AND BIOENGINEERINO
`JOURNAL OF FERMENTATION
`vol. 76, No. 4. 265-269. 1993
`
`Cloning, Nucleotide Sequence, and Expression in Escherichia coli
`of DNA Polymerase Gene (poL4) from
`Thermus thermophilus HI38
`KEIKO ASAKURA,’ HIDEYUKI KOMATSUBARA,2 SHIRO SOGA,’ TETSUYA YOMO,,’ MASANORI OKA,
`SHIGENORI EML2 AND
`ITARU URABE’*
`Suita, Osaka 565’ and
`Faculty of Engineering,
`Osaka University,
`2-I Yamadaoka,
`Institute
`of Biotechnology,
`IO-24 Toyo-cho,
`Tsuruga, Fukui 914,2 Japan
`
`of Biotechnology,
`Toyobo
`Tsuruga
`
`Department
`
`Received
`
`13 May
`
`1993/Accepted
`
`29 June
`
`1993
`
`thermophilus
`from Thermus
`I) was cloned
`I (Tth Pol
`DNA polymerase
`for a thermostable
`A gene coding
`frame of 2505
`HB8, and
`its nucleotide
`sequence was identified.
`The Tth Pol
`I gene @olA) has an open
`reading
`frame was also
`base pairs available
`to encode a peptide of 834 amino acids. Another
`incomplete
`open reading
`found upstream
`from
`the poOl gene. In the deduced amino acid sequence of Tth Pol I, which shows 87% simi-
`larity
`to that of Thermus aquaticus DNA polymerase,
`there
`is the leucine
`zipper structure
`from Leu458
`to
`Leu486. The Tth Pol
`I gene was subcloned
`in a high-expression
`vector. Escherichia
`coli cells harboring
`the
`hybrid
`plasmid produced
`about 100,000 units of thermostable
`DNA polymerase
`in a 200-ml culture.
`
`thermophilic bacteria is highly
`DNA polymerase from
`useful in the polymerase chain reaction (PCR) method (1).
`Previously, a DNA polymerase (Taq Pol I) was purified
`from Thermus
`(2), and its gene was cloned,
`aquaticus
`sequenced, and expressed in Escherichia
`coli (3). Another
`thermostable DNA polymerase I (Tth Pol I) was purified
`from Thermus
`HB8, and has been shown to
`thermophilus
`be useful in the PCR method (unpublished results). In this
`work, we cloned the Tth Pol I gene @o/.4) and expressed it
`in E. cob cells. The nucleotide sequence of the polA gene
`was identified and compared with those of other known
`genes. The cloned gene and the production system will be
`useful for the study and application of this enzyme.
`
`AND METHODS
`MATERIALS
`HB8
`strains and plasmids
`T. thermophilus
`Bacterial
`(4), a generous gift
`from Dr. Tairo Oshima (Tokyo
`In-
`stitute of Technology), was used as the source of Tth Pol I
`and its gene. The following bacterial strains and plasmids
`were used: E. colt’ strains JM109 (recA
`I B(lac-pro)
`endAl
`gyrA96
`thi-I
`hsdRl7
`supE44
`relA1,
`F’
`traD36
`proAB)
`(S), and KP3998 (F- hsdS20
`(ra- me-) ara-14
`proA
`supE44 A-) (6); and plas-
`IacP galK2
`rpsL20
`xyl-5 mlt-l
`mids pUC 18 (7), pUCl9
`(5, 7), and pKP1500 (6). E. coli
`KP3998 and pKPl500 were a generous gift
`from Dr.
`Takeyoshi Miki (Kyushu University). T, thermophilus
`was
`grown at 75OC on a medium containing
`tryptone
`(2Og),
`yeast extract (IO g), and NaCl (10 g) in 1 I (pH 7.2); E. coli
`was grown at 37°C on Luria-Bertani medium (8) contain-
`ing ampicillin (50 /[g/ml, when necessary).
`Purified Tth Pol I, restric-
`Enzymes
`and chemicals
`tion endonucleases, and other enzymes for DNA manipula-
`tion were obtained
`from Toyobo Co. Ltd. (Osaka). Taq
`Pol I was purchased from Takara Shuzo Co. Ltd. (Kyoto).
`Prepara-
`DNA
`manipulation
`and
`transformation
`tion of plasmid DNA, enzyme reactions, and transfor-
`mation of E. coli cells was carried out as described by
`
`* Corresponding
`
`author.
`
`Maniatis et al.
`(8).
`Partial
`DNA
`probe
`and
`of primers
`Preparation
`amino acid sequences of Tth Pol I were identified by au-
`tomated Edman sequencing of peptide
`fragments ob-
`tained by digestion with Achromobacter
`protease I. To
`prepare probe DNAs by the PCR method
`(1), the fol-
`lowing DNA
`primers were prepared:
`primer
`1 (5’-
`ATGAGGGGGATGCTGCCCCTCTTTGAG-3’),
`encoding
`the N-terminal sequence of Taq Pol I (3); primer 2 (5’-
`GACATCCACACGCAGACCGCCAGCTGGATGTTC-
`3’), encoding an amino acid sequence of Tth Pol I iden-
`tified in this study (Asp-Ile-His-Thr-Gln-Thr-Ala-Ser-X-
`Met-Phe), which is almost the same as that of Taq Pol I
`(Asp637-Ile-His-Thr-Glu-Thr-Ala-Ser-Trp-Met-Phe)
`(3);
`primer 3, the anti-sequence of primer 2; primer 4 (5’-
`GTCGGCGGCGGTGCCCTG-3’),
`the anti-sequence of
`the Taq Pol I sequence (Gln754-Gly-Thr-Ala-Ala-Asp)
`which is identical to the E. cob Pol I sequence (3); and
`primer 5 (5’-TCACTCCTTGGCGGAGAGCCA-3’),
`the
`anti-sequence of the Taq Pol I sequence that encoding its
`C-terminal
`region including
`the stop codon. Among these
`primers,
`two pairs (primers 2+4 and primers 2+ 5) were
`able to amplify DNA
`fragments (about 370 and 570 base
`pairs (bp), respectively) which seemed to originate
`from
`the Tth Pol I gene under the following PCR conditions: a
`reaction mixture (0.1 ml) containing 0.3 pg genomic DNA,
`1 /fM each primer, 0.2 mM each dNTP
`(dATP, dCTP,
`dTTP, dGTP), 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl,,
`0.1 mg/ml gelatin, and 2.5 units Taq Pol I, was incubated
`for 30 cycles of 2 min at 92°C 3 min at 50°C and 2 min
`at 72’C using the Program Temperature Control System
`PC-700 (Astec Co. Ltd., Fukuoka).
`to be
`The 370-bp DNA probe
`(probe A) was found
`divided into two parts with a similar size by Hind111 di-
`gestion. We cloned the two parts separately by the follow-
`ing procedure. The 370-bp DNA
`fragment was inserted
`into
`the SmaI site of pUC19, and the resulting hybrid
`plasmid was cut into two parts by Hind111 digestion. The
`longer part was self-ligated into the plasmid pUC19-SH,
`and the shorter one (about 190 bp) was inserted into the
`
`265
`
`Illumina Ex. 1122
`IPR Petition - USP 10,435,742
`
`

`

`266
`
`ASAKURA
`
`ET AL.
`
`H Xb
`
`BH
`
`P HII
`
`J. FERMENT.
`
`BIOENG.,
`
`’
`
`put-19
`
`’
`
`pUC
`
`18
`Xba I.‘Hincli
`
`Xba I/Hincl~
`
`1 Ligation
`
`pUPL-12
`
`pUPL-1253
`
`‘4
`[
`
`region
`
`1
`
`Upstream
`deletion
`BH
`
`I
`
`I
`
`’
`
`PUG18
`
`’
`
`PCR amplilication
`
`I-
`fragment
`
`2.3
`
`kb
`
`Kination
`
`I Klenow
`
`PLED-PC
`
`E
`t=h
`
`NY
`I
`
`7’;’
`
`0
`I
`
`’
`
`’ h
`
`SD
`AATTC~GTTTATCATATIGCCC
`GTCCTCCAAATAGTATACGGG
`
`Nde
`
`I
`
`pKP-1500
`Eco RI/SmaI
`
`L
`
`Ligation
`
`1
`PLED-Ml
`A Sma I
`
`H Xb
`1
`
`pUPL-3
`
`BH
`
`Ban HI
`
`0
`I
`
`I
`
`puc19
`
`J Ligation
`
`pLElJ-Ml’
`
`J Nde
`
`I ;Bam III
`
`Barn III
`
`Ligation
`
`B
`
`PLED-NS
`
`PLED-Ml
`’
`FIG. 1. Scheme for the construction of a Tth Pol I high-expression plasmid, PLED-NS. Restriction sites are abbreviated as follows: B,
`BarnHI; E, EcoRI; H, HindIII; HII,
`ffincll;
`N, N&I; P, PslI; Xb, XbaI;
`Xh, X/toI.
`
`I
`
`resulting in the plasmid pUC19-
`Hind111 site of pUC19,
`HH. Probe Al was obtained as the 180-bp XbaI-Hind111
`fragment of pUCl9-SH,
`and probe A2 was the 180-bp
`HindIII-PstI
`fragment
`of pUC19-HH.
`These probes
`were used for cloning the Tth Pol I gene.
`Cloning of Tth Pol I gene
`Chromosomal DNA of T.
`therrnophilus HB8 prepared by the method of Saito and
`Miura (9) was digested with HindIII. After agarose gel elec-
`trophoresis (8) of the digested DNA,
`fragments of about
`2.8 kilo base pairs (kb) and 3.2 kb that hybridized with
`probe Al and probe A2, respectively, were recovered from
`the gel by the method of Vogelstein and Gillespie (10)
`using a Geneclean kit (BiolOl
`Inc.). The DNA
`fragments
`were ligated with pUC19
`that had been digested with
`HindIII,
`and the ligated DNA was introduced
`into E.
`coli JM109. The plasmid DNA obtained
`from
`the ampi-
`cillin-resistant
`transformants were analyzed by hybridiza-
`tion with probe Al and probe A2, and positive plasmids,
`~1-100 and ~5-7, which hybridized with probe Al and
`probe A2, respectively, were obtained. The inserted 2.8-kb
`Hind111 fragment of ~1-100 was ligated with a modified
`~5-7, which was prepared by digestion of ~5-7 with PstI
`to shorten
`the inserted fragment
`from 3.2 kb to 1.5 kb,
`religation, and then digestion with HindIII.
`The hybrid
`plasmid
`thus obtained was named pUPL1. The 2.8-kb
`Hind111 fragment of ~I-100 was also ligated with another
`modified ~5-7, which was prepared by digestion with
`XhoI and &z/I to shorten the inserted fragment
`to 0.5 kb,
`religation, and then digestion with HindIII.
`This plasmid
`was named pUPL3.
`Subcloning of Tth Pol I gene
`
`The following proce-
`
`frag-
`in Fig. 1. A 4.3-kb XbaI-HincII
`dures are illustrated
`ment of pUPL1 was ligated with pUC18
`that had been
`digested with XbaI and HincII. The resulting hybrid plas-
`mid (pUPL12) was digested with KpnI and XbaI,
`the up-
`stream region of the Tth Pol I gene was shortened by digest-
`ing with exonuclease III and then mung bean nuclease.
`One of the shortened plasmids was named pUPL1253,
`which was the shortest one containing
`the whole Tth Pol
`I gene.
`To increase the expression level of the Tth Pol I gene
`in E. coli,
`the gene was inserted
`in a high-expression
`vector, PLED-MI, which was derived
`from pKP1500
`(6) in our laboratory, as shown in Fig. 1. An N-terminal
`part of the coding region of the Tth Pol I gene was am-
`plified by the PCR method
`(1) using the primers of 5’-
`GGCATATGGAGGCGATGCTTCCGCTCTT-3’
`and 5’-
`GTCGGCGGCGGTGCCCTG-3’;
`by the former primer,
`the NdeI site was introduced overlapping
`the initiation
`codon. 2.3-kb fragments of the PCR products were ob-
`tained by agarose gel electrophoresis as described above,
`the 5’-ends were phosphorylated by polynucleotide kinase,
`and the terminal single-stranded regions of the fragments
`(if present) were filled in by the Klenow
`fragment. The
`2.3-kb DNA
`fragment containing
`the N-terminal part
`of the Tth Pol I gene was inserted into the ,%?a1 site of
`PLED-Ml,
`and the resulting plasmid
`(PLED-PC) was
`digested with NdeI,
`religated, then digested with BumHI
`and religated again to yield the plasmid PLED-NB. The
`remaining C-terminal part of
`the Tth Pol I gene was
`obtained as the Bar?tHI fragment of pUPL3, and was
`inserted into
`the BumHI site of PLED-NB
`to yield the
`
`

`

`STRUCTURE AND EXPRESSION OF TTH POL
`
`I GENE
`
`267
`
`for both strands. The amino acid sequences
`FIG. 2. Nucleotide sequence of the Tth Pol I gene. The nucleotide sequence was identified
`deduced from the nucleotide sequence are also shown below. The amino acid sequences, which are identical
`to the sequences determined by
`automated Edman sequencing of peptide
`fragments of
`the purified enzyme (Ser-Leu-T/~r-Thr-Ser-X-G/y-Glu-Pro-Vul-G/n-A/u-X-~r
`and
`are underlined. The region coding
`for Tth
`Asp-Ile-His-Thr-Glrr-Thr-Ala-Ser-X-Met-Phe-Gly-
`Val-Pro-Pro-Glu-Ala-
`Val-Asp-Pro-Leu-Met),
`Pal I is boxed, and the five leucine residues forming
`the leucine zipper structure are outlined
`in black.
`
`

`

`268
`
`ASAKUlL4
`
`ET AL.
`
`kDal
`
`12345678
`
`94
`
`67
`43
`
`30
`
`gel electropho-
`FIG. 3. Sodium dodecyl sulfate-polyacrylamide
`resis. Electrophoresis was done according
`to the method of Laemmli
`(19). The volume of crude cell extract applied was 10 pl each. Pro-
`tein bands were stained with Coomassie Brilliant Blue R250. Lane
`1, Marker proteins;
`lanes 2-4, crude cell extract before heat treat-
`ment; lanes 5-7, supernatant of heat-treated crude cell extract; lanes
`2 and 5, E. coli KP3998 harboring PLED-Ml
`(negative control);
`lanes 3 and 6, E. co/i KP3998 harboring PLED-NS;
`lanes 4 and 7, E.
`coli JM109 harboring pUPL1253;
`lane 8, purified Tth Pol I (Toyobo;
`40 units).
`
`plasmid PLED-NS.
`E. coli cells
`Preparation of crude enzyme solution
`obtained
`from 200-ml culture were suspended in 10ml
`50 mM Tris-HCl
`(pH 7.5) containing 1 mM EDTA and
`2.4 mM phenylmethanesulfonyl
`fluoride, and disrupted by
`sonication. The supernatant obtained by centrifugation
`(crude cell extract) was heated at 75°C for 30 min, centri-
`fuged, and used as a crude enzyme solution.
`Enzyme assay
`DNA polymerase activity was meas-
`ured at 75°C for 30 min in an assay mixture (50 ~1) con-
`taining 67 mM Tris-HCl
`(pH 8.8), 16mM
`(NH&S04,
`6.7 mM MgCl*, 0.2 mM each dATP, dGTP, and dCTP,
`0.2 mM
`[3H]-dTTP
`(5 ,uCi/mmol), 1 pg M13mp19 single-
`stranded DNA, 10 pmol P7 primer, 1OmM mercaptoeth-
`anol, 5 mg/ml bovine serum albumin, and enzyme solu-
`tion (5 ~1). Reactions were stopped by chilling on ice and
`adding 50 ~1 0.2 M sodium pyrophosphate and 0.1 ml 1
`M perchloric acid, and the mixture was then incubated
`at O’C for more than 10 min. Precipitated DNA was col-
`lected on GF/C
`filter discs, and washed with 0.1 M HCl
`(4 ml), then 95% ethanol (2 ml), dried, and counted. One
`unit of enzyme activity corresponds
`to 10 nmol of the
`deoxynucleotides
`incorporated
`in 30 min.
`
`RESULTS AND DISCUSSION
`The poL4 gene of T. thermophilus was found
`to be
`divided
`into
`two parts by Hind111 digestion, and we
`deduced that a 2.8-kb Hind111 fragment and a 3.2-kb
`Hind111 fragment of the chromosomal DNA were likely
`to contain the N-terminal and C-terminal halves, respec-
`tively, of the gene (data not shown). As there were no other
`fragments suitable for cloning the polA gene,
`restriction
`we decided to clone these two Hind111 fragments sepa-
`rately and to assemble the full-length gene. The cloned
`fragment
`in pUPL1 was sequenced by the dideoxynucleo-
`tide chain-termination method
`(ll), and the results are
`shown in Fig. 2. There is an open reading frame of 2505
`bp available to encode a peptide of 834 amino acids (M,
`94,048). The nucleotide and deduced amino acid sequences
`
`J. FERMENT.
`
`BIOENO.,
`
`(85%
`of the cloned Tth Pol I gene show high similarity
`and 87%
`identities,
`respectively) to
`those of
`the Taq
`Pol I gene (3). Hence, Tth Pol I is a member of family A
`DNA polymerases (12), which include E. cofi DNA poly-
`merase I (Pol I) and Taq Pol I.
`to the polA gene, there is another
`incom-
`In addition
`plete open reading frame which starts beyond the 5’-termi-
`nal of the sequence shown in Fig. 1 and ends at the stop
`codon (TAG) one bp upstream from the initiation codon
`of thepolA gene. The deduced amino acid sequence of the
`is also found in the
`incomplete
`open
`reading
`frame, which
`upper region of the Taq Pol I sequence (3), shows 33.8%
`identity
`(195 amino acids overlap) to that of a putative
`X-Pro dipeptidase encoded in the pepQ gene of E. coli
`(13); this similarity was confirmed
`to be significant by
`the method of Pearson and Lipman
`(14).
`In the amino acid sequence of Tth Pol I (Fig. 2), the
`leucine zipper structure, a periodic repetition of leucine
`residues at every seventh position
`(15), is found
`from
`Leu458 to Leu486 showing the periodic array of five leu-
`tine residues. The same structure
`is also found at the
`corresponding positions
`in the sequences of Taq Pol
`to Leu484) (3) and E. coli Pol I (Leu552
`I (Leu456
`to
`Leu580) (16), though the second Leu is replaced by Val in
`the structure of Taq Pol I and the fourth Leu is replaced
`by Ile in that of E. coli Pol I. The tertiary structure of the
`fragment) of E. coli Pol I (17)
`large fragment
`(Klenow
`shows that the first three Leu residues are on helix H. The
`leucine zipper structure has been found
`in DNA binding
`proteins and is thought
`to facilitate dimerization
`(15, 18).
`As these DNA polymerases are monomeric molecules, the
`leucine zipper structure may have another
`function
`for
`DNA-related enzymes.
`The crude enzyme solution prepared as described under
`from E. coli JM109 cells harbor-
`Materials and Methods
`ing pUPL1 exhibited very low DNA polymerase activity
`(about 40 units/ml culture). To increase the expression of
`the Tth Pol I gene, the upstream region was shortened
`from 700 bp to 100 bp by exonuclease digestion, resulting
`in the plasmid pUPL1253
`(see Fig. 1). By using this plas-
`mid,
`the production
`level was increased to about 300
`units/ml culture. To further
`increase the expression level
`of the gene, the plasmid PLED-NS (see Fig. 1) was pre-
`pared as described under Materials and Methods. E. coli
`cells harboring PLED-NS produced an increased level of
`heat-stable
`polymerase
`activity
`(about
`500 units/ml
`culture). Figure 3 also shows that
`the expression level
`of
`the PLED-NS system is higher
`than
`that of
`the
`pUPL1253 system, although
`the level is still much lower
`than
`that of glucose dehydrogenase genes (20) inserted
`in a similar high-expression vector. It seems that overpro-
`to E. coli.
`duction of Tth Pol I is somewhat harmful
`the original system of T.
`Nevertheless, compared
`to
`thermophilus
`(unpublished results), this expression system
`has advantages
`in the high expression level (about 10
`times larger). In addition, Fig. 3 shows that heat treat-
`ment effectively
`facilitates
`the purification
`of
`thermo-
`stable Pol I by removing other heat-labile proteins in the
`crude cell extract. We believe that
`this system will be a
`good source of enzyme for the study and application of
`Tth Pol I.
`
`REFERENCES
`1. S&i, R. K., Gelfand, D. I-I., Stoffel, S., Scharf, S. J., Higuchi,
`R., Horn, G. T., Mullis, K. B., and Erlich, H. A.: Primer-direct-
`
`

`

`VOL.
`
`76, 1993
`
`STRUCTURE
`
`AND
`
`EXPRESSION
`
`OF TTH
`
`POL
`
`1 GENE
`
`269
`
`with
`of DNA
`amplification
`ed enzymatic
`(1988).
`Science,
`239, 487-491
`polymerase.
`acid
`J. M.: Deoxyribonucleic
`2. Chien,
`A., Edgar.
`D. B.. and Trela,
`Thertttus aquoticus. J.
`polymerase
`from
`the extreme
`thermophile
`Bncteriol.,
`127,
`1550-1557
`(1976).
`K.,
`R. K., Myambo,
`3. Luwyer,
`F. C..
`Slolfel,
`S. Saiki,
`Isolation,
`characterization,
`mond.
`R., and Gelfand,
`D. H.:
`in Escherichia co/i of
`the DNA
`polymerase
`gene
`expression
`Thenttrts nqrralicrrs. J. Biol. Chem.,
`264, 6427-6437
`(1989).
`the?-
`of Thenttus
`Description
`4. Oshimn,
`T.
`and
`Imnhori,
`K.:
`tttophiha
`(Yoshida
`and Oshima)
`comb.
`a nonsporulating
`nov.,
`thermophilic
`bacterium
`from
`a Japanese
`thermal
`spa.
`Int.
`Syst.
`Bacterial.,
`24, 102-I
`12 (1974).
`Improved
`J.:
`5. Ynnisch-Perron,
`C., Vierin.
`J., and Messing,
`phage
`cloning
`and host
`strains:
`nucleotide
`sequences
`of
`mpl8
`and pUCl9
`vectors.
`Gene,
`33.
`103-119
`(1985).
`T.,
`6. Miki,
`T., Yasukochi.
`T., Nagatnni.
`H.,
`Furuno,
`M.. Orita,
`of a
`Ynmnda,
`H.,
`Imolo,
`T.,
`and Horiuchi,
`T.: Construction
`of eu-
`plasmid
`vector
`for
`the
`regulatable
`high
`level
`expression
`in Escherichiu coli: an application
`kariotic
`genes
`to overproduc-
`tion
`of chicken
`lysozvme.
`Protein
`Enn.,
`1. 327-332
`(1987).
`7. Normnder,
`J., Kempe,
`T., nnd Messing,
`J.: Construction
`proved M
`I3 vector
`using oligodeoxynucleotide-directed
`esis. Gene,
`26, 101-106
`(1983).
`8. Mnniatis,
`T., Fritsch,
`E. F.. and Snmbrook.
`ing: a laboratory
`manual.
`Cold Spring
`Harbor
`Spring
`Harbor,
`New York
`(1982).
`of
`9. Saito,
`H.
`nnd Miurn,
`K.:
`Preparation
`ynucleic
`acid
`by phenol
`treatment.
`Biochim.
`619-629
`(1963).
`IO. Vogelstein.
`B.
`
`a
`
`thermostable
`
`DNA
`
`Drum-
`and
`from
`
`J.
`
`Ml3
`the Ml3
`
`im-
`of
`mutagen-
`
`J.: Molecular
`Laboratory,
`
`clon-
`Cold
`
`transforming
`Biophys.
`
`deox-
`Acta,
`72,
`
`and Gillespie,
`
`D.:
`
`Preparation
`
`and
`
`analytical
`
`12.
`
`IS.
`
`from
`
`agarose.
`
`Proc.
`
`Natl.
`
`Acad.
`
`Sci. USA,
`
`shotgun
`
`for
`(1981).
`alignment
`19, 4045-4057
`
`of
`
`D. J.:
`Natl.
`
`Improved
`Acad.
`
`for biological
`tools
`Sci. USA,
`8.5, 2444-
`
`of DNA
`purification
`(1979).
`76, 615-619
`P. H.: A system
`I I. Messing,
`J., Crea, R., and Seeburg,
`DNA
`sequencing.
`Nucleic
`Acids
`Res.,
`9, 309-321
`Ito,
`J. and Braithwaite,
`D. K.: Compilation
`and
`DNA
`polymerase
`sequences.
`Nucleic
`Acids
`Res.,
`(1991).
`between
`sequence
`H.: Nucleotide
`Inokuchi,
`K. nnd
`13. Nakahignshi,
`the rrnA operon
`from Escherichia co/i. Nucleic
`thefadE
`gene and
`Acids
`Res.,
`18, 6439
`(1990).
`14. Pearson,
`W. R. and Lipman,
`sequence
`comparison.
`Proc.
`2448
`(1988).
`S. L.: The
`and McKnight,
`P. F.,
`Johnson,
`W. H.,
`Landschulz,
`common
`to a new class of
`structure
`a hypothetical
`leucine
`zipper:
`1759-1764
`(1988).
`proteins.
`Science,
`240,
`DNA
`binding
`Kelley, W. S., and Grindley,
`N. D. F.: Nucleotide
`16. Joyce,
`C. M.,
`the Escherichiu co/ipo/A
`gene and primary
`sequence
`of
`structure
`of DNA
`polymerase
`I. J. Biol. Chem.,
`257,
`1958-1964
`(1982).
`17. Ollis,
`D. L.,
`Brick,
`P., Hamlin,
`R., Xuong,
`N. G.,
`and Steiz.
`of Escherichiu coli DNA
`T. A.: Structure
`of
`large
`fragment
`poly-
`merase
`I complexed
`with
`dTMP.
`Nature,
`313, 762-766
`(1985).
`18. Busch,
`S. J. and Sassone-Corsi,
`P.: Dimers,
`leucine
`zippers
`and
`DNA-binding
`domains.
`Trends
`Genet.,
`6, 36-40
`(1990).
`19. Laemmli,
`U. K.: Cleavage
`of structural
`proteins
`during
`the assem-
`bly
`of
`the
`head
`of
`bacteriophage
`T4.
`Nature,
`227,
`680-685
`(1970).
`properties
`H.: Enzymatic
`I., and Okada,
`T., Urabe,
`20. Mitamura,
`from Bad/us
`of glucose
`dehydrogenase
`and variants
`of
`isozymes
`tneguleriutn. Eur.
`J. Biochem.,
`186. 389-393
`(1989).
`
`