCAGGAATTGGCTTTCTCTCCACCATTCTACCCTTCGCCTTGGGCTGATGGCCAGGGAGAGTGGGCAGATGCCCATCGACGC 200
`M R F G W L E V A A L T A A S V A N A Q
`ATGAGATTCGGTTGGCTCGAGGTGGCCGCTCTGACGGCCGCTTCTGTAGCCAATGCCCAGGTTTGTGATGCTTTCCCGTCATTGTTTCGGATATAGTTGA 100
`
`

`

`O'I = UI = N
`
`~
`~
`'N
`-....l
`d r.,;_
`
`Fig. 1 B
`
`H V G S S S R K L P L R A P L P R V Y
`CACGTCGGCAGCTCCTCGCGTAAGCTGCCTCTGAGAGCGCCTCTGCCCCGTGTCTACTAG 3060
`
`GGAGCAAAAGGTTTGGACCACGACTCTTAACCGTCGTGATCTCGCCAATTGGGATGTGQAGGCTCAGGACTGGGTCATCACAAAGTACCCCAAGAAAGTG 3000
`
`T K Y P K K V
`
`I
`
`E Q K V W T T T L N R R D L A N W D V E A Q D W V
`
`~
`
`....
`0 ....
`('D ....
`rJJ =(cid:173)
`
`N
`
`('D
`
`....
`2' :-'
`
`-...J
`0
`0
`N
`~-...J
`
`~ = ~
`
`~
`~
`~
`•
`00
`
`e •
`
`TTGCAATTTGGCTAACTCGCTTCTAGTATGTTTCACTGGGCGGACCGAACGAGCCTCGGGTCGTTCTGCGCAAGTTCGACCGAATCTTCCTGGCTCCTGG 2900
`Y Q D L V R V S A T
`
`I F L A P G
`
`Y V S L G G P N E P R V V L R K F D R
`
`I T N T G N V A G Y E V P Q L
`
`TATCAGGATCTTGTTAGGGTGTCGGCCACCATAACCAACACTGGTAACGTCGCCGGTTATGAAGTCCCTCAATTGGTGAGTGACCCGCATGTTCCTTGCG 2800
`
`CGGCTGGGAGGACTCGGAGTACATTCCCGAAGGCGCTAGGGATGGGTCTCCTCAACCCCTCCTGAAGGCTGGCGGCGCTCCTGGTGGTAACCCTACCCTT 2700
`A D Y L Y P E G L K R
`CCGACTACCTGTATCCCGAGGGTCTCAAAAGAATTACCAAGTTTATTTACCCTTGGCTCAACTCGACCGACCTCGAGGATTCTTCTGACGACCCGAACTA 2600
`
`P E G A R D G S P Q P L L K A G G A P G G N P T L
`
`I
`
`G W E D S E Y
`
`I Y P W L N S T D L E D S S D D P N Y
`
`T K F
`
`I
`
`H L R V Q A L N S S S
`CACCTTCGGGTTCAGGCCCTCAATAGTTCGAGTTCGGCATATGTCCCGACTAGCGGAGAGACCAAGCCTGCGCCAACCTATGGTGAGATCGGTAGTGCCG 2500
`
`S A Y V P T S G E T K P A P T Y G E
`
`I G S A
`
`I Y E F G H G L S Y T T F G Y S
`
`I D Y R H F D K R N E T P
`
`E G V F
`
`CGAGGGCGTCTTCATTGACTACCGTCACTTTGACAAGCGCAATGAGACCCCCATTTATGAGTTTGGCCATGGCTTGAGCTACACCACCTTTGGTTACTCT 2400
`A K T P F T W G K T R E S Y G A P L L T E P N N G N G A P Q D D F N
`CCAAGACCCCGTTCACCTGGGGCAAGACTCGGGAGTCTTACGGGGCTCCCTTGCTCACCGAGCCTAACAATGGCAATGGTGCTCCCCAGGATGATTTCAA 2300
`D NP NV TA I I.WAG LPG Q E S G NS L VD V LY GR V NP S
`GATAACCCCAACGTCACTGCCATCATCTGGGCCGGCTTGCCCGGTCAGGAGAGTGGCAACTCCCTGGTCGACGTGCTCTATGGCCGCGTCAACCCCAGCG 2200
`
`I D R W Y
`
`I H S V G P V L
`
`I V V
`
`I D T V V S H C N N T
`
`K N G E A V
`
`GAAGAACGGCGAGGCCGTCATTGACACTGTTGTCAGCCACTGCAACAACACGATTGTGGTTATTCACAGTGTTGGGCCCGTCTTGATCGACCGGTGGTAT 2100
`
`TTGCGAACAGCGTGTCTTTGGTGTTTGTCAACGCCGACTCTGGAGAGGGTTTCATCAGTGTCGACGGCAACGAGGGTGACCGCAAAAATCTCACTCTGTG 2000
`
`S V D G N E G D R K N L T L W
`
`I
`
`V S L V F V N A D S G E G F
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 3 of 13
`
`US 7,244,605 B2
`
`Apa LI (6473)
`
`Sa/ I (242) C/a I (393)
`C/a I (735)
`Eco RI (768)
`Be/ I (783)
`
`--NA2-tpi Promoter
`
`Bel I (1076)
`Pst I (1188)
`Nco I (1389)
`Not I (1400)
`
`Ava I (1430)
`Xma I (1430)
`ma I (1432)
`Be/ I (1532)
`AMG Terminator
`
`Eco RV (1616)
`Eco RV (1749)
`C/a I (2132)
`Be/ I (2190)
`Sac I (2363)
`Eco RV (2442)
`Apa LI (2913)
`Eco RV (3032)
`
`I LI (5227)
`
`pAILo1
`6914 bp
`
`oa LI (4730)
`Pst I (4248)
`Pst I (4062)
`Sma I (3958
`Xma I (3956 _.,.....-....~¥-1111--lllf',
`Ava I (3956)
`Barn HI (3712)
`Pst I (3674)
`
`amdS
`
`Fig. 2
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 4 of 13
`
`US 7,244,605 B2
`
`EcoRI (773)
`T AKA Promoter
`
`Eco RI (2010)
`Eco RI (2091)
`Pac I (2305)
`AMG Terminator
`Nco I (2502)
`Nsil (2628)
`
`pBANe10
`6731 bp
`
`pyrG
`
`pyrG
`
`Fig. 3
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 5 of 13
`
`US 7,244,605 B2
`
`T AKA Promoter
`
`blaA
`
`pAILo2
`5827 bp
`
`Notl (1400)
`Paci (1446)
`AMG Terminator
`
`Nstl (3406)
`Xhol (3319)
`
`PyrG
`
`Fig. 4
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 6 of 13
`
`US 7,244,605 B2
`
`TAKA Promoter
`Eco RI (8212)
`
`Neal (624)
`EcoRI (635)
`
`b-Lactamase
`
`pEJG97
`8831 bp
`
`Neal (2370)
`
`AMG Terminator
`
`BamHI (3548)
`PyrG
`
`PyrG
`
`Fig. 5
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 7 of 13
`
`US 7,244,605 B2
`
`Sa/I (242)
`
`EcoRI (768)
`TAKA Promoter
`
`AmpR
`
`pMJ04
`7119 bp
`
`Ncol (1389)
`Notl (1400)
`Spel (1419)
`Trcbh1 terminator
`Paci (1651)
`
`BamHI (3917)
`
`AMDS
`
`Fig. 6
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 8 of 13
`
`US 7,244,605 B2
`
`Apa LI (6515)
`
`Sall (242)
`
`TrCBHI promoter
`Ava I (867)
`Ava I (875)
`Hin dlll (1026)
`Nco I (1234)
`Xma I (1339)
`Aval (1339)
`Smal (1341)
`TrCBHI terminator
`Be/I (1574)
`Eco RV (1658)
`Eco RV (1791)
`C/a I (2174)
`Be/I (2232)
`Sac I (2405)
`Eco RV (2484)
`Apa LI (2955)
`Eco RV (307 4)
`amds (Aspergillus nidulans)
`
`Apa LI (5269)
`
`pMJ06
`6956q,
`
`Apa LI (4772)
`Pstl (4290)
`Pstl (4104)
`Smal (4000)
`Aval (3998)
`Xmal (3998)
`8am HI (3754)
`Pstl (3716)
`
`Fig. 7
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 9 of 13
`
`US 7,244,605 B2
`
`Apa LI (6770)
`
`Sa/ I (242)
`
`TrCBHI promoter
`Ava I (867)
`Ava I (875)
`Hin dlll (1026)
`Nco I (1234)
`Xma I (1345)
`Ava I (1345)
`Sma I (1347)
`TrCBHI terminator
`Be/ I (1829)
`Eco RV (1913)
`Eco RV (2046)
`
`C/a I (2429)
`Be/ I (2487)
`Sac I (2660)
`Eco RV (2739)
`Apa LI (3210)
`Eco RV (3329)
`AMOS
`
`Apa LI (5524)
`
`Apa LI ( 5027)
`
`pMJ09
`n11 bp
`
`Pst I (4545)
`Pstl (4359)
`
`Sma I (4255) --
`
`Ava I (4253)
`Xma I (4253)
`Barn HI (4009)
`Pst I (3971)
`
`Fig. 8
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 10 of 13
`
`US 7,244,605 B2
`
`pEJG107
`10241 bp
`
`EcoRI (1867)
`
`AfumigatusFAM3A
`
`BamHI (7039)
`
`TrCBHITerminator
`
`Fig. 9
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 11 of 13
`
`US 7,244,605 B2
`
`Thermal Stability of A. fumigatis Fam 3a BG
`(AFum3BG_D/C) with PNPBDG - 24h time
`[protein] = 6.9 X 10-6
`
`c.. z c.. 70.0
`.S 60.0
`5 50.0
`-~ 40.0
`~ 30.0
`C: o 20.0
`0
`0 10.0
`~ 0.0
`
`~50deg
`-65deg
`
`0
`
`50
`
`100
`Time
`
`150
`
`200
`
`Fig. 10
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 12 of 13
`
`US 7,244,605 B2
`
`Thermal Stability of A. fumigatis Fam-3a BG
`(AFum3BG_D/C) at 70 deg C
`[protein] = 5.6 X 1 o-6 mg/ml
`a.
`z a. 14.00 ~ - - - - - - - - - - - - - - -~
`.S 12.00 + - - - - - - - - - - - - - - - - - - c= - - l l f - - - - - - l
`5 10.00 + - - - - - - - - - - - -= - - - " " " ' - - - - - - - - - I
`f 8.00 + - - - - - - - -~ - - - - - - - - - - !
`~ 6.00 + - - - - - - - - - - - , - - - - - - - - - - - - - - -1
`5 4.00 + - - -~ - " " " ' - - - - - - - - - - - - - - - - - !
`O 2.00 + - - - - - - - - - - - - - - - - - - - - - - - - - - -1
`"#. 0.00 + - - - - - -~ - - - - - - - - - - - - - !
`0
`60
`120
`180
`240
`300
`360
`Time (min)
`
`Fig. 11
`
`

`

`U.S. Patent
`
`Jul. 17, 2007
`
`Sheet 13 of 13
`
`US 7,244,605 B2
`
`Hydrolysis of Cellobiose at 65 deg C by
`
`A. furn Fam 3
`
`60
`50
`40
`30
`20
`10
`0
`
`0 -C
`C -0
`
`0
`Cl)
`tn
`tn
`a.. 0
`Cl) u
`>
`::I
`(!)
`
`0
`~ 0
`
`0
`
`5
`
`15
`
`10
`Time (h)
`
`20
`
`25
`
`-+- 3.70E-05 mg/ml AFum
`
`---- 9.20E-06 mg/ml AFum
`
`Fig. 12
`
`

`

`US 7,244,605 B2
`
`1
`POLYPEPTIDES HAVING
`BETA-GLUCOSIDASE ACTIVITY AND
`POLYNUCLEOTIDES ENCODING SAME
`
`CROSS-REFERENCE TO RELATED
`APPLICATION
`
`This application claims the benefit of U.S. Provisional
`Application No. 60/515,482, filed Oct. 28, 2003, which
`application is incorporated herein by reference.
`
`STATEMENT AS TO RIGHTS TO INVENTIONS
`MADE UNDER FEDERALLY SPONSORED
`RESEARCH AND DEVELOPMENT
`
`This invention was made with Govermnent support under
`NREL Subcontract No. ZCO-30017-02, Prime Contract
`DE-AC36-98GO10337 awarded by the Department of
`Energy. The govermnent has certain rights in this invention.
`
`BACKGROUND OF THE INVENTION
`
`2
`drolase to enhance the hydrolysis. However, the quantities
`required are too costly for a commercial biomass to ethanol
`operation.
`A second approach is to carry out cellulose hydrolysis
`5 simultaneously with fermentation of the glucose by yeast.
`This process is known as simultaneous saccharification and
`fermentation (SSF). In an SSF system, fermentation of the
`glucose removes it from solution. However, SSF systems are
`not yet commercially viable because the operating tempera-
`10 ture for yeast of 28° C. is too low for the 50° C. conditions
`required.
`A third approach to overcome the shortage of beta(cid:173)
`glucosidase is to overexpress the beta-glucosidase in a host,
`thereby increasing the yield of beta-glucosidase.
`Ximenes et al., 1996, Current Microbiology 32: 119-123;
`Hang and Woodams, 1994, Lebensmittel-Wissenschafl and
`Technologie 27: 587-589; and Kitpreechavanich et al., Agri(cid:173)
`cultural and Biological Chemistry 50: 1703-1712, disclose
`beta-glucosidases from Aspergilllus fumigatus.
`It would be very advantageous in the art to use a ther(cid:173)
`mostable beta-glucosidase for converting cellulosic materi(cid:173)
`als to monosaccharides, disaccharides, and polysaccharides
`to improve process efficiency.
`It is an object of the present invention to provide new
`25 polypeptides having beta-glucosidase activity and nucleic
`acid encoding the polypeptides.
`
`15
`
`20
`
`SUMMARY OF THE INVENTION
`
`1. Field of the Invention
`The present invention relates to isolated polypeptides
`having beta-glucosidase activity and isolated polynucle(cid:173)
`otides encoding the polypeptides. The invention also relates
`to nucleic acid constructs, vectors, and host cells comprising
`the polynucleotides as well as methods for producing and
`using the polypeptides.
`2. Description of the Related Art
`Cellulose is a polymer of the simple sugar glucose
`covalently bonded by beta-1,4-linkages. Many microorgan(cid:173)
`isms produce enzymes that hydrolyze beta-linked glucans.
`These enzymes include endoglucanases, cellobiohydrolases, 35
`and beta-glucosidases. Endoglucanases digest the cellulose
`polymer at random locations, opening it to attack by cello(cid:173)
`biohydrolases. Cellobiohydrolases sequentially release mol(cid:173)
`ecules of cellobiose from the ends of the cellulose polymer.
`Cellobiose is a water-soluble beta-1,4-linked dimer of glu-
`case. Beta-glucosidases hydrolyze cellobiose to glucose.
`The conversion of cellulosic feedstocks into ethanol has
`the advantages of the ready availability of large amounts of
`feedstock, the desirability of avoiding burning or land filling
`the materials, and the cleanliness of the ethanol fuel. Wood, 45
`agricultural residues, herbaceous crops, and municipal solid
`wastes have been considered as feedstocks for ethanol
`production. These materials primarily consist of cellulose,
`hemicellulose, and lignin. Once the cellulose is converted to
`glucose, the glucose is easily fermented by yeast into
`ethanol. Since glucose is readily fermented to ethanol by a
`variety of yeasts while cellobiose is not, any cellobiose
`remaining at the end of the hydrolysis represents a loss of
`yield of ethanol. More importantly, cellobiose is a potent
`inhibitor of endoglucanases and cellobiohydrolases. The
`accumulation of cellobiose during hydrolysis is extremely
`undesirable for ethanol production.
`Cellobiose accumulation has been a major problem in
`enzymatic hydrolysis because cellulase-producing microor(cid:173)
`ganisms produce little beta-glucosidase. The low amount of 60
`beta-glucosidase results in a shortage of capacity to hydro(cid:173)
`lyze the cellobiose to glucose. Several approaches have been
`used to increase the amount ofbeta-glucosidase in cellulose
`conversion to glucose.
`One approach is to produce beta-glucosidase using micro- 65
`organisms that produce little cellulase, and add the beta(cid:173)
`glucosidase exogenously to endoglucanase and cellobiohy-
`
`30
`
`40
`
`50
`
`The present invention relates to isolated polypeptides
`having beta-glucosidase activity selected from the group
`consisting of:
`(a) a polypeptide having an amino acid sequence which
`has at least 85% identity with amino acids 20 to 863 of SEQ
`ID NO: 2;
`(b) a polypeptide which is encoded by a nucleotide
`sequence which hybridizes under at least high stringency
`conditions with (i) nucleotides 58 to 2580 of SEQ ID NO:
`1, (ii) the cDNA sequence contained in nucleotides 58 to
`2580 of SEQ ID NO: 1, or (iii) a complementary strand of
`(i) or (ii); and
`( c) a variant comprising a conservative substitution, dele(cid:173)
`tion, and/or insertion of one or more amino acids of amino
`acids 20 to 863 of SEQ ID NO: 2.
`The present invention also relates to isolated polynucle(cid:173)
`otides encoding polypeptides having beta-glucosidase activ(cid:173)
`ity, selected from the group consisting of:
`(a) a polynucleotide encoding a polypeptide having an
`amino acid sequence which has at least 85% identity with
`amino acids 20 to 863 of SEQ ID NO: 2;
`(b) a polynucleotide having at least 85% identity with
`nucleotides 58 to 2580 of SEQ ID NO: 1; and
`( c) a polynucleotide which hybridizes under at least high
`55 stringency conditions with (i) nucleotides 58 to 2580 of SEQ
`ID NO: 1, (ii) the cDNA sequence contained in nucleotides
`58 to 2580 of SEQ ID NO: 1, or (iii) a complementary strand
`of (i) or (ii).
`The present invention also relates to nucleic acid con(cid:173)
`structs, recombinant expression vectors, and recombinant
`host cells comprising the polynucleotides.
`The present invention also relates to methods for produc-
`ing such polypeptides having beta-glucosidase activity com(cid:173)
`prising (a) cultivating a recombinant host cell comprising a
`nucleic acid construct comprising a polynucleotide encoding
`the polypeptide under conditions conducive for production
`of the polypeptide; and (b) recovering the polypeptide.
`
`

`

`US 7,244,605 B2
`
`3
`The present invention also relates to detergent composi(cid:173)
`tions comprising the polypeptides having beta-glucosidase
`activity.
`The present invention also relates to plants encoding the
`polypeptides having beta-glucosidase activity.
`The present invention further relates to using the polypep(cid:173)
`tides having beta-glucosidase activity in the conversion of
`cellulosic materials to monosaccharides, disaccharides, and
`polysaccharides.
`The present invention further relates to nucleic acid
`constructs comprising a gene encoding a protein, wherein
`the gene is operably linked to a nucleotide sequence encod(cid:173)
`ing a signal peptide consisting of nucleotides 1 to 57 of SEQ
`ID NO: 1, wherein the gene is foreign to the first and second
`nucleotide sequences.
`
`BRIEF DESCRIPTION OF THE FIGURES
`
`FIGS. lA and 1B show the genomic DNA sequence and
`the deduced amino acid sequence of an Aspergillus fumiga(cid:173)
`tus beta-glucosidase (SEQ ID NOs: 1 and 2, respectively).
`The predicted signal peptide is underlined and predicted
`intrans are italicized.
`FIG. 2 shows a restriction map of pAlLol.
`FIG. 3 shows a restriction map ofpBANel0.
`FIG. 4 shows a restriction map of pA1Lo2.
`FIG. 5 shows a restriction map ofpEJG97.
`FIG. 6 shows a restriction map of pMJ04.
`FIG. 7 shows a restriction map of pMJ06.
`FIG. 8 shows a restriction map ofpMJ09.
`FIG. 9 shows a restriction map ofpEJG107.
`FIG. 10 shows the thermal stability of Aspergillus fumi(cid:173)
`gatus beta-glucosidase at 50° and 65° C.
`FIG. 11 shows the thermal stability of Aspergillus fumi(cid:173)
`gatus beta-glucosidase at 70° C.
`FIG. 12 shows the hydrolysis of cellobiose by Aspergillus
`fumigatus beta-glucosidase at 65° C.
`
`DEFINITIONS
`
`Beta-glucosidase activity: The term "beta-glucosidase" is
`defined herein as a beta-D-glucoside glucohydrolase (E.C.
`3.2.1.21) which catalyzes the hydrolysis of terminal non(cid:173)
`reducing beta-D-glucose residues with the release of beta(cid:173)
`D-glucose. For purposes of the present invention, beta(cid:173)
`glucosidase activity is determined according to the basic
`procedure described by Venturi et al., 2002, J. Basic Micro(cid:173)
`bial. 42: 55-66, except different conditions were employed
`as described herein. One unit of beta-glucosidase activity is
`defined as 1.0 µmole of p-nitrophenol produced per minute 50
`at 50° C., pH 5 from 4 mM p-nitrophenyl-beta-D-glucopy(cid:173)
`ranoside as substrate in 100 mM sodium citrate, 0.01 %
`Tween-20.
`Family GH3AA beta-glucosidase: The term "Family
`GH3AA beta-glucosidase" is defined herein as a glycoside 55
`hydrolase of Family 3 according to Coutinho, P. M. and
`Henrissat, B., 1999, Carbohydrate-active enzymes: an inte(cid:173)
`grated database approach, in "Recent Advances in Carbo(cid:173)
`hydrate Bioengineering", H.J. Gilbert, G. Davies, B. Hen(cid:173)
`rissat and B. Svensson eds., The Royal Society of Chemistry, 60
`Cambridge, pp. 3-12.
`The polypeptides of the present invention have at least
`20%, preferably at least 40%, more preferably at least 50%,
`more preferably at least 60%, more preferably at least 70%,
`more preferably at least 80%, even more preferably at least 65
`90%, most preferably at least 95%, and even most preferably
`at least 100% of the beta-glucosidase activity of the
`
`25
`
`4
`polypeptide consisting of the amino acid sequence shown as
`amino acids 20 to 863 of SEQ ID NO: 2.
`Isolated polypeptide: The term "isolated polypeptide" as
`used herein refers to a polypeptide which is at least 20%
`5 pure, preferably at least 40% pure, more preferably at least
`60% pure, even more preferably at least 80% pure, most
`preferably at least 90% pure, and even most preferably at
`least 95% pure, as determined by SDS-PAGE.
`Substantially pure polypeptide: The term "substantially
`10 pure polypeptide" denotes herein a polypeptide preparation
`which contains at most 10%, preferably at most 8%, more
`preferably at most 6%, more preferably at most 5%, more
`preferably at most 4%, at most 3%, even more preferably at
`most 2%, most preferably at most 1 %, and even most
`15 preferably at most 0.5% by weight of other polypeptide
`material with which it is natively associated. It is, therefore,
`preferred that the substantially pure polypeptide is at least
`92% pure, preferably at least 94% pure, more preferably at
`least 95% pure, more preferably at least 96% pure, more
`20 preferably at least 96% pure, more preferably at least 97%
`pure, more preferably at least 98% pure, even more prefer(cid:173)
`ably at least 99%, most preferably at least 99.5% pure, and
`even most preferably 100% pure by weight of the total
`polypeptide material present in the preparation.
`The polypeptides of the present invention are preferably
`in a substantially pure form. In particular, it is preferred that
`the polypeptides are in "essentially pure form", i.e., that the
`polypeptide preparation is essentially free of other polypep(cid:173)
`tide material with which it is natively associated. This can be
`30 accomplished, for example, by preparing the polypeptide by
`means of well-known recombinant methods or by classical
`purification methods.
`Herein, the term "substantially pure polypeptide" is syn(cid:173)
`onymous with the
`terms "isolated polypeptide" and
`35 "polypeptide in isolated form."
`Identity: The relatedness between two amino acid
`sequences or between two nucleotide sequences is described
`by the parameter "identity".
`For purposes of the present invention, the degree of
`40 identity between two amino acid sequences is determined by
`the Clustal method (Higgins, 1989, CABIOS 5: 151-153)
`using
`the LASERGENE™ MEGALIGWM
`software
`(DNASTAR, Inc., Madison, Wis.) with an identity table and
`the following multiple alignment parameters: Gap penalty of
`45 10 and gap length penalty of 10. Pairwise alignment param(cid:173)
`eters are Ktuple=l, gap penalty=3, windows=5, and diago(cid:173)
`nals=5.
`For purposes of the present invention, the degree of
`identity between two nucleotide sequences is determined by
`the Wilbur-Lipman method (Wilbur and Lipman, 1983,
`Proceedings of the National Academy of Science USA 80:
`726-730) using the LASERGENE™ MEGALIGWM soft(cid:173)
`ware (DNASTAR, Inc., Madison, Wis.) with an identity
`table and the following multiple alignment parameters: Gap
`penalty of 10 and gap length penalty of 10. Pairwise
`alignment parameters are Ktuple=3, gap penalty=3, and
`windows=20.
`Polypeptide Fragment: The term "polypeptide fragment"
`is defined herein as a polypeptide having one or more amino
`acids deleted from the amino and/or carboxyl terminus of
`SEQ ID NO: 2 or a homologous sequence thereof, wherein
`the fragment has beta-glucosidase activity. Preferably, a
`fragment contains at least 770 amino acid residues, more
`preferably at least 800 amino acid residues, and most
`preferably at least 830 amino acid residues.
`Subsequence: The term "subsequence" is defined herein
`as a nucleotide sequence having one or more nucleotides
`
`

`

`US 7,244,605 B2
`
`5
`deleted from the 5' and/or 3' end of SEQ ID NO: 1 or a
`homologous sequence thereof, wherein the subsequence
`encodes a polypeptide fragment having beta-glucosidase
`activity. Preferably, a subsequence contains at least 2310
`nucleotides, more preferably at least 2400 nucleotides, and 5
`most preferably at least 2490 nucleotides.
`Allelic variant: The term "allelic variant" denotes herein
`any of two or more alternative forms of a gene occupying the
`same chromosomal locus. Allelic variation arises naturally
`through mutation, and may result in polymorphism within
`populations. Gene mutations can be silent (no change in the
`encoded polypeptide) or may encode polypeptides having
`altered amino acid sequences. An allelic variant of a
`polypeptide is a polypeptide encoded by an allelic variant of
`a gene.
`Isolated polynucleotide: The term "isolated polynucle(cid:173)
`otide" as used herein refers to a polynucleotide which is at
`least 20% pure, preferably at least 40% pure, more prefer(cid:173)
`ably at least 60% pure, even more preferably at least 80%
`pure, most preferably at least 90% pure, and even most
`preferably at least 95% pure, as determined by agarose
`electrophoresis.
`Substantially pure polynucleotide: The term "substan(cid:173)
`tially pure polynucleotide" as used herein refers to a poly(cid:173)
`nucleotide preparation free of other extraneous or unwanted
`nucleotides and in a form suitable for use within genetically
`engineered protein production systems. Thus, a substantially
`pure polynucleotide contains at most 10%, preferably at
`most 8%, more preferably at most 6%, more preferably at
`most 5%, more preferably at most 4%, more preferably at 30
`most 3%, even more preferably at most 2%, most preferably
`at most 1 %, and even most preferably at most 0.5% by
`weight of other polynucleotide material with which it is
`natively associated. A substantially pure polynucleotide
`may, however, include naturally occurring 5' and 3' untrans- 35
`lated regions, such as promoters and terminators. It is
`preferred that the substantially pure polynucleotide is at least
`90% pure, preferably at least 92% pure, more preferably at
`least 94% pure, more preferably at least 95% pure, more
`preferably at least 96% pure, more preferably at least 97% 40
`pure, even more preferably at least 98% pure, most prefer(cid:173)
`ably at least 99%, and even most preferably at least 99.5%
`pure by weight. The polynucleotides of the present invention
`are preferably in a substantially pure form. In particular, it is
`preferred that the polynucleotides disclosed herein are in 45
`"essentially pure form", i.e., that the polynucleotide prepa(cid:173)
`ration is essentially free of other polynucleotide material
`with which it is natively associated. Herein, the term "sub(cid:173)
`stantially pure polynucleotide" is synonymous with the
`terms "isolated polynucleotide" and "polynucleotide in iso- 50
`lated form." The polynucleotides may be of genomic,
`cDNA, RNA, semisynthetic, synthetic origin, or any com(cid:173)
`binations thereof.
`cDNA: The term "cDNA" is defined herein as a DNA
`molecule which can be prepared by reverse transcription
`from a mature, spliced, mRNA molecule obtained from a
`eukaryotic cell. cDNA lacks intron sequences that are usu(cid:173)
`ally present in the corresponding genomic DNA. The initial,
`primary RNA transcript is a precursor to mRNA which is
`processed through a series of steps before appearing as
`mature spliced mRNA. These steps include the removal of
`intron sequences by a process called splicing, cDNA derived
`from mRNA lacks, therefore, any intron sequences.
`Nucleic acid construct: The term "nucleic acid construct"
`as used herein refers to a nucleic acid molecule, either
`single- or double-stranded, which is isolated from a natu(cid:173)
`rally occurring gene or which is modified to contain seg-
`
`6
`ments of nucleic acids in a manner that would not otherwise
`exist in nature. The term nucleic acid construct is synony(cid:173)
`mous with the term "expression cassette" when the nucleic
`acid construct contains the control sequences required for
`expression of a coding sequence of the present invention.
`Control sequence: The term "control sequences" is
`defined herein to include all components, which are neces(cid:173)
`sary or advantageous for the expression of a polynucleotide
`encoding a polypeptide of the present invention. Each con-
`10 trol sequence may be native or foreign to the nucleotide
`sequence encoding the polypeptide. Such control sequences
`include, but are not limited to, a leader, polyadenylation
`sequence, propeptide sequence, promoter, signal peptide
`sequence, and transcription terminator. At a minimum, the
`15 control sequences include a promoter, and transcriptional
`and translational stop signals. The control sequences may be
`provided with linkers for the purpose of introducing specific
`restriction sites facilitating ligation of the control sequences
`with the coding region of the nucleotide sequence encoding
`20 a polypeptide.
`Operably linked: The term "operably linked" denotes
`herein a configuration in which a control sequence is placed
`at an appropriate position relative to the coding sequence of
`the polynucleotide sequence such that the control sequence
`25 directs the expression of the coding sequence of a polypep(cid:173)
`tide.
`Coding sequence: When used herein the term "coding
`sequence" means a nucleotide sequence, which directly
`specifies the amino acid sequence of its protein product. The
`boundaries of the coding sequence are generally determined
`by an open reading frame, which usually begins with the
`ATG start codon or alternative start codons such as GTG and
`TTG. The coding sequence may a DNA, cDNA, or recom(cid:173)
`binant nucleotide sequence.
`Expression: The term "expression" includes any step
`involved in the production of the polypeptide including, but
`not limited to, transcription, post-transcriptional modifica(cid:173)
`tion, translation, post-translational modification, and secre(cid:173)
`tion.
`Expression vector: The term "expression vector" is
`defined herein as a linear or circular DNA molecule that
`comprises a polynucleotide encoding a polypeptide of the
`invention, and which is operably linked to additional nucle-
`otides that provide for its expression.
`Host cell: The term "host cell", as used herein, includes
`any cell type which is susceptible to transformation, trans(cid:173)
`fection, transduction, and the like with a nucleic acid con(cid:173)
`struct or expression vector comprising a polynucleotide of
`the present invention.
`Modification: The term "modification" means herein any
`chemical modificat