Anal. Cham. 1992, 64, 2149-2154
`
`2149
`
`DNA Sequencing Using Capillary Array Electrophoresis
`Xiaohua C. Huang, Mark A. Quesada, and Richard A. Mathies*
`Department of Chemistry, University of California, Berkeley, California 94720
`
`A DNA sequencing method is presented that utilizes capillary
`array electrophoresis, two-color fluorescence detection, and
`a two-dye labeling protocol. Sanger DNA sequencing frag-
`ments are separated on an array of capillaries and detected
`on-column using a two-color, laser-excited, confocal-fluores-
`The four sets of DNA sequencing fragments
`cence scanner.
`are separated In a single capillary and then distinguished by
`using a binary coding scheme where each fragment set is
`labeled with a characteristic ratio of two dye-labeled primers.
`Since only two dye-labeled primers are required, K Is possible
`It Is also
`to select dyes that have Identical mobility shifts.
`shown that the ratio of the signal In the two detection channels
`provides a reliable Identification of the sequencing fragment.
`DNA sequencing results on a 25-caplllary array are presented.
`
`INTRODUCTION
`The development of a high-speed, high-throughput DNA
`sequencing method is necessary for achieving the goals of the
`Human Genome Project.* 1"4 Automated DNA sequencing is
`currently performed using either one-color5"7 or four-color7"9
`labeling of DNA fragments followed by separation on slab
`gels and fluorescence detection. Recently, high-field ultrathin
`slab gel electrophoresis has been introduced as one method
`for enhancing the rate of DNA sequencing.10 Capillary
`electrophoresis (CE) also appears to be a promising high-
`speed DNA sequencing method.11"16 Although CE separations
`are rapid because of the high electric fields that can be applied,
`the throughput is about the same as that of conventional slab
`gels because only one capillary can be run and detected at a
`time.17
`
`* Corresponding author.
`(1) Smith, L. M. Genome 1989, 31, 929-937.
`(2) Cantor, C. R. Science 1990, 248, 49-51.
`(3) Watson, J. D. Science 1990, 248, 44-49.
`(4) Hunkapiller, T.; Kaiser, R. J.; Koop, B. F.; Hood, L. Science 1991,
`254, 59-67.
`(5) Ansorge, W.; Sproat, B.; Stegemann, J.; Schwager, C.; Zenke, M.
`Nucl. Acids Res. 1987,15, 4593-4602.
`(6) Ansorge, W.; Zimmermann, J.; Schwager, C.; Stegemann, J.; Erfle,
`H.; Voss, H. Nucl. Acids Res. 1990, 18, 3419-3420.
`(7) Tabor, S.; Richardson, C. C. J. Biol. Chem. 1990,265, 8322-8328.
`(8) Smith, L. M.; Sanders, J. Z.; Kaiser, R. J.; Hughes, P.; Dodd, C.;
`Connell, C. R.; Heiner, C.; Kent, S. B. H.; Hood, L. E. Nature 1986, 321,
`674-679.
`(9) Prober, J. M.; Trainor, G. L.; Dam, R. J.; Hobbs, F. W.; Robertson,
`C. W.; Zagursky, R. J.; Cocuzza, A. J.; Jensen, M. A.; Baumeister, K.
`Science 1987, 238, 336-341.
`(10) Kostichka, A. J.; Marchbanks, M. L.; Brumley, R. L.; Drossman,
`H.; Smith, L. M. Biol Technology 1992, 10, 78-81.
`(11) Drossman, H.; Luckey, J. A.; Kostichka, A. J.; D’Cunha, J.; Smith,
`L. M. Anal. Chem. 1990, 62, 900-903.
`(12) Luckey, J. A.; Drossman, H.; Kostichka, A. J.; Mead, D. A.;
`D’Cunha, J.; Norris, T. B.; Smith, L. M. Nucl. Acids Res. 1990,18,4417-
`4421.
`(13) Swerdlow, H.; Wu, S.; Harke, H.; Dovichi, N. J. J. Chromatogr.
`1990, 516, 61-67.
`(14) Swerdlow, H.; Gesteland, R. Nucl. Acids Res. 1990, 18, 1415-
`1419.
`(15) Cohen, A. S.; Najarian, D. R.; Karger, B. L. J. Chromatogr. 1990,
`516, 49-60.
`(16) Swerdlow, H.; Zhang, J. Z.; Chen, D. Y.; Harke, H. R.; Grey, R.;
`Wu, S.; Dovichi, N. J.; Fuller, C. Anal. Chem. 1991, 63, 2835-2841.
`(17) Smith, L. M. Nature 1991, 349, 812-813.
`
`To transcend this limitation, we have recently introduced
`the new technique of capillary array electrophoresis (CAE).18
`It was demonstrated that arrays of capillaries can be used to
`perform rapid, parallel separations followed by on-column
`detection using a one-color, confocal-fluorescence scanner.18
`Because of capillary-to-capillary variations in the migration
`velocity, we concluded that DNA sequencing using CAE would
`probably require multicolor detection of the four sets of
`sequencing fragments after separation in the same capillary.
`that we have de-
`The confocal-fluorescence gel scanner
`veloped19"21 has also been used to perform multicolor detection
`of slab gels.2122 We show here that this multicolor, confocal-
`can be used to detect DNA sequencing
`fluorescence scanner
`fragments separated on capillary arrays. In addition, a binary
`coding protocol for labeling the DNA fragments is introduced
`that permits us to sequence DNA using only two fluorescently
`labeled dye primers and a two-color detection system.
`
`EXPERIMENTAL SECTION
`Instrumentation. Figure 1 presents a schematic of the laser-
`excited, confocal-fluorescence capillary array scanner. Excitation
`light (488 nm, 1 mW) from an argon ion laser (Spectra-Physics,
`Model 2020, Mountain View, CA) is reflected by a long-pass
`dichroic beam splitter (480DM, Omega Optical, Brattleboro, VT),
`passed through a 32X, N.A. 0.4 microscope objective (LD Plan-
`Achromat 440850, Carl Zeiss, Germany), and brought to a 10-
`Mm-diameter focus within the 100-/an-i.d. capillaries in the array.
`The fluorescence is collected by the objective, passed back through
`the first beam splitter to a second dichroic beam splitter (565LP,
`Omega Optical, Brattleboro, VT) that separates the red (X > 565
`nm) and green (X < 565 nm) channels. The beams are then
`focused on 400-/nm-diameter confocal pinholes. The emission is
`spectrally filtered by a 35-nm band-pass filter (590DF35, Omega
`Optical, Brattleboro, VT) centered at 590 nm (red channel) and
`a 10-nm band-pass filter (525DF10, Omega Optical, Brattleboro,
`VT) centered at 525 nm (green channel) followed by photomul-
`tiplier detection. The output is preamplified, filtered, digitized,
`and then stored in an IBM PS/2 computer. A computer-
`controlled stage is used to translate the capillary array past the
`optical system at 20 mm/s. The fluorescence is sampled
`unidirectionally at 1500 Hz/channel. The image resolution is
`13.3 pm/pixel. An image of the migrating bands is built up by
`accumulating periodic 1.4-s sweeps of the exposed region of the
`capillaries. Postacquisition image processing was performed on
`a MacII using the NIH program Image 1.29, and the image and
`electropherogram displays were prepared using the commercial
`programs, Canvas and Kaleidagraph.
`Preparation of Capillary Arrays. Fused silica capillaries
`with a 100-pm i.d. and 200-pm o.d. (Polymicro Technologies,
`Phoenix, AZ) were filled with a non-cross-linked 9% T, 0% C
`polyacrylamide gel in Tris, boric acid, EDTA buffer (pH 8.3)
`
`(18) Huang, X. C.; Quesada, M. A.; Mathies, R. A. Anal. Chem. 1992,
`64, 967-972.
`(19) Glazer, A. N.; Peck, K.; Mathies, R. A. Proc. Natl. Acad. Sci.
`U.S.A. 1990, 87, 3851-3855.
`(20) Rye, H. S.; Quesada, M. A.; Peck, K.; Mathies, R. A.; Glazer, A.
`N. Nucl. Acids Res. 1991, 19, 327-333.
`(21) Quesada, M. A.; Rye, H. S.; Gingrich, J. C.; Glazer, A. N.; Mathies,
`R. A. BioTechniques 1991,10, 616-625.
`(22) Rye, H. S.; Yue, S.; Quesada, M. A.; Haughland, R. P.; Mathies,
`R. A.; Glazer, A. N. Meth. Enzymol., in press.
`
`0003-2700/92/0364-2149503.00/0
`
`&copy; 1992 American Chemical Society
`
`Downloaded via UNIV OF VIRGINIA on November 6, 2018 at 18:19:59 (UTC).
`
`See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
`
`Agilent Exhibit 1267
`Page 1 of 6
`
`

`

`2150 • ANALYTICAL CHEMISTRY, VOL. 64, NO. 18, SEPTEMBER 15, 1992
`
`PREAMPLIFiIr)—^-| COMPUTER |
`
`PHOTOTUBE
`
`SPECTRAL FILTER
`CONFOCAL SPATIAL FILTER
`
`DICHROIC BEAM SPLITTER
`
`MIRROR
`
`DICHROIC BEAM SPLITTER
`
`LASER INPUT =
`
`Figure 1. Schematic of the two-color, confocal-fluorescence capillary array scanner.
`Table I. Binary Coding of DNA Sequencing Fragments
`FAM
`JOE
`1
`0
`1
`0
`
`A
`G
`T
`C
`
`1
`1
`0
`0
`
`with 7 M urea
`as the denaturant.23,24 The gel-filled capillary
`array was then assembled in a holder mounted on a computer-
`controlled translation stage. To achieve uniform detection
`sensitivity and background, the holder was designed to keep the
`exposed region of the capillaries precisely in the same plane.
`Typically, the length from the inlet to the detection window was
`24 cm and the applied field was ~225 V/cm. A detailed
`description of the capillary array fabrication has been reported
`previously.18 In initial studies, we have been able to reuse
`capillaries three or more
`times.
`Preparation of DNA Sequencing Sample. Chain-termi-
`nated M13mpl8 DNA sequencing fragments were produced using
`a Sequenase 2.0 kit (United States Biochemical Corp., Cleveland,
`OH). Commercially available FAM and JOE-tagged primers (400
`nM, Applied Biosystems, Foster City, CA) were employed in the
`primer-template annealing step. Three annealing solutions were
`(1) 4 fiL of reaction buffer, 13 fiL of M13mpl8 single-
`prepared:
`stranded DNA, and 3 fiL of FAM; (2) 6 fiL of reaction buffer, 20
`fiL of M13mpl8 DNA, 1.5 mL of FAM, and 3 fiL of JOE; and (3)
`6 fiL of reaction buffer, 20 fiL of M13mpl8 DNA, and 4.5 fiL of
`JOE. The tubes were heated to 65 °C for 3 min and then allowed
`to cool to room temperature for 30 min. When the temperature
`of the annealing reaction mixtures had dropped below 30 °C, 2
`fiL of 0.1 M DTT solution, 4 fiL of reaction buffer, and 10 fiL of
`ddT termination mixture were added in tube 1; 3 fiL of DTT
`solution, 6 ftL of reaction buffer, and 15 fiL of ddA termination
`mixture were added in tube 2; and 3 fiL of DTT, 6 fiL of reaction
`buffer, and 15 fiL of ddG termination mixture were added in
`
`(23) Cohen, A. S.; Najarian, D. R.; Paulus, A.; Guttman, A.; Smith, J.
`A.; Karger, B. L. Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 9660-9663.
`(24) Heiger, D. N.; Cohen, A. S.; Karger, B. L. J. Chromatogr. 1990,
`516, 33-48.
`
`Time — 
`Figure 2. Comparison of the mobility shift of different dye primers on
`In A the sample was produced
`M13mp18 G fragment DNA samples.
`using an equimolar mixture of FAM- and TAMRA-labeled primers. In
`B the sample was produced using an equimolar mixture of FAM- and
`JOE-labeled primers. The solid and dotted lines are the fluorescence
`signals detected in the green and red channels, respectively. The
`numbers above the peaks indicate the base position.
`
`tube 3. Diluted Sequenase 2.0 (4 fiL) was added in tube 1, and
`6 fiL of diluted Sequenase was added in tubes 2 and 3. The
`mixtures were incubated at 37 °C for 5 min. Ethanol precipitation
`was used to terminate the reaction and to desalt the DNA
`then resuspended and
`sequencing sample. The samples were
`pooled in 6 mL of 80 % (v/v) formamide. The sample was heated
`at 90 °C for 3 min to denature the DNA and then placed on ice
`
`Agilent Exhibit 1267
`Page 2 of 6
`
`

`

`Green Channel
`
`Red Channel
`
`15
`
`10
`
`15
`
`20
`
`25
`
`ANALYTICAL CHEMISTRY, VOL. 64, NO. 18, SEPTEMBER 15, 1992 • 2151
`
`Figure 3. DNA sequencing using a 25-capillary array and binary coding to label the DNA fragments. The left-hand panel presents a pseudocolor
`display of the 525-nm, green channel and the right panel presents the 590-nm, red channel. The elapsed time to obtain this portion of the total
`the 40-cm total length of the 100-pm-i.d.,
`image was 30 min. The length from the inlet to the detection zone was 24 cm. The applied voltage over
`200-jim-o.d. capillaries was 9 kV.
`
`until sample injection. Electrokinetic injection was performed
`at 9 kV for 10 s.
`RESULTS AND DISCUSSION
`To detect four sets of DNA sequencing fragments using a
`two-color fluorescence detection system, a new protocol for
`labeling the sequencing fragments was devised. Previous
`methods have employed either labeling each set of DNA
`fragments with a different dye followed by four-color detection
`labeling each fragment with the same dye followed by
`or
`detection based on different band intensities.6-8 An alter-
`native approach using four different dye labels and a two-
`color detection system has been applied to slab gel sequenc-
`ing,9 to small (0.5-mm) diameter, low-field tube gel se-
`quencing,25 and subsequently to sequencing by high-field
`capillary gel electrophoresis.16 Two-dye labeling followed by
`two-color detection provides a simple and sensitive alternative.
`In this method, “binary combinations" of two dye-labeled
`primers, having the same priming sequence but tagged with
`different fluorescent dyes, are used to encode the four sets
`of DNA fragments. This is illustrated in Table I where a 1
`denotes that that set of DNA fragments is synthesized with
`the corresponding dye primer and a 0 denotes the absence of
`the corresponding labeled dye primer. The {1,1} coding
`indicates that the A fragments are synthesized with a mixture
`of both dye-labeled primers. The {0,1} coding indicates that
`the G fragments are synthesized with the JOE-labeled primer,
`and {1,0} indicates that the T fragments are synthesized with
`
`(25) Zagursky, R. J.; McCormick, R. M. BioTechniqu.es 1990,9,74-79.
`
`the FAM-labeled primer. Fragments terminating in C are
`not synthesized, and this is denoted by {0,0}.
`There are two requirements for the dyes used in binary
`coding. First, it is critical that there be no electrophoretic
`mobility difference between DNA fragments labeled with the
`different dyes. When there are mobility shifts, correction
`procedures are required to read the DNA sequence.8 The
`shift of the mobility of the DN A fragments due to the presence
`of the dye can be simply detected by capillary gel electro-
`phoresis. Figure 2A presents an electropherogram of
`M13mpl8 G fragments, half of which were labeled with the
`commercially available dye primer F AM and half labeled with
`the dye primer TAMRA. Peaks are observed at two different
`times for each DNA fragment due to the different mobility
`shift of FAM and TAMRA. The earlier peak, which is solely
`detected in the red channel, is due to the TAMRA-labeled
`DNA fragments; the later one, which is mainly detected in
`the green channel, is due to the FAM-labeled DNA fragments.
`The observed mobility shift between TAMRA-labeled frag-
`ments and FAM-labeled fragments is equivalent to a one-
`base change in the length of the DNA fragment. A similar
`shift is observed for fragments from 20 to more
`than 250
`bases in length. This mobility shift is especially problematic
`when two fragments differ in length by one base (e.g., bases
`87 and 88 in Figure 2A). Figure 2B presents an electrophero-
`gram of M13mpl8 G fragments, half of which were
`labeled
`with the dye primer FAM and half labeled with the dye primer
`JOE. W ithin the resolution of the separation and under these
`conditions, we can detect no difference in the mobility of the
`two different labeled fragments.
`
`Agilent Exhibit 1267
`Page 3 of 6
`
`

`

`2152 • ANALYTICAL CHEMISTRY. VOL. 64, NO. 18, SEPTEMBER 15, 1992
`  Mi
`am*
`
`ft if
`| 11 |
`f
`l
`i
`l ci
`iftift
`t
`i
`n
`*
`A A GCTTGCATGCCTGCAGG
`
`i
`lit
`t
`i
`f mu
`i
`i
`«
`TC G ACTCTAGAGGA
`
`II
`
`1
`
`.
`
`TCCCCGGGT
`
`ift
`
`- ft
`
`i
`ACCGA GC
`
` 
`
`ft,
` 
`T CGAA
`
`I - * ttft^SSteW^EP
`  M  
`TCA T
`
`# '
`
`'
`
`T TCGTAA
`
`mmm; mmm-
`* t
`* *  
`G T TTCC
`
`GGTCATAGCT
`
`*»*
`
`imi
`
`t
`» *)*    »
`TG TGTG AAAT
`
`•
`
`TGTT
`
`ATCCO
`
`5
`
` 
`*
`C TCACAA
`
`ft
`
`it
`*t
`*«
`TTCCACACAACATACGAGC
`
`*h
`
`CG GA A GC A T A A A
`
`CTCTAAAGCCTGGGGTGCCTAATGAGTCAGCTAACTCACATTAATTGCGTTCCGCTC
`COO)
`
`AC
`
`T GCCCG CTT TCC AG TCC
`
`GGAAACCTGTCGT
`
`GCCAGC TGC AT T A A TG A ATC G G CC A ACG CCC G GG G AGAGGCGGT
`050)
`
`TT GCGT A T TG G GCGCCAG G GTGG T T T
`(300)
`
`<(800.
`
`Figure 4. Analysis of the DNA sequence from one capillary In a capillary array. The red image and one-dimensional trace represent the signal
`detected as a function of time from the red, 590-nm channel. The green Image and trace represent the corresponding signal from the green,
`525-nm channel. G fragments are labeled with JOE (0,1} which emits predominantly In the red channel. T fragments are labeled wtth FAM {1,0}
`which emits in the green and red channels at a ratio of ~2:1 for the conditions used here. A fragments are labeled with both JOE and FAM
`{1,1}. The molar ratio of JOE to FAM was chosen to give a green/red detection ratio of ~ 0.9:1. Gaps in the sequence indicate the location
`of C. The intensities of the middle two sets of traces were multiplied by a factor of 2 compared to the top traces; the bottom traces were multiplied
`by a factor of 4.
`
`A second requirement for two-color binary coding is that
`the dyes should have readily distinguishable fluorescence
`emissions. The dye primers F AM and JOE do not fully meet
`this requirement because with our apparatus FAM is also
`detected in the red channel. We have found, however, that
`computation of the ratio of outputs in the two channels can
`effectively solve this problem. This ratio is completely
`independent of the amount of DNA in a band, it is insensitive
`to a variety of instrumental detection sensitivity fluctuations,
`talk between the two detection
`and when there is cross
`the ratio is a constant parameter that can be
`channels,
`recognized in the analysis (see below). The preceding analysis
`indicates why we chose FAM and JOE as the two dye labels
`for the binary coding scheme.
`
`Figure 3 presents a DNA sequencing run performed using
`an array of 25 capillaries. Each capillary image is presented
`twice, once for the red channel and once for the green channel.
`The horizontal dimension represents the physical image of
`the 100-/un-i.d. capillaries, and this dimension of the pixels
`is 13 pm. The vertical dimension is proportional to the elapsed
`time, and this dimension of the pixels is 1.4 s. The image in
`Figure 3 presents resolved DNA bands up to ~120 bases
`beyond the primer, and it was typically possible to sequence
`up to 300-350 bases per capillary in such an array under our
`conditions (see below).
`Figure 4 presents a more detailed analysis of the DNA
`sequence from one representative capillary in an array. An
`image of the output from the two detection channels is
`
`Agilent Exhibit 1267
`Page 4 of 6
`
`

`

`ANALYTICAL CHEMISTRY, VOL. 64, NO. 18, SEPTEMBER 15, 1992 • 2153
`
`Base Number
`Figure 5. Plot of the fluorescence Intensity In the green channel divided
`by that in the red channel for each of the peaks In Figure 4. ( ) T
`fragments labeled solely with FAM; (A) G fragments labeled solely with
`JOE; and (•) A fragments labeled with both FAM and JOE. The ratio
`was calculated based on the peak maxima.
`
`presented along with one-dimensional
`traces formed by
`integrating the signal across the width of the capillary. Single
`base resolution is achieved throughout the run, and the
`sequence can be read out to base 316. The bases can be called
`throughout the run by examining the ratio of the signals. For
`example, when the band appears only in the red channel it
`is a G {0,1}, when the red and green intensities are nearly
`equal it is an A {1,1}, when the gTeen intensity is ~2 times
`larger than the red it is a T {1,0}, and when a gap appears in
`the sequence it is a C {0,0}.
`Figure 5 presents a plot of the fluorescence intensity in the
`green channel divided by that in the red channel for each of
`the peaks in Figure 4. Three distinct distributions of ratios
`are observed. Peaks with a ratio of ~ 2 are due to T fragments
`that are just labeled with FAM. A fragments that are labeled
`with both FAM and JOE give a characteristic ratio of about
`0.9. Finally, the G fragments that are labeled with JOE are
`detected solely in the red channel. Over the entire range
`displayed, there is essentially no overlap between the dis-
`indicating that
`the individual bases can be
`tributions,
`accurately called. The ratio of the signal in the green and red
`reliable parameter than the raw
`channels is a much more
`signal strength in any one channel. The fluorescence intensity
`of the DNA bands can fluctuate due to a variety of factors,
`especially sequence-dependent termination.26 In the data
`presented here, the fluorescence intensity for a particular set
`of fragments was found to vary by as much as a factor of 20
`across the run while the ratios only fluctuate by a factor of
`about 1.7. Thus, the use of the ratio to call the base identity
`can reduce the uncertainty of the determination. For example,
`for the 209 directly observed bands (A, G, T) in Figures 4 and
`5, there was only one ambiguous call. The utility of two-color
`ratio detection has also been recognized in previous slab gel
`studies which employed a four-dye labeling protocol.9
`When there is residual secondary structure or anomalous
`migration of the sequencing fragments, the lack of direct
`detection of
`the C or
`{0,0} coded fragments can
`cause
`sequencing errors because the presence of C in the sequence
`is determined solely by the gaps between the other labeled
`fragments. For the sequencing run presented in Figure 4,
`the error
`rate due to this effect was 5.4 % (15 errors/280 bases).
`There are a number of ways to address this issue. To achieve
`rate, sequencing is typically performed at least
`a low error
`twice, either by repeated sequencing of the same strand or
`by sequencing the complementary strand. If the same strand
`is resequenced, then a different coding algorithm can be used.
`
`(26) Tabor, S.; Richardson, C. C. Proc. Natl. Acad. Sci. U.S.A. 1989,
`86, 4076-4080.
`
`Figure 6. The top trace presents the M13mp18 DNA sequence from
`bases 43 to 61 using the binary coding assignment In Table I. The
`bottom trace presents a second sequencing run on M13mp18 using
`a modified binary coding assignment where the C fragments are labeled
`with FAM {1,0} and the T fragments are not synthesized {0,0}. The
`solid line is the fluorescence signal detected in the green channel; the
`dotted line Is the signal detected in the red channel.
`
`For example, we can change the coding of the C fragments
`to {1,0} and that of the T fragments to {0,0}. This approach
`is illustrated in Figure 6. The top traces in Figure 6 show
`that the number of C fragments between bases 55 and 60 is
`potentially ambiguous using the original binary coding. By
`interchanging the coding for the T and the C fragments, it
`is easily determined that there are
`four consecutive C
`fragments between Tag and the next G. A second approach
`to solving the spacing problem would be to sequence the
`complementary strand with the original coding. Using the
`binary coding assignment in Table I, the presence of C in the
`original sequence is indicated by the detection of a G fragment
`with a {0,1} coding in the complementary strand. Finally, an
`alternative approach is to label all four sets of fragments with
`a unique ratio of the dyes JOE and FAM. The data in Figure
`5 suggest that the ratios are sufficiently distinctive and
`separate that the use of four ratios of FAM and JOE will be
`practical. Experiments in this direction are now in progress.
`CONCLUSIONS
`Capillary array electrophoresis coupled with two-color,
`confocal-fluorescence detection and two-dye labeling has the
`potential to be a useful, high-speed, high-throughput DNA
`sequencing method. An important and intrinsic advantage
`of CAE over high-speed DNA sequencing methods based on
`slab gels10 is the ease with which multiple samples can be
`electrokinetically loaded (e.g.,
`see Figure 1). However,
`methods must be developed for easily filling and manipulating
`arrays of capillaries—this effort may benefit from the use of
`linear-polymer separation matrices.27 The
`low-viscosity,
`instrumental limitations on the overall throughput of our
`system depend on the total number of capillaries that can be
`scanned, the scan rate, the scan repetition period, and the
`If we employ 150-nm-o.d. cap-
`capillary outside diameter.
`
`(27) Grossman, P. D.; Soane, D. S. Biopolymers 1991, 31,1221-1228.
`
`Agilent Exhibit 1267
`Page 5 of 6
`
`

`

`in the development of high-speed, high-
`also be useful
`throughput mapping and diagnostics.
`
`ACKNOWLEDGMENT
`
`2154 • ANALYTICAL CHEMISTRY, VOL, 64, NO. 18, SEPTEMBER 15, 1992
`iUaries, a 3 cm/s scan rate, and a 2-s repetition period, then
`200 capillaries can be scanned. The length of the sequencing
`run and the reliability of the base calls depend on the gel
`matrix, the sequencing reaction conditions, the dye labeling
`protocol, and the detection sensitivity.11"131616 Using the
`conditions reported here, we can sequence ~300 bases per
`capillary, and sequencing 500 bases or more in a single capillary
`run has been reported.28 Assuming that the reliable detection
`of 500 bases per capillary can ultimately be achieved, CAE-
`based DNA sequencing should produce a raw sequencing rate
`of 100 000 bases in ~2 h using 200 capillaries. This is close
`to the rate necessary for the success of the Human Genome
`in the application of CE to the-
`Project.4 Recent success
`separation of restriction fragments and PCR-amplified prod-
`ucts24-29-30 suggests that capillary array electrophoresis may
`(28) Chen, D. Y.; Swerdlow, H. P.; Haxke, H. R.; Zhang, J. Z.; Dovichi,
`N. J. J. Chromatogr. 1991, 559, 237-246.
`(29) Cohen, A. S.; Najarian, D.; Smith, J. A.; Karger, B. L. J.
`Chromatogr. 1988, 458, 323-333.
`(30) Schwartz, H. E.; Ulfelder, K.; Sunzeri, F. J.; Busch, M. P.; Brownlee,
`R. G. J. Chromatogr. 1991, 559, 267-283.
`
`We thank Alexander N. Glazer and Jiun-Wei Chen for
`valuable discussions and assistance. This research was
`supported by the Director, Office of Energy Research, Office
`of Health and Environmental Research, of the U.S. Depart-
`ment of Energy under Contract DE-FG-91ER61125. X.H.
`was supported by a Human Genome Distinguished Post-
`doctoral Fellowship sponsored by the U.S. Department of
`Energy, Office of Health and Environmental Research, and
`administered by the Oak Ridge Institute for Science and
`Education.
`
`Received for review March 4, 1992. Accepted July 7,
`1992.
`
`Agilent Exhibit 1267
`Page 6 of 6
`
`