United States Patent (19)
`Mitoma
`
`54 FLUORESCENCE DETECTING APPARATUS
`75 Inventor: Yasutami Mitoma, Kanagawa-ken,
`Japan
`73 Assignee: ToSoh Corporation, Yamaguchi-ken,
`Japan
`
`21 Appl. No.: 09/517,666
`22 Filed:
`Oct. 30, 1996
`Related U.S. Application Data
`63 Continuation of application No. 08/087,855, Jul. 9, 1993,
`abandoned.
`Foreign Application Priority Data
`30
`Jul. 17, 1992
`JP
`Japan .................................... 4-212288
`(51) Int. Cl." ..................................................... G01N 21/64
`52 U.S. Cl. ....................... 356/317; 250/458.1; 435/808;
`436/172
`58 Field of Search ..................................... 356/317, 318,
`356/417, 440; 250/458.1, 459.1, 461.1,
`461.2, 435/34, 289-291, 808; 422/82.07-82.08,
`82.11; 436/172
`
`56)
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`3,992,631 11/1976 Harte.
`4,498,780 2/1985 Banno et al. ....................... 356/440 X
`5,217.876 6/1993 Turner et al. ............................. 435/34
`5,252,834 10/1993 Lin ....................................... 250/458.1
`
`
`
`US006144448A
`Patent Number:
`11
`(45) Date of Patent:
`
`6,144,448
`Nov. 7, 2000
`
`5,371,016 12/1994 Berndt .................................. 356/461.2
`5,473,437 12/1995 Blumenfeld et al. ................... 356/417
`FOREIGN PATENT DOCUMENTS
`European Pat. Off..
`European Pat. Off..
`European Pat. Off..
`European Pat. Off..
`WIPO.
`
`O 127 286 12/1984
`O 127 418 12/1984
`O 266 881 5/1988
`O 156 274 A2 12/1992
`WO 87/06716 11/1987
`
`OTHER PUBLICATIONS
`Bio/Technology vol. 10 Apr. 1992 Research pp. 413-417
`Higuchi et al Simultaneous Amplification and Detection of
`Specific DNA Sequences.
`Primary Examiner F. L. Evans
`Attorney, Agent, or Firm Nixon & Vanderhye
`57
`ABSTRACT
`A fluorescence detecting apparatus which allows highly
`precise measurement of fluorescence even with minute
`Sample amounts, which has a Strong responsiveness to
`temperature variations, which allows Simultaneous measure
`ment of a plurality of Samples, and wherein the light Source
`and the container holder, and the container holder and the
`fluorescence detector, are each optically connected by opti
`cal fibers, and the optical fibers are connected to the con
`tainer holder in Such a manner that the Sample in the
`container is excited for fluorescence from below the Sample
`container held by the container holder, and that they may
`receive the fluorescent light which is emitted by the sample
`from below the Sample container.
`
`13 Claims, 4 Drawing Sheets
`
`DETECTING
`APPARATUS
`
`SOURCE
`
`Agilent Exhibit 1235
`Page 1 of 10
`
`

`

`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 1 of 4
`
`6,144,448
`
`
`
`Agilent Exhibit 1235
`Page 2 of 10
`
`

`

`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 2 of 4
`
`6,144,448
`
`Fig. 2
`
`8
`|
`1O 2
`
`1
`
`N
`
`
`
`
`
`
`
`DETECTING
`APPARATUS
`
`Agilent Exhibit 1235
`Page 3 of 10
`
`

`

`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 3 of 4
`
`6,144,448
`
`g. 5
`Fi
`
`
`
`
`
`(AU) W LISNE LNI BONEOSBYJOQT1B BALLVTEH
`
`7OO
`
`
`
`6OO
`
`5OO
`
`3OO
`
`2OO
`
`1OO
`
`Agilent Exhibit 1235
`Page 4 of 10
`
`

`

`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 4 of 4
`
`6,144,448
`
`Fig. 4
`
`1 .. 5
`
`an
`
`X
`H
`U5
`2.
`
`H
`Z 1. O
`
`2
`
`1.
`O
`
`B O.5
`D
`H
`CC
`ul
`
`1.
`
`55°C
`
`72°C
`
`94°C
`
`Ya
`9.
`
`H
`CC
`1.
`
`H
`
`O
`
`O
`
`1
`
`3.
`2
`TIME (MINUTE)
`
`4.
`
`5
`
`Agilent Exhibit 1235
`Page 5 of 10
`
`

`

`1
`FLUORESCIENCE DETECTINGAPPARATUS
`
`6,144,448
`
`This is a continuation of application Ser. No. 08/087,855,
`filed Jul. 9, 1993, now abandoned.
`
`FIELD OF THE INVENTION
`The present invention relates to a fluorescence detecting
`apparatus, and more specifically, it relates to a fluorescence
`detecting apparatus for measuring variations in the fluores
`cent properties of Substances or their interacted complexes
`in reactions which occur between at least two types of
`Substances capable of interaction between each other, for
`example, reactions involving nucleic acids and intercalatory
`fluorescent pigments, lipid bilayers and hydrophobic fluo
`rescent probes, proteins and fluorescent pigments, organic
`polymers and fluorescent pigments, etc.
`
`DESCRIPTION OF THE PRIOR ART
`In reactions which occur between at least two types of
`Substances capable of interaction between each other, for
`example, reactions involving nucleic acids and intercalatory
`fluorescent pigments, lipid bilayers and hydrophobic fluo
`rescent probes, proteins and fluorescent pigments, organic
`polymers and fluorescent pigments, etc., the fluorescent
`properties of these Substances or their interacted complexes
`vary depending upon their State. Thus, if the variation in the
`fluorescent properties thereof is measured, it is possible to
`know the State of interreaction of the above Substances, the
`amount of complex formed, etc.
`In polymerase chain reactions (PCRs) which are con
`ducted in the copresence of an intercalatory fluorescent
`pigment (for example Japanese Patent Application Hei
`3-313616) etc., it is possible to know the state of nucleic acid
`amplification (success of the PCR) by measuring the fluo
`rescent properties at a desired point in each cycle of the
`PCR, and usually at a point during repetition of Separation
`of the double-Stranded nucleic acid into Single Strands and
`hybridization between Single Strands, by variation of the
`temperature. In this procedure, a device is required which
`can vary the temperature according to a preset program and
`measure the change in the fluorescent properties of a Sample
`in a Sample container. Such a device in current use is a
`Spectrophotometer containing a temperature-controlling cell
`holder.
`
`SUMMARY OF THE INVENTION
`Measurement of fluorescent property variation according
`to the prior art using a spectrophotometer employs a System
`in which exciting light is directed towards a cell using an
`optical System of lenses, mirrors, etc., and fluorescence is
`directed towards a fluorescence detecting apparatus in the
`same manner, and therefore it has been difficult to effect
`multichannel measurement (Simultaneous measurement of
`multiple samples). Furthermore, the responsiveness of the
`Sample temperature to the temperature variation is lessened
`by the amount of liquid in the Sample, and it is difficult to
`measure the rapid interactions between compounds which
`accompany phase transitions.
`Various attempts have been made at improving tempera
`ture responsiveness, but in methods where the Volume of the
`Sample container is reduced, etc. it becomes necessary to
`Select the beam of the exciting light, thus causing new
`problems Such as a reduction in the quantity of light and a
`resulting decrease in the precision of measurement. An
`attempt at improvement has been made by using an intense
`
`15
`
`25
`
`35
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`2
`light Source to compensate for the reduction in the quantity
`of light, but in this case the problem of heat waste from the
`device and the influence of heat on the fluorescence detect
`ing apparatus are considerable, and thus it becomes difficult
`to obtain highly precise and repeatable measurement results.
`Very recently, devices which employ optical fibers in an
`optical system (Biotechnology, Vol. 10, p. 413, 1992) have
`become known, but in these devices the Sample is excited
`from the top of the Sample container, and the fluorescence
`from the Sample is also received from the top, and therefore
`if the amount of the Sample is Small, there is a loss of
`exciting light and fluorescence from the Sample in the air
`layer between the Sample and the tip of the optical fibers.
`The process is thus complicated by the necessity of replac
`ing the Sample container from time to time, depending on the
`Volume of the Sample, in order to overcome this problem,
`and therefore improvement thereof is in order.
`BRIEF DESCRIPTION OF THE DRAWINGS
`FIG. 1 is a drawing showing the construction of an
`apparatus according to the present invention;
`FIG. 2 is a drawing Showing the periphery of the container
`holder of the apparatus in FIG. 1;
`FIG. 3 is a graph showing the results of Example 1, with
`the fluorescence intensity during the PCR cycle for various
`concentrations of DNA plotted on the vertical axis, and the
`number of PCR cycles plotted on the horizontal axis. In the
`figure, “a” represents a case where the amount of DNA is 2.5
`ng, "b" a case where it is 0.25 ng, and “c” a case where it
`is 0.025 ng.
`FIG. 4 is a graph showing the results of Example 2, with
`the fluorescence intensity during a PCR conducted in the
`presence of an intercalatory fluorescent pigment plotted on
`the Vertical axis, indicating temperatures of the Sample at the
`time of measurement of the fluorescence intensity on the
`right-hand Side, and the time plotted on the horizontal axis.
`DETAILED DESCRIPTION OF THE
`INVENTION
`The present invention relates to a fluorescence detecting
`apparatus which comprises a Sample container which holds
`a Sample, a container holder which holds the Sample con
`tainer and is capable of varying the temperature of the
`Sample in the Sample container which it holds, a fluores
`cence detector for measuring the fluorescence from the
`Sample, and a light Source which emits exciting light to
`excite the Sample for fluorescence, characterized in that the
`light Source and the container holder, and the container
`holder and the fluorescence detector, are each optically
`connected by optical fibers, and Said optical fibers are
`connected to the container holder in Such a manner that the
`Sample in the container is excited for fluorescence from
`below the Sample container held by the container holder, and
`that they may receive the fluorescent light which is emitted
`by the Sample from below the Sample container. A more
`detailed description of the present invention is provided
`below. The Sample container for holding the Sample may be
`of any shape, but in order to excite the Sample from the
`bottom of the container and to receive fluorescence of the
`Sample from the bottom of the container, a container is used
`of which at least the bottom is light-permeable. In reaction
`systems such as the PCR, wherein there exists the danger of
`infection of Viral nucleic acids, etc. and the slightest con
`tamination between two or more Samples results in a large
`experimental error, it is preferable to use a Sealable reaction
`container and to Supply the Samples to the detector under
`
`Agilent Exhibit 1235
`Page 6 of 10
`
`

`

`15
`
`3
`Sealed conditions. An example of a Sealable Sample con
`tainer is a commercially available centrifuge tube (for
`example, an Eppendorf microcentrifuge tube, etc.). Also,
`there is not particular restriction on the material, provided it
`Satisfies the conditions described above.
`The container holder used to hold the Sample container
`has a function for varying the temperature of the Sample, and
`also serves to hold the container. It may be, for example, in
`the form of a container holder shaped to fit the container
`used, or be constructed, for example, in a large box shape
`with Said container Simply being placed therein.
`If the container holder is constructed in the form of a
`container holder shaped to fit the container, then it may be
`constructed So that variation in the temperature of Samples
`may be achieved by, for example, varying the temperature of
`the container holder itself to vary the temperature of the
`Sample container, thus varying the temperature of the Sample
`in the Sample container. In this case, the container holder and
`Sample container are preferably constructed of a highly
`thermoconductive material. An example which may be
`mentioned is a heater, etc. installed on the Surface of contact
`of the container holder with the container, in a position
`which does not interfere with excitement or reception of the
`fluorescent light. If the container holder is constructed in the
`form of a large box shape, then the temperature of the
`Sample may be varied by installing a heater therein, creating
`a refrigerant circuit, or by air-conditioning or liquid bath,
`etc. In addition to these, a variety of other methods may be
`employed to vary the temperature of the Sample according to
`the present invention. Since there is no need for heating
`when varying the temperature of the Sample within a tem
`perature range of, for example, room temperature or lower,
`in Such cases only cooling means may be provided. Thus, the
`container holder is preferably constructed with attention to
`the desired range of variation of the Sample temperature.
`The fluorescence detector may be any one which is
`capable of measuring fluorescence from a Sample. Here,
`“fluorescence' includes fluorescence intensity, fluorescence
`Spectrum, etc., and these can be measured using a photo
`multiplier or a photodiode.
`The light Source to be used may be a Xenon lamp, a D2
`lamp, a mercury lamp, a halogen lamp, a discharge tube,
`laser light, or the like. According to the present invention,
`optical fibers are used both to direct the exciting light from
`the light Source to the Sample, and to direct the fluorescent
`light from the Sample to the detecting apparatus. However,
`this does not exclude a construction wherein, for example,
`common optical parts Such as lenses or mirrors are used near
`the light Source in addition to the optical fibers, and the light
`focussed thereby is directed to the optical fibers.
`Two Systems of optical fibers are used, one for directing
`the exciting light to the Sample, and the other for directing
`fluorescent light from the Sample to the fluorescence detec
`tor. Also, by using, for example a dichroic mirror or the like,
`the above mentioned 2 systems may be provided for by a
`single optical fiber (one line). The ends of the optical fibers
`of each System are connected directly to the light Source and
`the fluorescence detector, respectively, via the above men
`tioned optical parts or if necessary a light amplifier, etc. If
`60
`the two Systems are provided for by a single optical fiber
`line, then an auxiliary optical System is attached thereto to
`direct light branched at the dichroic mirror provided at one
`end to the light source or the detector. The other end of the
`optical fiber line is connected to the container holder So that
`exciting light is radiated to the Sample from below the
`Sample container held by the container holder, and So that
`
`45
`
`50
`
`55
`
`65
`
`6,144,448
`
`25
`
`35
`
`40
`
`4
`fluorescence from the sample is received from below the
`Sample container. For example, if the container holder is in
`the form of a holder shaped to fit the container, then the
`fibers may be connected So as to provide a through-opening
`on the concave section thereof, but in order to allow for
`highly precise and repeatable measurement of Small
`amounts of Samples, they are preferably connected at the
`deepest area of the concave Section.
`The end of the optical fiber line for directing the exciting
`light and the one for receiving the fluorescent light may each
`be connected Separately to the container holder. For
`example, the ends of the exciting light radiation fibers or the
`fluorescent light receiving fiberS may be arranged So as to
`interSect over an extension wire, or they may be arranged to
`be parallel to each other. For a more Sensitive and repeatable
`measurement of fluorescence according to the present
`invention, it is preferable to construct the ends of the fibers
`of the two Systems in proximity to each other, and it is
`particularly preferable to construct the ends using fibers of
`two coaxial Systems. If the ends are constructed using fibers
`of two coaxial System, then it is preferable to position the
`ends of the fibers for receiving the fluorescent light from the
`Sample on the exterior, and the ends of the optical fibers for
`directing the exciting light in the center, Since this allows for
`reception of weaker fluorescence. AS mentioned previously,
`if the two Systems are provided for by a Single optical fiber
`line, then the end of the fiber line may be simply connected
`to the container holder.
`The Source of the exciting light is normally Selected to
`maximize the light intensity, but in cases where there exists
`the possibility of deterioration of the sample due to the
`radiation of the exciting light, a light-interrupting shutter
`may be provided to prevent the exciting light from radiating
`onto the Sample, and the Shutter may be opened and closed
`only at the time of measurement of the fluorescence to avoid
`constant bombardment of the exciting light onto the Sample.
`The light-interrupting Shutter is provided in the optical path
`running from the light Source to the container holder, but the
`Simplest construction is one in which a movable shutter is
`constructed between the ends of the optical fibers and the
`light Source, and the shutter is mechanically or electrically
`moved to open and close in Synchronization with the timing
`of measurement of the fluorescence. This timing may be, for
`example, the time at which the temperature of the container
`holder falls within a desired range (i.e., the time at which the
`Sample in the container is thought to be in the desired range).
`Such a procedure is particularly effective in cases where
`continuous (intermittent) detection of fluorescence from two
`identical Samples is made, Such as in the fluorescence
`measurement in PCRS, as disclosed in Japanese Patent
`Application Hei 3-313616.
`The variation of the temperature of the container holder
`for varying the Sample temperature may be effected within
`a desired range, and this may be stored in a program, and a
`controller for controlling the temperature of the container
`holder may be attached to the apparatus according to the
`present invention. The controller may include a Sensor for
`Sensing the temperature of the container holder and means
`for Storing the above mentioned program, and may compare
`the Signal from the above mentioned Sensor and the contents
`of the program, outputting an indication for heating or
`cooling of the container holder, and this purpose may be
`achieved by using a microcomputer or the like. If the
`controller functions to control the detector, light Source and
`Shutter, etc. of the present invention, then it is possible to
`achieve an automatic fluorescence detecting apparatus
`which varies the temperature of a Sample when the Sample
`
`Agilent Exhibit 1235
`Page 7 of 10
`
`

`

`6,144,448
`
`6
`a case wherein the end Surfaces of the optical fibers for
`irradiating exciting light and the end Surfaces of the optical
`fibers for receiving fluorescent light are arranged coaxially.
`Also, in this embodiment the controller used is a
`microcomputer, and it controls the container holder, the
`fluorescence detector, the light Source and the Shutter.
`The temperature of the container holder is varied accord
`ing to the temperature variation program Stored in the
`controller, in order to vary the temperature of the Sample in
`the sample container (not shown). The light Source is on
`during this time, or is controlled to be on in Synchronization
`with the timing of measurement of the fluorescence. The
`controller opens and closes the Shutter according to a
`prescribed timing, following the Signal from a temperature
`Sensor (not shown), thus exciting the sample and allowing
`the fluorescence to be measured by the fluorescence detector.
`In this apparatus, the results of measurement by the fluo
`rescence detector may be read by the controller and later
`displayed.
`FIG. 2 is a drawing Showing the periphery of the container
`holder of the apparatus explained in FIG. 1. 7 represents a
`Sealed Sample container, 8 a Sample in the container, 9 an
`aluminum container holder which holds the Sample con
`tainer (only one of the plurality of concave Sections in
`shown), 10 an O-ring and 11 a screw which connects the
`optical fibers to the container holder. In this embodiment, 48
`fibers are bunched together and arranged around the
`perimeter, with 12 for irradiation of the exciting light and the
`remaining 36 for receiving the fluorescent light.
`
`15
`
`25
`
`S
`container is placed in the container holder, and which can
`measure fluorescence by opening and closing the Shutter in
`accordance with the timing.
`The apparatus according to the present invention is Suit
`able for use in PCRs. In this case, it is particularly preferable
`that the above mentioned Sample container be Sealed. The
`PCR is a reaction which amplifies the nucleic acid in a
`Sample, and for the purpose of preventing Secondary con
`tamination a fluorescence detecting apparatus according to
`the present invention which employs a Sealed Sample con
`tainer is most effective. This is because, by using a Sealed
`container, it is possible to keep to a minimum the contami
`nation of nucleic acids by other Samples, which is a cause of
`false positivity in PCRs.
`In most PCRS, completion is not after a Single procedure.
`This is because the Separation of double-Stranded nucleic
`acids into Single-Stranded nucleic acids by varying the
`temperature of the Sample, annealing of a primer to each of
`the Single-Stranded nucleic acids, and the extension reaction
`of nucleic acids originating from the primer (which results
`in the appearance of double-stranded nucleic acids) are
`conducted as one cycle, and the cycle is usually repeated.
`Thus, an apparatus according to the present invention which
`is suitable for PCRs, is preferably provided with the above
`mentioned shutter.
`Because the above mentioned cycle is repeated, the tem
`perature variation of the container holder is actually the
`variation between the temperature at which the nucleic acids
`can exist in double-stranded form (if the object nucleic acid
`is double-Stranded, then this temperature range is applied at
`the start of the above mentioned cycle, at the time of
`extension of the primer, and appearance of the double
`Stranded nucleic acid resulting from the above mentioned
`extension) and the temperature at which they can only exist
`in Single-stranded form (this temperature range is applied for
`division of the double-Stranded nucleic acid into Single
`Strands).
`With reactions involving nucleic acids and intercalatory
`fluorescent pigments as a case in point, here the fluorescent
`properties of the fluorescent pigment themselves vary in a
`temperature-dependent manner, and thus the timing of varia
`tion of the temperature of a Sample in a PCR and opening
`and shutting of the above mentioned Shutter is preferably
`Such that the measurement is made at a stage wherein a fixed
`temperature has been reached after completion of a Series of
`temperature variations, rather than during variation of the
`temperature. Furthermore, in this reaction, Since a fluores
`cent pigment is taken up in the nucleic acid extension
`reaction which originates with a primer, and the fluorescent
`properties thereof vary, the reaction may be monitored to
`determine whether or not the PCR is successful (Japanese
`Patent Application Hei3-313616); however, here as well the
`temperature range may be one in which the nucleic acids can
`exist in double-Stranded form, and a timing which maintains
`a fixed temperature in the interior of the Sample container is
`preferable. In concrete terms, this is at the moment of
`completion of the above mentioned cycle.
`An explanation of the present invention will now be given
`with reference to the drawings. FIG. 1 is a drawing showing
`the entire body of an apparatus according to the present
`invention. 1 represents a container holder for holding a
`Sample container, provided with a plurality of concave
`Sections for holding containers to allow measurement of a
`plurality of Samples, and optical fibers 5 on each concave
`Section. 2 represents a fluorescence detector, 3 a light Source,
`4 a shutter, 5 optical fibers, and 6 a controller. FIG. 1 shows
`
`EXAMPLES
`
`35
`
`Examples will now be provided to illustrate the apparatus
`according to the present invention and measurement of
`fluorescence using it, without limiting the present invention
`thereto.
`
`Example 1
`Using a commercially available DNA synthesis kit
`(GeneAmp, trade name, product of Takara Brewing Co.) and
`the apparatus shown in FIGS. 1 and 2, amplification of
`nucleic acids was effected using the PCR (1 cycle=
`denaturation at 94 C. for 1 minute, annealing at 55 C. for
`1 minute, extension at 72 C. for 1 minute (using Taq
`polymerase), and 30 cycles were repeated in the presence of
`an intercalatory fluorescent pigment (Pigment 33258, prod
`uct of Hoechst AG). The reaction solution for the PCR was
`prepared using a calibrating 2-DNA and 1 Set of primer
`included in the kit, and following the directions for the kit.
`The fluorescent pigment was added to a concentration of 1
`tug/ml. The composition of the reaction Solution is listed
`below.
`
`W-DNA (1 lug, 0.1 tug or 0.01 tug/ml)
`10 x reaction buffer solution
`(Sodium chloride
`(Tris-HCl buffer solution (pH 8.0)
`(Magnesium chloride
`(Gelatin (weight/volume)
`Intercalatory fluorescent pigment
`(final concentration)
`(20 uM)
`Primer 1 and Primer 2
`(Primer 1:
`W-DNA, corresponding to 7131-7155,
`anti sense strand
`GATGAGTTCGTGTCCGTACAACTGG)
`
`10 ul
`10 ul
`0.5 M)
`0.1 M)
`15 mM)
`0.01%)
`1 ug/ml
`
`1 till ea
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`Agilent Exhibit 1235
`Page 8 of 10
`
`

`

`6,144,448
`
`7
`
`-continued
`
`(Primer 2:
`
`W-DNA, corresponding to 7607-7630,
`sense strand
`GGTTATCGAAATCAGCCACAGCGCC)
`dNTP mixture
`(2.5 mM ea)
`8 ul
`Water
`59.5 ul
`Taq polymerase
`0.5 ul
`
`(5 unitsful)
`
`15
`
`8
`coaxial fibers (E32-CC200, product of Omron) were used.
`For comparison, the above mentioned optical fibers were
`affixed to the upper opening of the microcentrifuge tube for
`measurement in the Same manner. For this purpose, the end
`Surfaces of the optical fibers positioned at the liquid Surface
`of the Sample in the centrifuge tube and at the above
`mentioned opening were separated by a gap of 23 mm.
`The above mentioned optical fibers consisted of one 1 mm
`diameter fiber in the center, and 16 lines of 0.25 mm fibers
`around the periphery, with the center fiber used for irradi
`ating exciting light, and the peripheral fibers used for
`receiving fluorescent light. In this embodiment, a 50 W
`Xenon lamp is used as the light Source, and measurement
`was made of the exciting light which was transmitted
`through a U-350 filter and of the fluorescent light which was
`transmitted through an interference filter (400-450 nm).
`As a result, a fluorescence intensity of 265 mV was
`obtained with the apparatus according to the present
`invention, whereas the fluorescence intensity from the same
`sample was measured to be 20 mV, or only about /13 in
`comparison, when the optical fibers were attached to the
`upper opening of the centrifuge tube.
`EFFECT OF THE INVENTION
`According to the present invention, Since the light Source,
`the container holder (i.e., the sample) and the fluorescence
`detector are all connected by the optical fibers, it is possible
`to arrange all of these separately So that the heat-emitting
`light Source and the container holder do not affect the
`fluorescence detector. Furthermore, multichannel
`measurement, or direction of exciting light from a single
`light Source to a plurality of Samples, and direction of
`fluorescence from a plurality of Samples to a detector, may
`be easily realized. If highly photoconductive fibers are used,
`then the loss of the exciting light and fluorescent light may
`be prevented and the light beam may be Selected, and
`therefore it is possible to make high precision measurements
`even in the case of, for example, minute Sample amounts,
`etc.
`According to the present invention, exciting light is
`irradiated onto the bottom of a Sample container, and fluo
`rescent light is received at the bottom of the Sample, and
`therefore the air layer between Samples may be kept to a
`minimum. As a result, highly precise measurements are
`possible particularly in cases where fluorescence is mea
`Sured from minute sample amounts.
`The Significance of using minute Sample amounts is that
`the responsiveness of Samples to temperature variation may
`be improved, and therefore that in reactions involving Sub
`stances which undergo temperature-dependent phase transi
`tions and have been difficult to measure according to the
`prior art . . . for example, reactions involving intercalatory
`fluorescent pigments and nucleic acids, reactions involving
`lipid bilayerS and hydrophobic fluorescent probes, reactions
`involving proteins and fluorescent pigments, and reactions
`involving organic polymers and fluorescent pigments... the
`measurement of rapid interactions between compounds
`which result from phase interactions due to temperature
`variations may be made by measuring the variation in the
`fluorescent properties thereof.
`Particularly, if an apparatus according to the present
`invention is used in a PCR in which an intercalatory pigment
`is added, and the fluorescence intensity is measured accord
`ing to a desired timing during each cycle, or the variation in
`the fluorescence is measured throughout each cycle, then it
`is possible to know the progress of nucleic acid
`
`In the apparatus shown in FIGS. 1 and 2, optical fibers
`(SupereSca, product of Mitsubishi Rayon), a controller
`(DCP200, product of Yamatake Honeywell) and a light
`source (50 W xenon lamp; light power source: Model
`C-2576, both products of Hamamatsu Photonics) were used,
`and the Shutter and fluorescence detector were manufactured
`in-house.
`For the three different samples prepared in the above
`manner having different initial 2-DNA concentrations, 25 ul
`of each reaction Solution was Sampled in a microcentrifuge
`tube (product of Biobic), mineral oil was Superpositioned on
`the Surface thereof to prevent evaporation of the sample,
`which was carried on an aluminum block, and the PCR was
`carried out while raising and lowering the temperature.
`Exciting light from the Xenon lamp light Source and passing
`through a U350 color glass filter was focussed with a lens,
`directed towards the optical fibers, and irradiated from the
`bottom of the Sample container to the Sample. The fluores
`cence from the Sample was received by the optical fibers at
`the bottom of the reaction container, and the light which
`passed through a 400-450 nm interference filter was mea
`Sured with the in-house manufactured fluorescence detector
`which contained a photodiode. The measurement of the
`fluorescence was made during the final Second of the exten
`Sion reaction of the above mentioned reaction cycle.
`The resulting measurement of the variation in fluores
`cence during the PCR was as shown in FIG. 3. In FIG. 3, the
`fluorescence intensity during the PCR cycle for each con
`centration of 2-DNA is plotted on the vertical axis, and the
`number of cycles is plotted on the horizontal axis, and it is
`clear from this graph that the number of cycles required for
`an increase in the fluorescence intensity depended on the
`concentration of the Sample; that is, 3 curves were obtained
`with different increase points depending on the initial
`amount of DNA in the sample.
`Example 2
`Using the amplified Sample from Example 1, continuous
`measurement was made of the fluorescence intensity at
`temperatures (94, 72, 55° C) predetermined for the double
`Stranded nucleic acid fragments (approximately 500 base
`pairs) and during a state of continuous variation of the
`temperature to each one, in the presence of an intercalatory
`fluorescent pigment.
`The resulting measurement of the variation in fluores
`cence was as shown in FIG. 4. In FIG. 4, the time is plotted
`on the horizontal axis, and the fluorescence intensity on the
`Vertical axis.
`
`25
`
`35
`
`40
`
`45
`
`50
`
`55
`
`Example 3
`Of 2-DNA which had been digested with EcoT14I, 1 lug
`was suspended in 25ul of a buffer solution (50 mM of NaCl,
`1 ug/ml of intercalatory fluorescent pigment (33258, product
`of Hoechst AG), 10 mM of Tris-HCl, pH 8.5), the suspen
`Sion was placed in a 25ul microcentrifuge tube (product of
`Biobic), and the fluorescence intensity was measured using
`an apparatus Similar to the one in Example 2, except that
`
`60
`
`65
`
`Agilent Exhibit 1235
`Page 9 of 10
`
`

`

`6,144,448
`
`9
`amplification, i.e., the Success of the PCR, from these
`measurements. Therefore, according to the present invention
`it is also easily possible to know the Success of PCRs, which
`has conventionally been determined by electrophoresis, etc.
`This means that waste may be reduced in cases where the
`initial concentration of the object nucleic acid is high and the
`PCR continues unnoticed even after saturation of the ampli
`fication reaction, resulti