`DOI: 10.1093/nar/gng130
`
`Short bioactive Spiegelmers to migraine-associated
`calcitonin gene-related peptide rapidly identified by a
`novel approach: Tailored-SELEX
`
`Axel Vater, Florian Jarosch, Klaus Buchner and Sven Klussmann*
`
`NOXXON Pharma AG, Max-Dohrn-Strasse 8–10, D-10589 Berlin, Germany
`
`Received August 7, 2003; Revised and Accepted September 10, 2003
`
`ABSTRACT
`
`We developed an integrated method to identify apta-
`mers with only 10 fixed nucleotides through ligation
`and removal of primer binding sites within the
`systematic evolution of
`ligands by exponential
`enrichment (SELEX) process. This Tailored-SELEX
`approach was validated by identifying a Spiegelmer
`(‘mirror-image aptamer’) that inhibits the action of
`the migraine-associated target calcitonin gene-
`related peptide 1 (a-CGRP) with an IC50 of 3 nM at
`37oC in cell culture. Aptamers are oligonucleotide
`ligands that can be generated to bind to targets with
`high affinity and specificity. Stabilized aptamers and
`Spiegelmers have shown activity in vivo and may be
`used as therapeutics. Aptamers are isolated by
`in vitro selection from combinatorial nucleic acid
`libraries that are composed of a central randomized
`region and additional fixed primer binding sites with
`~30–40 nt. The identified sequences are usually not
`short enough for efficient chemical Spiegelmer syn-
`thesis, post-SELEX stabilization of aptamers and
`economical production. If the terminal primer bind-
`ing sites are part of the target recognizing domain,
`truncation of aptamers has proven difficult and
`laborious. Tailored-SELEX results in short sequen-
`ces that can be tested more rapidly in biological
`systems. Currently, our identified CGRP binding
`Spiegelmer serves as a lead compound for in vivo
`studies.
`
`INTRODUCTION
`
`Since the invention of in vitro selection of oligonucleotides
`from combinatorial nucleic acid libraries, also known as
`systematic evolution of ligands by exponential enrichment
`(SELEX), the use of these molecules (termed aptamers) as
`therapeutics, e.g. for the specific interruption of disease-
`related protein–protein interactions, has been predicted and
`aspired (1–3). Aptamers usually show binding constants to
`their respective protein or peptide targets in the same range as
`
`most receptor–ligand interactions and exh bit a high substrate
`specificity (4–6).
`In order to move aptamers from the bench to the clinic,
`several hurdles have to be taken. The most prominent ones are
`the issues of aptamer stability in biological fluids and
`production costs. Stabilization of aptamers against abundant
`nucleases has been improved by the introduction of chemically
`modified nucleic acid libraries (pre-SELEX modifications) in
`combination with post-SELEX modifications, that both rely on
`the substitution of the RNA’s 2¢-OH group (7–10). In a second
`strategy, chiral principles were introduced into the SELEX
`process in order to generate nuclease resistant aptamers on the
`basis of L-RNA or L-DNA, so-called Spiegelmers (from the
`German ‘Spiegel’, meaning mirror) (11). Spiegelmers are
`identified through in vitro selection of an unmodified D-RNA
`or D-DNA library against
`the mirror-image configuration
`(enantiomer) of a drug target. The selected aptamer sequences
`are then synthesized in their unnatural enantiomeric configur-
`ation as L-RNAs or L-DNAs. Following the rules of symmetry,
`these Spiegelmers bind to the natural target of interest just like
`the aptamers bind to the mirror-image selection target (11–13).
`Aptamers with pre- and post-SELEX modifications as well as
`Spiegelmers have been reported to be stable for many hours in
`biological fluids (11,14).
`For both strategies, the ability to chemically synthesize the
`lead candidates is crucial, since neither post-SELEX-modified
`aptamers nor Spiegelmers can be synthesized enzymatically
`due to the lack of appropriate enzymes. However, aptamers
`and Spiegelmers that are identified through the standard
`SELEX process usually comprise 60–90 nt, since they are
`typically selected from nucleic acid libraries with 30–40 nt
`long randomized regions plus fixed primer sites of ~15–25 nt
`on each side. Standard chemical oligoribonucleotide synthesis,
`however, is only efficiently applicable up to 60 nt, with
`decreasing yields and escalating production costs for every
`incorporated base.
`Therefore, the identified lead oligonucleotides need rational
`and experimental truncation before they can be further tested
`in biological systems (15). Whether or not the truncation of a
`given lead aptamer or Spiegelmer will eventually succeed,
`may not be foreseen. The flanking fixed regions sometimes
`participate in forming the scaffold that surrounds the binding
`interface and may thus not simply be omitted (16–18).
`
`*To whom correspondence should be addressed. Tel: +49 30 726247 240; Fax: +49 30 726247 243; Email: sklussmann@noxxon.net
`
`The authors wish to be known that, in their opinion, the first two authors should be regarded as joint First Authors
`
`Nucleic Acids Research, Vol. 31 No. 21 ª Oxford University Press 2003; all rights reserved
`
`
`
`e130 Nucleic Acids Research, 2003, Vol. 31, No. 21
`
`PAGE 2 OF 7
`
`Here we describe a methodology that allows the direct and
`rapid isolation of target binding RNA sequences that only
`require 10 fixed nucleotides in addition to the random region.
`The novel procedure, which we named Tailored-SELEX,
`relies on customized primers/adapters that are added by
`ligation before and removed within the amplification
`processes.
`In order to prove the efficiency of Tailored-SELEX, we
`carried out an in vitro selection approach against the optical
`antipode of the neuropeptide calcitonin gene-related peptide 1
`(a-CGRP) of rat. a-CGRP has been recognized as a potent
`vasodilator and has recently attracted attention as a novel
`target in acute migraine treatment (19–22).
`
`MATERIALS AND METHODS
`
`Oligonucleotides and peptides
`
`All oligonucleotides were synthesized at NOXXON Pharma
`AG using standard phosphoramidite chemistry. C-terminal
`biotinylated rat D-a-CGRP [all-D-(Ser–Cys–Asn–Thr–Ala–
`Thr–Cys–Val–Thr–His–Arg–Leu–Ala–Gly–Leu–Leu–Ser–
`Arg–Ser–Gly–Gly–Val–Val–Lys–Asp–Asn–Phe–Val–Pro–
`Thr–Asn–Val–Gly–Ser–Glu–Ala–Phe)-e-biotinyl-Lys-NH2]
`and rat L-a-CGRP were purchased from Bachem (Bubendorf,
`Switzerland).
`
`In vitro selection procedure
`Three complexities of a combinatorial RNA library (5¢-
`GGAC-N40-GACAGG) of 1015 different molecules, that was
`obtained by in vitro transcription of a synthetic ssDNA library
`(5¢-COMeCOMeTGTC-N40-GTCCTATAGTGAGTCGTATT-
`AGTAGTCGC) in the presence of a 1.5-fold excess of the
`forward primer (5¢-GCGACTACTAATACGACTCACTA-
`TAGGAC), were used as the starting library. The last two
`nucleotides of the 5¢ terminus of the DNA library were
`modified with 2¢-methoxy-cytidines in order to reduce the
`non-templated nucleotide addition at the 3¢ terminus of the
`in vitro transcripts.
`Before each selection round, the RNA library was dissolved
`in 10 mM HEPES/KOH pH 7.4, 150 mM NaCl, 4 mM KCl
`and denatured (95(cid:176)C, 5 min). It was then allowed to cool to 23
`or 37(cid:176)C for 15 min and CaCl2 (final 1 mM), MgCl2 (final
`1 mM) and Tween (final 0.05%) were added to give the final
`selection buffer. In the first five rounds the biotinylated rat
`D-a-CGRP concentration was 10 mM. In later rounds the
`peptide concentration was consecutively reduced to reach
`1 nM in round 14. The selection process was carried out at
`23(cid:176)C for rounds 1–9 and at 37(cid:176)C for rounds 10–15 (see Fig. 5).
`Neutravidin Agarose or Streptavidin Ultralink beads (Pierce,
`Rockford, IL) were utilized as selection matrices for the
`immobilization of the RNA–peptide complexes. The matrix
`was equilibrated with selection buffer before use. The
`selection process included a pre-column to prevent accumu-
`lation of non-specific matrix binders (pure selection matrix,
`30 min incubation) from round 2 onwards. The binding
`reaction of RNA and peptide was done in solution for 2 up to
`12 h. The complexes of RNA and biotinylated rat D-a-CGRP
`were immobilized for 30 min on the selection matrix. Non-
`binding oligonucleotides were removed by washing with 10–
`25 matrix volumes of selection buffer. Bound RNA was eluted
`
`twice (8 M urea, 10 mM EDTA, 65(cid:176)C, 15 min), extracted with
`phenol/chloroform/isoamyl alcohol, precipitated with ethanol
`and dissolved in water.
`
`Ligation and amplification
`The ligation reaction was done at 25(cid:176)C for 12 h [71.4 or 357 nM
`RNA with 36 or 7.2 UT4 DNA ligase/pmolRNA (Fermentas, St
`Leon-Roth, Germany), respectively, depending on the amount
`of eluted RNA, 13 ligation buffer (Fermentas), 5% PEG
`4000, 0.5 ml of RNaseOUT (Invitrogen, Karlsruhe, Germany),
`a 20-fold excess of forward adapter and a 20-fold excess of
`reverse adapters]. The adapters are double-stranded oligo-
`nucleotides: forward adapter [forward ligate (RNA, 5¢-GCG-
`ACUACUAAUACGACUCACUAUA) plus forward bridge
`(DNA, 5¢-GTCCTATAGTGAGTCG-3¢dT) with 2¢-3¢-dideoxy-
`thymidine at the 3¢ terminus], reverse adapter 1 [reverse ligate 1
`(DNA, pACGCTGAGCTGAACTCG-3¢dC, 5¢-phosphorylated
`and 3¢-blocked) plus reverse bridge 1 (DNA, 5¢-GCGAGT-
`TCAGCUOHCAGCGUOHCCTGTC) with two incorporated
`ribonucleotides] and reverse adapter 2 [reverse ligate 2 (DNA,
`5¢-pCGCTGAGCTGAACTCG-3¢dC, 5¢-phosphorylated and
`3¢-blocked) plus reverse bridge 2 (DNA, 5¢-GCGAGTTCAG-
`CUOHCAGCGIOHCCTGTC) with two incorporated ribo-
`nucleotides]. Reverse adapter 2 was added to the ligation
`reaction (10-fold excess of reverse adapter 1 and 2 each) from
`round 2 onwards. The reverse transcription reaction was
`carried out without intermediate purification at a final RNA
`concentration of 30 or 150 nM for 20 min at 51(cid:176)C and 10 min
`at 54(cid:176)C [13 First strand buffer (Invitrogen), 13 Q solution
`(Qiagen, Hilden, Germany), 0.5 mM dNTPs (Larova, Teltow,
`Germany), 4 U/ml Superscript Reverse Transcriptase II
`(Invitrogen), 10 mM DTT]. The cDNA was directly trans-
`ferred to the PCR [1–10 nM cDNA, 13 PCR buffer (Roche),
`5 mM forward primer, 5 mM reverse primer, 0.2 mM dNTPs
`(Larova), 0.05 U/ml Taq DNA polymerase (Roche, Mannheim,
`Germany), annealing temperature at 68(cid:176)C, 7–15 cycles]. The
`cleavage of the PCR reverse strand was done by alkaline
`fission of the ribonucleotides [310 mM (final) NaOH, 10 min
`at 95(cid:176)C, neutralization with HCl, buffered with 0.1 mM (final)
`sodium acetate]. The PCR product was ethanol precipitated
`before in vitro transcription [80 mM HEPES/KOH pH 7.5,
`22 mM MgCl2, 1 mM spermidine, 10 mM DTT, 1.2 mg/ml
`[a-32P]GTP (Hartmann, Braunschweig, Germany),
`BSA,
`4 mM NTPs (Larova), 32 mM 5¢-GMP (Sigma, Taufkirchen,
`Germany), 1 ml RNaseOUT (Invitrogen), 0.1 U/ml T7 RNA
`polymerase (Stratagene, La Jolla, CA) at 37(cid:176)C for 6–12 h].
`The transcribed RNA was gel-purified (23). The enriched
`library from round 15 was ligated and PCR amplified with all
`DNA primers before cloning and sequencing (GATC,
`Konstanz, Germany).
`
`Bioassay
`
`The bioassay was performed with SK-N-MC human neuro-
`blastoma cells (DSMZ, Braunschweig, Germany) which
`endogenously express the CGRP1 receptor. Cells were grown
`at 37(cid:176)C and 5% CO2 in DMEM (1 mg/l glucose), further
`containing 10% heat-inactivated fetal calf serum, 4 mM
`L-alanyl-L-glutamine, 50 U/ml penicillin, 50 mg/ml strepto-
`mycin, and, for experiments, seeded at 4 3 104 in 96-well
`microtiter plates. The Spiegelmers were pre-incubated in
`different concentrations with 1 nM rat a-CGRP in Hank’s
`
`
`
`PAGE 3 OF 7
`
`Nucleic Acids Research, 2003, Vol. 31, No. 21 e130
`
`A
`
`B
`
`5'
`\
`
`forward ligate ~
`T7 promoter] I 4nt
`
`RNA library
`randomized ':Ilion
`
`3'H
`
`forw. bridge
`
`5'
`\
`
`I
`
`forward ligate ~
`T7 promotei 4nt
`I
`I
`forw. bridge
`3'H
`
`I
`
`\
`5'
`
`RNA library
`(N+1 transcript)
`
`randomized
`
`I
`3'
`
`3'
`
`~ rev. ligate 1
`6nt j A
`u
`u
`reverse bridge 1
`
`3'H
`
`1
`'s·
`
`u
`reverse bridge 2
`
`Figure 1. (A) Cartoon of the RNA library and the double-stranded adapters each containing a ligate and an oligonucleotide bridge, before the ligation of the
`primer binding sites. The library consists of a randomized region that is flanked by 4 and 6 nt long stretches of fixed sequence (green). They serve as hybridiz-
`ation sites for the bridging oligonucleotides of the pre-annealed double-stranded adapters. The forward ligate contains a T7 RNA polymerase promoter at its
`3¢ end. Reverse bridge 1 is also used as a PCR reverse primer. Two nucleotides in the reverse bridge 1 are uridines (U) which allow for primer removal
`under alkaline conditions. Forward bridge and reverse ligates contain a 3¢ terminal 2¢-3¢-dideoxynucleotide (3¢H) to prevent them from mispriming in the
`PCR. (B) Up to 50% of all run-off transcripts contain a non-templated nucleotide (N) at their 3¢ ends (red). In order to ligate these species, an alternative
`adapter 2 was designed. It consists of a reverse ligate 2 that lacks the 5¢ terminal adenosine (A) and a reverse bridge 2 that offers the universal base inosine
`for hybridization opposite to the additional nucleotide. Thus, the overall length of the library does not increase.
`
`balanced salt solution plus 1 mg/ml BSA (60 min, 37(cid:176)C).
`Twenty minutes before the stimulation, the cells were pre-
`treated with 1 mM isobutyl-1-methylxanthin (IBMX). IBMX
`(1 mM) was also added to the CGRP/Spiegelmer solutions.
`For stimulation, the medium was removed and the CGRP/
`Spiegelmer mixtures were added to the cells. After 30 min
`stimulation at 37(cid:176)C, the cells were lysed and the cAMP
`content of the cell extract was quantified using cAMP-
`Screen(cid:212) System kits (Applied Biosystems, Foster City, CA).
`The luminescence signal was detected by a POLARstar
`Galaxy multi-detection microplate reader (BMG, Offenburg,
`Germany).
`
`RESULTS
`
`The conventional SELEX process, which comprises alternat-
`ing steps of selection and amplification, is carried out with
`oligonucleotide libraries consisting of 60–90 nt. The method
`we have devised is performed with a 50 nt long library that
`consists of a 40 nt long randomized region plus a total of 10
`fixed flanking nucleotides. The fixed regions are necessary for
`an efficient ligation of the primer binding sites that are needed
`for the amplification steps. These oligonucleotides (referred to
`as ligates) are enzymatically ligated to the core library with the
`assistance of bridging oligonucleotides (bridges) that are
`complementary to one of the ligates and the respective fixed
`sequence of the RNA library (Fig. 1A).
`All reactions that contribute to the amplification, including
`ligation and removal of the primers before the next selection
`round, may be pursued in a single reaction vessel without the
`need for additional purification steps (Fig. 2).
`
`Ligation
`
`T4 DNA ligase and a DNA bridge assisted ligation strategy
`(24). The bridging is achieved by the overhanging reverse
`strands of double-stranded adapter molecules that are com-
`plementary to the fixed nucleotides of the library. Four and six
`fixed nucleotides at the 5¢ and 3¢ ends, respectively, proved to
`be the minimum required length of the fixed sequence parts.
`Nevertheless, three fixed nucleotides are necessary on the 5¢
`end to accommodate the transcription initiation sequence GG-
`purine. Furthermore, the ligation strategy proved functional
`not only for RNA, but also for 2¢-F-pyrimidine-RNA.
`
`Design of the forward adapter
`
`The forward adapter consists of the forward ligate (the
`oligonucleotide that is ligated to the RNA) and the forward
`bridge. The adapter has a recessive 3¢ end that is comple-
`mentary to the four fixed nucleotides at the 5¢ end of the
`library. While the forward bridge was made of DNA, the
`forward ligate was made from RNA, since RNA is a better
`substrate in the subsequent reverse transcription step. The
`forward adapter was chosen to contain a T7 RNA polymerase
`promoter directly upstream of the ligation site. The forward
`bridge was made up of only 17 nt to prevent hindrance of
`cDNA synthesis during reverse transcription at elevated
`temperatures.
`Unused adapter molecules are carried over into the PCR,
`because no purification step between ligation and amplifica-
`tion is foreseen. PCR mispriming, however, is a common
`event during the amplification of nucleic acid libraries, due to
`the heterogeneous nature of the randomized region and the
`high primer concentrations commonly used. In order to
`avoid elongation of the forward bridge and potential ligation
`side products, we introduced a 2¢-3¢-dideoxy nucleotide at
`its 3¢ end.
`
`Since the ligation of the primer binding sites takes place with a
`finite number of molecules that survived the selection step,
`high ligation yields are desirable in order to propagate the
`binding sequences. This is particularly true in the first rounds,
`where only a few copies of each molecule are present.
`Ligation yields of 80% were attained with highly concentrated
`
`Design of the reverse adapters
`
`Two different kinds of reverse adapters—both made pre-
`dominantly from DNA—were used. The reverse adapter 1 was
`designed to accommodate RNA molecules with the 6 nt long
`3¢ fixed region at its 5¢ recessive end. The reverse ligate 1
`
`
`
`e130 Nucleic Acids Research, 2003, Vol. 31, No. 21
`
`PAGE 4 OF 7
`
`Figure 2. Flowchart of the tailored selection scheme. The amplification steps of the Tailored-SELEX process may be performed within a single tube. The
`process begins with the ligation of primer binding sites to those species within the nucleic acid pool that bind to a target of interest. The ligation is assisted
`by deoxyoligonucleotide bridges that span the ligation site. The reverse bridges also serve as cDNA and PCR primer in the subsequent reactions. The reverse
`strand of the PCR product is then cleaved under alkaline conditions at a predetermined cleavage site that was introduced via the reverse primer. After
`neutralization and an optional ethanol precipitation, the truncated reverse strand serves as a template for the in vitro transcription which is followed by RNA
`purification by PAGE or by DNase treatment and spin column filtration.
`
`5
`
`6 ..
`•
`
`2
`
`3
`
`4
`
`•
`
`carries a 5¢ phosphate since it is the phosphate donor in the
`ligation reaction. The 3¢ end is blocked by a 2¢-3¢-
`dideoxynucleotide in analogy to the forward bridge. The
`reverse bridge 1 was not blocked since it serves as cDNA and
`PCR primer. In order to dispose of the primer region before the
`next selection step, two ribonucleotides were incorporated in
`the reverse bridge 1 so as to create predetermined breaking
`points at alkaline pH.
`However, up to 50% of the products of run-off in vitro
`transcriptions with T7 RNA polymerase contain an additional
`nucleotide at their 3¢ ends (25). This phenomenon, which is
`known as 3¢ microheterogeneity, strongly confines the 3¢
`ligation efficiency of the bridge-assisted ligation because no
`undistorted duplex can be formed at the ligation site (26).
`Hence, for an efficient ligation of the inevitable N + 1
`transcripts that are formed within the repetitive SELEX
`process, we designed a reverse adapter 2. It consists of the 5¢
`phosphorylated 3¢ blocked reverse ligate 2 that lacks the first 5¢
`nucleotide in order to accommodate the additional base of the
`N + 1 transcripts (Fig. 1B). Hybridized to the reverse ligate 2 is
`the reverse bridge 2, which is identical to reverse bridge 1 in
`all but one position: we substituted the uridine at the 3¢
`cleavage site with the universal nucleobase analog inosine that
`can base pair with any base at the transcript’s N + 1 position,
`so that T4 DNA ligase will ligate the paired ends. Analogous
`to the uridine in the reverse bridge 1, the inosine nucleotide
`also served as a predetermined fission point at alkaline pH. By
`using an equimolar mixture of the reverse adapters 1 and 2,
`overall ligation yields were improved from 40 up to 80%
`(Fig. 3).
`
`Reverse transcription, PCR and alkaline fission
`
`Reverse transcription was performed at the highest possible
`temperature in order to resolve RNA secondary structures and
`to ease the removal of the forward bridge, which might
`interfere with cDNA synthesis.
`Twenty to 100 pmol of PCR product accumulated from
`10 fmol to 5 pmol of template per 100 ml of PCR within 7–15
`cycles. The forward primer resembles the forward ligate but
`additionally extends into the GC-rich 5¢ fixed region of the
`nucleic acid pool to improve priming efficiency. The PCR
`
`82 % 55% 40 % 90 % 80 %
`ligation yield
`
`Figure 3. Improved ligation yield with special adapters. The autoradiogram
`shows the bridge-assisted ligation of primer binding sites to a 32P-labeled
`in vitro transcribed RNA library (mixture of 50 and 51mer due to the partial
`non-templated addition of a single nucleotide) (1). While ligation to the
`RNA’s 5¢ end with the forward adapter (plus 25 nt) was acceptable (2), liga-
`tion to the 3¢ end with reverse adapter 1 only (plus 18 nt) (3) and the overall
`ligation yield (plus 43 nt) (4) were insufficient, because N + 1 transcripts
`were not ligated. By using an equimolar mixture of reverse adapters 1 and
`2, the 3¢ ligation efficiency (5) and the overall ligation yield (6) were
`markedly improved.
`
`reverse primer is identical to the reverse bridge. It contains
`two ribonucleotides to provide for alkaline fission. The second
`ribonucleotide is incorporated in order to prevent the cleaved
`reverse primer from re-hybridizing to the forward strand that
`might lead to a possible read-through of the RNA polymerase.
`Cleavage of the PCR product under alkaline conditions
`leads to strands of unequal length, as the reverse strand lacks
`the unwanted reverse primer site (Fig. 4).
`
`In vitro transcription
`
`The cleaved PCR product then serves as a template for the
`in vitro transcription. Since the T7 RNA polymerase promoter
`is located in the forward primer and the forward ligate
`upstream of the ligation site, the transcripts commence with
`the identical initiation sequence that is equal to the 5¢ fixed
`
`
`
`PAGE 5 OF 7
`
`Nucleic Acids Research, 2003, Vol. 31, No. 21 e130
`
`2
`
`3
`
`+- PCR product/forward strand
`+- truncated PCR reverse strand
`
`+- PCR forward primer
`+- PCR reverse primer with
`alkaline fission positions
`
`Figure 4. Alkaline fission of the PCR product. The reverse strand of the
`PCR product is truncated by alkaline fission at the ribonucleotide positions
`within the reverse primer. The procedure removes both the incorporated and
`unincorporated reverse primer that is now dispensable. (1) Ten base pair
`size marker, (2) PCR product before alkaline treatment, (3) PCR product
`after alkaline fission of the reverse strand and the unincorporated reverse
`primer.
`
`sequence of the nucleic acid library. The sequence was
`designed to provide for a high transcription yield (27) and a
`good ligation efficiency. Additionally, we included an excess
`of guanosine monophosphate as an initiation nucleotide into
`the transcription reaction, so that
`the majority of
`the
`transcripts contain a 5¢ monophosphate that is required for
`the next ligation step.
`
`Identification of a-CGRP binding Spiegelmers
`As a proof of concept, we carried out 15 rounds of in vitro
`selection against the unnatural enantiomer of rat a-CGRP.
`After
`the fifth selection round, enrichment of binding
`sequences became visible. In subsequent selection rounds,
`the peptide concentration was successively decreased from the
`initial 10 mM to 30 nM in round 9, without loss of pool
`binding. We also increased the stringency by switching from
`room temperature to 37(cid:176)C after round 9. In round 15, no more
`progress could be achieved (Fig. 5). With regard to pool
`binding or variations in sequence length, the system proved to
`be stable within the conducted 15 rounds of selection/
`amplification. The enriched pool of round 15 was cloned
`and 38 sequences were determined, 14 of which were different
`(Fig. 6). Their length varied between 48 and 52 nt, which is
`probably due to errors of the polymerases involved. By
`sequence alignment we identified four motifs that occurred in
`every sequence, either alone or in combination with each
`other. One of these motifs was found to occur in three families
`both as a full-length motif (24 nt) or as a truncated version
`(11 nt).
`
`Biological activity of the Spiegelmers
`
`Nine sequences were synthesized as Spiegelmers, without the
`need for prior truncation and further modification for their
`testing in cell culture. All Spiegelmers tested blocked rat
`
`l
`~ u
`I! - 5
`<( z
`0:: ,,
`0 .,,
`
`10
`9
`8
`7
`6
`
`4
`3
`2
`1
`0
`
`C
`
`C
`::,
`
`- - - - - -
`
`a...d,tL
`2 3 4 5 6 7 8 9 10 11 12 13 14 15
`
`23' C
`selection round
`
`37'
`
`10000
`
`~
`1000 ~
`0 .,,
`~
`C
`:'l
`0 u .,
`iJ
`Q. .,
`
`100
`
`C
`
`10
`
`Q.
`
`Figure 5. Course of the in vitro selection. The histogram shows the course
`of the in vitro selection. The fraction of the RNA pool eluted from the un-
`derivatized streptavidin or neutravidin matrix (yellow bars) and from the
`identical matrix after capturing RNA:peptide complexes from a solution
`(green bars) with the indicated peptide concentration (red triangles) is
`shown. Starting from round 6, selection was usually performed at three
`different peptide concentrations. Only the data of the minimal successful
`peptide concentration are shown.
`
`a-CGRP-induced cAMP formation with an IC50 of 500 nM or
`better, but with no clear preference for any of the four primary
`sequence motifs. The best
`inhibition was observed with
`Spiegelmer STAR-F12 with an IC50 of 3 nM (Fig. 7). The
`inverse Sequence STAR-F12inv served as a control and
`showed no inhibitory effect. While the 5¢ fixed sequence of the
`Spiegelmer STAR-F12 was needed for target binding, the six
`3¢ terminal fixed nucleotides could be removed. The resulting
`42mer STAR-F12-D43–48 had an IC50 of 3 nM, the same
`inhibition potency as the full-length Spiegelmer.
`Since the relationship between intracellular cAMP produc-
`tion and the concentration of free extracellular CGRP was
`linear under our experimental conditions, the dissociation
`constant KD almost equals the IC50. However, due to the
`almost equimolar concentrations of Spiegelmer and CGRP at
`the IC50,
`the apparent
`than the
`IC50 is slightly higher
`dissociation constant KD. The calculation of KD following
`the equation KD = IC50 – 0.5 3 [CGRP] leads to a dissociation
`constant of 2.5 nM.
`
`DISCUSSION
`
`Since the invention of the SELEX process, a large number of
`aptamers and several Spiegelmers active against a variety of
`biologically relevant
`targets have been generated (6).
`However, the transition from the biochemical and biophysical
`laboratory into living systems like cell culture, animals or
`even man, has been achieved only in a small number of them
`so far (28). One of the challenges is still the biological stability
`of oligonucleotides. Even for 2¢-F- or 2¢-NH2-pyrimidine-
`RNA aptamers, the introduction of additional 2¢ modifications
`at as many purine positions as possible is desirable. Such post-
`SELEX-modified aptamers can only be produced by chemical
`methods. Spiegelmers are biostable due to their unnatural
`configuration and require chemical synthesis as well. This is
`not accomplished easily since the partially stabilized aptamer
`
`
`
`e130 Nucleic Acids Research, 2003, Vol. 31, No. 21
`
`PAGE 6 OF 7
`
`--GACAGG 17
`STAR-All
`--GACAGG
`1
`STAR- C9
`--GACAGG
`1
`STAR-F7
`STAR- A7
`- -GACAGG
`1
`STAR-F12
`GAGACAGG
`1
`STAR- E9
`G--GACAGG
`1
`---GACAGG
`STAR- D8
`1
`- --GACAGG
`STAR-GlO
`1
`3
`---GACAGG
`~ - - -
`STAR- B11
`STAR- B10 GGAC- ----- - - - - - - --- -UCAUACGGOGAAAGAAACGAUUCGUCUAGCGACGAUG-AG-- --GACAGG
`1
`STAR- G12
`1
`STAR- D12 GGACGACAU-GUUCCCAGGAACAUACGGOGAAAGAAACGAUU- GUC-------------G----GACAGG
`6
`STAR- D9 GGACGACAU- GUUCCAAGGAACAUACGGOGAAAGAAACGAUU- GUC-------------G----GACAGG
`1
`STAR-C12 GGACGACAU-GUUC-AGAGAACAUACGGOGAAAGAAACGAUU-GUO-------------G----GACAGG
`1
`
`Figure 6. Aligned sequences from the CGRP binding RNA pool after selection round 15. The numbers indicate the individual sequence’s frequency of occur-
`rence. The fixed sequence parts were shaded in gray. Four different conserved motifs were identified as indicated by the background colors. The blue motif
`was found to occur as a 24mer or in part as an 11mer if it is flanked by the magenta-colored 16 nt long split-motif. The blue motif appeared close to the 5¢
`end, in the middle or close to the 3¢ end of the randomized region. While the green and magenta motifs were unique to the in vitro selection at 37(cid:176)C, the blue
`and yellow motifs were also frequent in room temperature selections that were carried out in parallel (sequences not shown). The sequences within each
`group seem to have partly arisen from an identical ancestor sequence with Taq polymerase-induced mutations.
`
`120
`
`100
`
`80
`
`60
`
`40
`
`20
`
`"' e:.
`Q.
`:i;
`< u
`
`0
`0,1
`
`- - F12
`
`-+- F12-a43-48
`
`10
`
`100
`
`Spiegelmer [nM]
`
`Figure 7. Dose–response curve for the Spiegelmer STAR-F12 and its 3¢
`truncated version STAR-F12-D43–48. IC50 values are indicated by the
`arrows. The Spiegelmer at different concentrations was pre-incubated with
`1 nM rat a-CGRP at 37(cid:176)C for 1 h. Intracellular cAMP formation in SK-N-
`MC cells was then stimulated for 30 min at 37(cid:176)C. After cell lysis, cAMP
`was quantified in a chemiluminescent immunoassay.
`
`candidates that are identified by the SELEX process are
`between 60 and 90 nt in length and to date only shorter RNAs
`with <60 nt are efficiently produced chemically at reasonable
`costs. As yields decrease with every coupling step, shorter
`sequences will be preferable for economical reasons, as soon
`as larger batches for animal
`tests are to be produced.
`Therefore, time-consuming experimental truncation processes
`that do not always lead to the desired results need to be carried
`out before Spiegelmers or biostable aptamers are available.
`We have developed the Tailored-SELEX strategy to afford
`the identification of short aptamers by ligation and removal of
`primer binding sites within the amplification part of the
`selection-amplification scheme. The candidates are only 10 nt
`longer than the randomized region of the initial library.
`
`Alternative strategies, e.g. blocking of primer binding sites
`by hybridization of complementary oligonucleotides, fishing
`of
`truncated sequences with full-length complementary
`strands and further ligation strategies, have been proposed
`by Toole et al. and Pagratis et al. in the patent literature
`(29,30).
`Tailored-SELEX is simple and requires only a little more
`hands-on time than a conventional SELEX process. The two
`extra steps, namely ligation of primers and alkaline fission of
`the PCR product, compare favorably with the time needed for
`post-SELEX truncation protocols. This holds especially true
`for the generation of aptamers against flexible peptides that
`require a structurally rigid binding partner. In these instances,
`the aptamer provides a scaffold and an epitope for high affinity
`binding, which is often governed by an induced fit mechanism
`by the peptide (31). Since the length of the aptamer’s target
`binding sequence could generally not be influenced by the
`experimental set-up, truncated peptide-directed aptamers were
`found to involve at least 50 nt, which is substantially longer
`than truncated protein-directed aptamers. An exception is
`provided by the truncated aptamers binding the arginine-rich
`core motif of the HIV-1 Rev-protein, which are only 27 and
`35 nt in length, probably because binding of arginines to
`nucleic acids is very advantageous (32).
`The calculated affinity (KD = 2.5 nM at 37(cid:176)C) of the best rat
`a-CGRP binding Spiegelmer (STAR-F12) almost reaches the
`binding constant of the neuropeptide to its receptor (EC50 =
`1 nM). The dissociation constants can be compared well with
`those of aptamers that were directed against larger proteins
`such as IgE (10 nM, 37(cid:176)C) (17), tyrosine phosphatase (18 nM,
`room temperature) (18) or complement C5 (20 and 2 nM after
`reselection, 37(cid:176)C) (33). Peptide-directed aptamers usually
`display higher dissociation constants for their respective
`targets, as reported for aptamers against substance P (190 nM,
`room temperature) (16), the arginine-rich peptide fragment of
`HIV Rev (19 nM, 4–7(cid:176)C) (34), K-Ras derived farnesylated
`peptide (139 nM, 23(cid:176)C) (35) and neuropeptide Y (370 nM at
`37(cid:176)C) (36) or the Spiegelmers against vasopressin (900 nM,
`
`
`
`PAGE 7 OF 7
`
`Nucleic Acids Research, 2003, Vol. 31, No. 21 e130
`
`room temperature) (12), GnRH (20–100 nM, room tempera-
`ture) (13,37) or a 25 amino acid domain of Staphylococcal
`Enterotoxin B (200 nM, room temperature) (38). A different
`measure has to be applied to aptamers directed to nucleic acid
`and heparin binding proteins. Due to the favorable biophysical
`nature of these targets, resulting aptamers frequently show
`picomolar dissociation constants (6).
`In conclusion, the above data confirm that Tailored-SELEX
`is suitable to identify not only short, but also high-affinity,
`aptamers/Spiegelm