[CANCER RESEARCH 64, 5720 -5727, August 15, 2004]
`
`Heparin- Binding EGF -Like Growth Factor Is a Promising Target for Ovarian
`Cancer Therapy
`
`Shingo Miyamoto,1 Michinari Hirata,2 Ayano Yamazaki,2 Takuya Kageyama,2 Hidetoshi Hasuwa,3
`Hiroto Mizushima,2 Yoshihiro Tanaka,1 Hiroshi Yagi,1 Kenzo Sonoda,1 Masahiro Kai,4 Hideo Kanoh,4
`Hitoo Nakano,1 and Eisuke Mekada"
`'Department of Obstetrics and Gynecology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan; 2Department of Cell Biology, Research Institute for
`Microbial Diseases and 'Department of Experimental Genome Research, Genome Information Research Center, Osaka University, Osaka, Japan; and 'Department of
`Biochemistry, Sapporo Medical University School of Medicine, Sapporo, Japan
`
`ABSTRACT
`
`Ovarian cancer is the most frequent cause of cancer death among all
`gynecologic cancers. We demonstrate here that lysophosphatidic acid
`(LPA)- induced ectodomain shedding of heparin- binding EGF -like growth
`factor (HB -EGF) is a critical to tumor formation in ovarian cancer. We
`found that among the epidermal growth factor receptor (EGFR) family of
`growth factors, HB -EGF gene expression in cancerous tissues and HB-
`EGF protein levels in patients' ascites fluid were significantly elevated.
`The human ovarian cancer cell lines SKOV3 and RMG -1 form tumors in
`nude mice. Tumor formation of these cells was enhanced by exogenous
`expression of pro -HB -EGF and completely blocked by pro -HB -EGF gene
`RNA interference or by CRM197, a specific HB -EGF inhibitor. Trans -
`fection with mutant forms of HB -EGF indicated that the release of soluble
`HB -EGF is essential for tumor formation. LPA, which is constitutively
`produced by ovarian cancer cells, induced HB -EGF ectodomain shedding
`in SKOV3 and RMG -1 cells, resulting in the transactivation of EGFR and
`the downstream kinase extracellular signal -regulated kinase/mitogen-
`activated protein kinase. LPA- induced transactivation was abrogated by
`HB -EGF gene RNA interference or by CRM197. Introduction of lipid
`phosphate phosphohydrolase, which hydrolyzes LPA, decreased the con-
`stitutive shedding of HB -EGF, EGFR transactivation, and the tumori-
`genic potential of SKOV3 and RMG -1 cells. These results indicate that
`HB -EGF is the primary member of the EGFR family of growth factors
`expressed in ovarian cancer and that LPA- induced ectodomain shedding
`of this growth factor is a critical step in tumor formation, making HB-
`EGF a novel therapeutic target for ovarian cancer.
`
`confirmed that EGFR overexpression is significantly associated with
`a high risk of progression in ovarian cancer patients (4). Although the
`frequency of ErbB2 overexpression is low, it has been correlated with
`clinical outcome (2, 3). Seven ligands have been described for EGFR:
`EGF; transforming growth factor (TGF) a; heparin- binding EGF -like
`growth factor (HB -EGF); amphiregulin; betacellulin; epiregulin; and
`epigen. Although a significant correlation between EGFR activation
`and ovarian cancer progression has been documented, which EGFR
`ligands contribute to cancer progression is largely unknown. The
`expression of TGF -a and amphiregulin was described in ovarian
`carcinomas, although expression levels varied in tumors (5, 6). Pro -
`HB -EGF is also expressed in ovarian cancer cells, because ovarian
`cancer cells are sensitive to diphtheria toxin (DT) (7), and DT utilizes
`pro -HB -EGF as the DT receptor (8). However, no comprehensive
`studies examining the significance of EGFR ligands in ovarian cancer
`progression have been reported.
`HB -EGF is initially synthesized as a membrane -bound precursor
`(pro -HB -EGF; Ref. 9). The soluble form of HB -EGF (sHB -EGF) is
`released from the cell membrane by ectodomain shedding of pro -HB-
`EGF (10), in a manner similar to that for other EGFR ligands (11).
`Ectodotnain shedding of pro -HB -EGF is critical for growth factor
`activity, and unregulated release of sHB -EGF results in lethal severe
`hyperplasia in mice (12). A number of physiological and pharmaco-
`logical stimuli, which include G protein -coupled receptor (GPCR)
`ligands such as lysophosphatidic acid (LPA), induce ectodomain
`shedding of pro -HB -EGF (13 -15), indicating that overabundance of
`such stimuli may cause excess release of sHB -EGF.
`Ascites from ovarian cancer patients are considered to be a rich
`source of growth factor activity for ovarian cancer cells. The mole-
`cules involved in this process have been termed ovarian cancer
`activating factors (16). Recent biochemical analysis has revealed that
`LPA is one possible ovarian cancer activating factor candidate (17,
`18). LPA is a simple phospholipid with numerous cellular effects
`including growth promotion, cell cycle progression, and cytoskeletal
`organization (19 -21). LPA levels are markedly elevated in the plasma
`and ascites of patients with ovarian cancer (22). LPA signals are
`generally mediated by LPA receptors, members of the GPCR family.
`Recent studies indicated that LPA and other GPCR ligands induce
`proteolytic cleavage of the extracellular domain (ectodomain shed-
`ding) of EGFR ligands at the cell surface (14, 15). The secreted EGF
`family ligands then activate EGFR on ligation (14, 23). Thus, LPA
`signals and the EGFR system are thought to be closely connected.
`To search for novel effective therapeutic targets, in this work we
`studied the expression of EGFR ligands in ovarian cancer patients and
`found HB -EGF to be the primary EGFR ligand altered in ovarian
`cancer. Based on this evidence, we examined the role of HB -EGF in
`tumor formation of ovarian cancer cells in nude mice. Results showed
`that HB -EGF, especially in its soluble form, is essential for tumor
`growth of ovarian cancer cells in nude mice; therefore, inhibition of
`gene expression or inhibition of growth factor activity can block
`tumor growth. We also show evidence that LPA, which is produced
`Lilly Exhibit 1269
`5720
`Eli Lilly & Co. v. Teva
`Pharms. Int' 1 GMBH
`Downloaded from cancerres.aacrjournals.org on July 18, 2019. © 2004 American Association for Cancer
`Research.
`
`INTRODUCTION
`
`Ovarian cancer is the most frequent cause of cancer death among all
`gynecologic cancers, and therapies over the last 30 years have not
`improved cure rates (1). To develop a novel effective therapy for
`ovarian cancer, further understanding of the processes and molecules
`leading to the initiation and progression of ovarian cancer is required.
`Activation of the ErbB family of receptors is involved in the
`progression of various cancers; therefore, epidermal growth factor
`receptor (EGFR) and ErbB2 are recognized as effective targets for the
`therapy of various cancers (2, 3). In the case of ovarian carcinoma,
`impairments of the epidermal growth factor (EGF) system, including
`EGFR ligands and ErbB family receptors, have also been reported to
`be involved in autonomous proliferation of ovarian carcinoma cells.
`As described in the literature (2, 3), EGFR overexpression occurs in
`35 -70% of all primary ovarian cancers. Statistical analyses have
`
`Received 3/5/04; revised 6/14/04; accepted 6/21/04.
`Grant support: Grant -in -Aid 14032202 from the Ministry of Education, Culture,
`Sports, Science and Technology (to E. Mekada).
`The costs of publication of this article were defrayed in part by the payment of page
`charges. This article must therefore be hereby marked advertisement in accordance with
`18 U.S.C. Section 1734 solely to indicate this fact.
`Note: Supplementary data for this article can be found at Cancer Research Online
`( http : / /cancerres.aacrjournals.org).
`Requests for reprints: Eisuke Mckada, Department of Cell Biology, Research Insti-
`tute for Microbial Diseases, Osaka University, 3 -1 Yamadaoka, Suita, Osaka 565 -0871,
`Japan. Phone: 81 -6 -6879 -8286; Fax: 81 -6- 6879 -8289; E -mail: emekada®biken.osaka-
`u.ac.jp.
`
`

`

`HB -EGF IS A TARGET FOR OVARIAN CANCER THERAPY
`
`by ovarian cancer cells, causes enhanced ectodomain shedding of
`pro -HB -EGF and consequent tumor formation.
`
`MATERIALS AND METHODS
`
`7.2) [1 mg /week] was injected intraperitoneally into tumor- bearing mice each
`week. All experimental use of animals complied with the guidelines of Animal
`Care of Kyushu University.
`Reverse Transcription -PCR. For the cell lines used in this study, total
`cellular RNA was purified. First -strand cDNA synthesis was performed as
`described previously (30). PCR analysis for the expression of EGFR ligands
`and glyceraldehyde -3- phosphate dehydrogenase (GAPDH) as an internal con-
`trol was performed using the primers described (31). For real -time PCR
`analysis, total cellular RNA was purified from frozen tumor tissues; first- strand
`cDNA synthesis was performed according to the manufacturer's protocol.
`Primers specific for HB -EGF (5'- CTCCCTCCTGCATCTGCCACCC -3'),
`TGF -a ( 5'- CCAGCATGTGTCTGCCATTCTGGG -3'), amphiregulin (5' -TCA-
`GAGTTGAACAGGTAGTTAAGCCCCC-3'), and GAPDH (5'- CCGACTCT-
`TGCCCTTCGAAC-3') were labeled with 6- carboxyfluorescein fluorescent
`spectrum as a reporter. The amplification primer pairs were 5'- TGGAGAAT-
`GCAAATATGTGAAGGA-3' and 5'- AGGATGGTTGTGTGGTCATAGG -
`TAT-3' for HB -EGF, 5'- GATTCCCACACTCAGTTCTGCTT -3' and 5' -CAC-
`AGCGTGCACCAACGT-3' for TGF -a, 5'- CCTGGCTATATTGTCGATGAT -
`TCA-3' and 5'- GTATTTTCACTTTCCGTCTTG 1-1"1-í'G -3' for amphiregulin,
`and 5'- GAAGGTGAAGGTCGGAGTC -3' and 5'-CTTTAGGGTAGTGGTA-
`GAAG-3' for GAPDH. PCR reactions were carried out using the ABI Prism 7700
`Sequence Detection System (Perkin -Elmer Applied Biosystems, Foster City, CA).
`The expression index for each messenger RNA was defined as the EGFR ligand
`messenger RNA copy number /GAPDH messenger RNA copy number X 104.
`Assay of Cell Surface Activities Hydrolyzing LPA of LPP -Transfected
`SKOV3 Cells. Radiolabeled LPA was prepared by Escherichia coli diacyl-
`glycerol kinase- catalyzed phosphorylation of monoolein (Sigma- Aldrich, St.
`Louis, MO) as described previously (25, 32). Cells (3 x 105 cells /well in a
`12 -well culture plate) were starved for 24 h in RPMI 1640 containing 0.1%
`bovine serum albumin. The cells were then incubated for 10 min at 37 °C in
`medium containing 3% bovine serum albumin and radioactive LPA (20 µM;
`specific radioactivity, ^-7000 cpm /nmol; Ref. 33). The culture medium was
`then rapidly aspirated, and the cells were washed once with 0.5 ml of Tris-
`buffered saline. The inorganic phosphate liberated was extracted from the
`aliquots (250 pl) of the combined medium as described previously (25, 32).
`The Amount of EGFR Ligands in Ascitic Fluid. The quantity of HB-
`EGF in patient ascites fluids was determined by 125I -DT binding. One milliliter
`of ascites fluid was incubated with 20 pi of heparin -Sepharose CL -6B (Am-
`ersham Biosciences, Uppsala, Sweden) for 5 h at 4 °C. Gels were washed in
`phosphate- buffered saline, incubated with 125I-DT (100 ng/ml) in the presence
`or absence of excess unlabeled DT for 12 h at 4 °C, and then washed with
`phosphate- buffered saline containing 1 mg /ml bovine serum albumin. The
`radioactivity bound to the gels was then counted in a gamma counter; the
`specific binding of 125I-DT was determined. The amount of HB -EGF was
`determined by normalization to a standard curve obtained by assessment of
`recombinant HB -EGF. The amounts of TGF -a and amphiregulin were deter-
`mined by enzyme -linked immunosorbent assay systems provided by R &D
`Systems, Inc. (Minneapolis, MN), and TECHNE Corp. (Minneapolis, MN),
`respectively. The sensitivity of these assays was <2.2 pg/ml for TGF -a and
`<5 pg /ml for amphiregulin.
`Patients and Statistical Analysis. All of the patients examined had un-
`dergone surgery between 1997 and September 2002 at the Department of
`Obstetrics and Gynecology, Kyushu University Hospital. All tissue samples
`were obtained at surgery from 34 patients with stage III /IV ovarian cancer
`derived from coelomic epithelium and 10 patients with normal ovaries who
`had surgery for benign disease or other gynecologic cancer. Ascitic fluid was
`also obtained from a total of 37 patients with normal ovaries (n = 10), benign
`ovarian cysts (n = 10), and stage III /IV ovarian cancers (n = 17). In this study,
`informed consent was obtained from all patients. The values for each EGFR
`ligand were analyzed using the Mann -Whitney U test. P < 0.05 was consid-
`ered statistically significant.
`
`Reagents and Antibodies. DT and CRM197 were prepared as described
`previously (24). To administer CRM197 to mice, LPS -like materials contam-
`inating the CRM197 preparations were removed using Detoxi Gel (Pierce
`Biotechnology, Rockford, IL). LPA 18:1 (1- oleoyl -sn- glycerol -3- phosphate,
`sodium salt) and LPA 18:0 (1- stearoyl -sn- glycerol -3- phosphate, sodium salt)
`were purchased from Avanti Polar Lipids, Inc. (Alabaster, AL). Suramin,
`GM6001, PD98059, and PD153035 were obtained from Calbiochem (San
`Diego, CA). Polyclonal rabbit anti -EGFR and anti -mitogen- activated protein
`kinase (MAPK) antibodies were purchased from Santa Cruz Biotechnology
`(Santa Cruz, CA). Mouse monoclonal antibodies against phospho- tyrosine and
`phospho -MAPK were acquired from Upstate Biotechnology Inc. (Lake Placid,
`NY). Sheep antimouse IgG was obtained from Amersham Corp. (Arlington
`Heights, IL). Peroxidase- conjugated goat antirabbit IgG was purchased from
`Zymed (San Francisco, CA).
`Cell Culture. SKOV3, RMG -1, OVMG1, and the transfected cells were
`maintained in RPMI 1640 supplemented with 100 units /ml penicillin G, 100
`µg /ml streptomycin, and 10% fetal bovine serum (ICN Biomedical, Irvine,
`CA).
`Plasmid Constructions and Transfection. Constructions of plasmids en-
`coding human pro -HB -EGF cDNA, the uc mutant, and the ATM mutant (12)
`inserted into the eukaryotic expression vector pRc /CMV (Invitrogen, Carlsbad,
`CA) have been described previously. Plasmids encoding FLAG -tagged lipid
`phosphate phosphohydrolase (LPP) -1 and FLAG -tagged LPP -3 were gener-
`ated by polymerase chain reaction (PCR) using human LPP -1 and LPP -3
`complete cDNA (25) as templates. These fragments were then inserted into the
`BamHI -Notl sites of pCX4pur vector. To construct the HB -EGF small inter-
`fering RNA (siRNA) vector (pH l- PUR/siRNAHB -EGF), we synthesized the
`following DNA oligonucleotides: 5'- CCCGTCCGTGACTTGCAAGAGGT -
`TCAAGAGACCTCTTGCAAGTCACGGACTTTTTGGAAA and 5' -CTA-
`GTTTCCAAAAAGTCCGTGACTTGCAAGAGGTCTCTTGAACCTC-
`TTGCAAGTCACGGACGGGTGCA. After amplification of the cDNA
`fragments by PCR, the fragments were cloned into the PstI and XbaI site of the
`pH 1 RNA interference vector (26). The product was digested with BamH 1 and
`XhoI and then cloned into a pPUR selection vector (Clontech, Palo Alto, CA)
`to confer puromycin resistance. Transfections of all constructs into SKOV3
`and RMG -1 cells were performed using LipofectAMINE 2000 reagent (In-
`vitrogen), according to the manufacturer's instructions. Transfected cells were
`selected with 400 µg/ml G418 or 5 µg /ml puromycin.
`Assays of Diphtheria Toxin Binding and Protein Tyrosine Phosphoryl-
`ation. To remove extracellular matrix components, cells were detached with
`trypsin -EDTA and then allowed to recover for 30 min in RPMI 1640 with 10%
`fetal bovine serum (27). To assess the effect of each pharmacological agent on
`DT binding, after rinsing with serum -free medium, cells were incubated with
`serum -free medium at 37 °C for 30 min. Cells (1 X 106) were seeded on
`polylysine- coated 6 -cm dishes. Samples were incubated with serum -free RPMI
`1640 at 37 °C for 1 h to assure the complete adherence of cells to
`the
`polylysine- coated dishes. Binding of 1251-labeled DT to cells was measured,
`and values of the specific binding were determined as described previously (8).
`To examine the activation of EGFR and MAPK, cells were treated as described
`above. Cells were rinsed in phosphate- buffered saline containing 1 mm sodium
`orthovanadate and then lysed in radioimmunoprecipitation assay buffer [1%
`Triton X -100, 1% sodium deoxycholate, 0.1% SDS, 150 mm NaCI, 50 mm Tris
`(pH 8.0), 0.2 unit/ml aprotinin, 2 µg/ml leupeptin, 1 µg /ml pepstatin A, 2 mm
`phenylmethylsulfonyl fluoride, and 1 mm sodium orthovanadate]. Extracts and
`immunoprecipitants were then subjected to SDS -polyacrylamide gel electro-
`phoresis and immunoblotting analysis (28).
`Tumor Growth in Nude Mice. Subconfluent cell cultures were detached
`RESULTS
`from plates with trypsin -EDTA. A total volume of 250 pl containing 5 X 106
`cells suspended in serum -free RPMI 1640 was injected into female BALB /c
`Enhanced Expression of HB -EGF in Human Ovarian Cancer.
`nu/nu mice at 5 weeks of age (Charles River Laboratories). Injection- treated
`In the beginning of this study, we determined the expression levels of
`mice were examined every week for tumor apparition. Tumor volume was
`EGFR ligand genes in ovarian cancer. Among EGFR ligands, the
`calculated as described previously (29). To assess the effect of -CRM197
`expression of HB -EGF, TGF -a, amphiregulin, and epiregulin was
`inhibition, CRM197 dissolved in 1 ml of 20 mm HEPES and 0.15 M NaCI (pH
`5721
`
`Downloaded from cancerres.aacrjournals.org on July 18, 2019. © 2004 American Association for Cancer
`Research.
`
`

`

`A
`
`HB-EGF
`P<0.01 -I
`
`500 -
`
`400 --
`
`x
`
`Ç 300 -
`1= o
`ái 200 -
`N
`L .
`X w
`100--
`
`tt
`
`OVCA
`(t.34)
`
`0 --..
`
`i
`
`;
`NO
`(t12)
`
`B
`
`HB-EGF
`
`Amphiregulin
`N.S.
`5-
`4-
`
`1
`
`x o
`
`1-
`
`-*-
`
`11.
`
`NO
`(n=12)
`
`...._.........___-i.iI.i`.-__
`OVCA
`(n=34)
`
`Amphiregulin
`
`IIB -EGF IS A TARGET FOR OVARIAN CANCER THERAPY
`
`TGF-a
`N.S.-i
`
`s
`
`NO
`(n=12)
`
`OVCA
`( t34)
`
`TGF-a,
`N.S. ----1
`N.S.-,
`I. N.S. -
`
`Í
`
`SO
`
`(pg/ml)
`50-
`
`ú.
`--
`ó
`c
`o
`
`.
`
`40-
`
`30-
`
`2 0 -
`
`G
`o
`c 10-
`o
`C)
`
`1
`OVCA
`(n=17)
`
`(pg/ml)
`1000-
`
`rn ï o.
`
`E
`ó
`c
`o
`:w.
`CJ
`
`800-
`
`600 °°
`
`400-
`
`c
`o 200-
`C
`o
`Ca
`
`0
`
`:4
`NO
`(rt=10)
`
`(ng /ml)
`5-
`
`4-
`
`3-
`
`2-
`
`1-
`
`o
`
`N.S. -I
`
`: -..-
`
`ii
`ss.
`OC
`OVCA
`OC
`NO
`NO
`(ml 0)
`(n=10)
`(n=17)
`(n=10)
`(n=10)
`Fig. 1. Association of EGFR ligand expression levels with clinical outcome in human ovarian cancer. A, expression index of HB -EGF, TGF -a, and amphiregulin in patients with
`either normal ovaries (NO) or ovarian cancer (OVCA). B, the ascites fluid levels of HB -EGF, TGF -a, and amphiregulin in patients with normal ovaries (NO), ovarian cysts (OC), and
`ovarian cancer (OVCA). Bars indicate mean. NS, not significant.
`
`i
`
`s
`
`s
`..011...
`
`it
`OVCA
`(M17)
`
`-.----
`
`ii
`
`OC
`(n=10)
`
`measured by nonquantitative reverse transcription -PCR (RT -PCR) in
`specimens from patients with ovarian cancer. EGF and betacellulin
`expression were not detected (data not shown). Then, we determined
`the expression levels of these four EGFR ligand genes in a quantita-
`tive manner by real -time PCR using specimens from patients with
`normal ovaries or ovarian cancer. Expression indices of HB -EGF,
`TGF -a, and amphiregulin in patients with normal ovaries or ovarian
`cancer are shown in Fig. IA. The expression level of epiregulin was
`similar to that of TGF -a.5 Large differences between the expression of
`HB -EGF and the other three EGFR ligands were observed in the
`tissue specimens examined. In addition to gene expression, we also
`determined the protein levels of HB -EGF, TGF -a, and amphiregulin
`in ascites fluids (Fig. IB). The amount of epiregulin was not deter-
`mined because appropriate antibodies for enzyme- linked immunosor-
`bent assay were not available. Consistent with the PCR data, the
`amount of HB -EGF in the peritoneal fluid of patients with normal
`ovaries or ovarian cancer was much higher than the amount of TGF -a
`and amphiregulin. Furthermore, and more importantly, HB -EGF gene
`expression levels in tissue specimens and protein levels in ascitic fluid
`from patients with ovarian cancer increased significantly from the
`levels observed in normal and cystic ovary tissues, although such
`enhanced expression was not observed for other EGFR ligands. These
`
`5Y. Tanaka, S. Miyamoto, S. O. Suzuki, E. Oki, H. Yagi, K. Sonoda, A. Yamazaki,
`H. Mizushima, E. Mekada, and H. Nakano. Clinical significance of heparin- binding
`EGF -like growth factor and ADAM 17 expression in human ovarian cancer, manuscript
`in preparation.
`
`results indicated that HB -EGF may play a role in human ovarian
`cancer.
`HB -EGF Is Essential for Tumor Formation of Ovarian Cancer
`Cells. As shown above, HB -EGF was the only EGFR ligand with
`particularly enhanced RNA and protein levels in ovarian cancer. To
`examine whether HB -EGF contributes to tumor formation in human
`ovarian cancer, we studied the relationship between HB -EGF expres-
`sion levels and tumor- forming ability of ovarian cancer cell lines in
`nude mice. SKOV3 and RMG -1 are cell lines derived from human
`epithelial ovarian carcinomas. RT -PCR revealed that HB -EGF is the
`primary EGFR ligand expressed in these cells, although expression of
`TGF -a, amphiregulin, and epiregulin was also detected (Fig. 2, A and
`B). A DT binding assay confirmed the presence of pro -HB -EGF on
`the surface of SKOV3 and RMG -1 cells and indicated that the amount
`of pro -HB -EGF on the surface of RMG -1 cells was about 2.5 -fold
`higher than that on the surface of SKOV3 cells (Fig. 2, C and D).
`injected subcutaneously
`When SKOV3 and RMG -1 cells were
`(5 X 106 cells /mouse) into nude mice, both cells formed tumors (Fig.
`3, A and B). Consistent with HB -EGF expression levels, RMG -1 cells
`formed tumors more rapidly than SKOV3 cells.
`To gain evidence of the involvement of HB -EGF in tumor forma-
`tion, ovarian cancer cells ectopically expressing pro -HB -EGF were
`isolated. SK -HB cells were obtained by transfecting SKOV3 cells
`with wild -type pro -HB -EGF. SK- HB -1 -3, stable clones of SK -HB
`cells, expressed pro -HB -EGF on the cell surface at levels approxi-
`mately 7 -fold higher than that of the parental SKOV3 cells (Fig. 2C).
`5722
`
`Downloaded from cancerres.aacrjournals.org on July 18, 2019. © 2004 American Association for Cancer
`Research.
`
`

`

`HB -EGF IS A TARGET FOR OVARIAN CANCER THERAPY
`
`s
`
`0 G Q- Q G G
`P 4 4> 4
`
`z s
`
`S I T
`
`A
`
`1353
`1078
`872
`603-
`310
`281
`
`C
`
`á3Q -
`á -
`x20_
`73
`
`m 10-
`t- o
`
``^
`
`o
`
`ß Z
`
`^ n
`4J CO
`0 0
`
`1Z, m mQí
`,kt
`
`ti
`g 1'
`0 0 0
`
`;v0,
`<
`Q
`
`o k k
`
`I,
`
`r HB -EGF
`G3PDH
`
`Fig. 2. Expression of HB -EGF in SKOV3, RMG -I, and transfectant cells and inhibi-
`tion by siRNA. A and B, expression of EGF family ligands in SKOV3 (A) and RMG -1 (B)
`cells was assessed by RT -PCR. The positions of size markers (bp) arc shown in Lanes M.
`C, quantitation of cell surface pro -HB -EGF expressed in SKOV3, SK -HB, and SK -MHB
`cells as measured by the binding of l25í -DT. The values of specific binding represent the
`average i- SD of three independent experiments. D, quantitation of cell surface pro -HB-
`EGF expressed in SKOV3, RMG -1, and HB -EGF siRNA vector -expressing cells as
`measured by the binding of l25í -DT. SKI81 -1, SK181 -2, and SK181 -3 cells, transfectants
`derived from SKOV3 cells, or 8181 -1, 8181 -2, and R181-3 cells, transfectants derived
`from RMG -1 cells, express HB -EGF siRNA. The values of specific binding represent the
`average ± SD of three independent experiments. E, semiquantitative RT -PCR analysis for
`pro -HB -EGF and GAPDH expression from transcripts derived from SKOV3 cells,
`RMG -1 cells, and cells expressing HB -EGF siRNA vector.
`
`weeks after injection, and tumors were slow to develop after this point
`(Fig. 3B). R181 -3, a clone expressing higher levels of HB -EGF than
`the other R181 clones, formed smaller tumors than the parental
`RMG -1 cells over a similar time scale. The small tumor formation of
`R181 -3 cells may be due to the partial reduction of pro -HB -EGF
`expression in R181-3 cells, but we cannot exclude the possibility that
`the introduced siRNA construct was lost from the R181 -3 cells under
`nonselective conditions, and therefore the cells re- formed tumors.
`Expression of empty vector containing only the H1 promoter (26) or
`vector containing an irrelevant DNA fragment did not affect the
`tumorigenicity of either SKOV3 or RMG -1 cells (data not shown).
`These results indicate that expression levels of pro -HB -EGF are
`critical for tumor formation of ovarian cancer cells.
`Suppression of Tumor Growth by Exogenously Administered
`CRM197. To further examine the tumorigenic activity of sHB -EGF,
`we studied the effect of CRM197 on tumor growth. CRM197, a
`nontoxic mutant protein of DT, is a specific inhibitor of sHB -EGF
`(34). One week after subcutaneous injection of either SKOV3 or
`RMG -1 cells, mice were given CRM197 (1 mg/week) every week by
`intraperitoneal injection. Tumor formation was completely suppressed
`by CRM197 treatment (Fig. 4, A and B). Similar results were also
`observed with OVMG1, another ovarian cancer cell line (Ref. 35; Fig.
`40. Furthermore, CRM197 also completely suppressed tumor forma-
`tion from SK -HB -1 (Fig. 4D) and R -HB -1 cells (data not shown),
`even though these cells expressed high levels of surface pro -HB -EGF.
`These results confirm that HB -EGF is required for tumor formation of
`ovarian cancer cell lines in vivo. In comparison, Taxol, a widely used
`chemotherapeutic agent for ovarian cancer, was used for nude mice
`with SKOV3 or SK -HB -1 cell tumors. Taxol inhibited tumor forma-
`tion of SKOV3 cells to a degree similar to that of CRM197 but only
`weakly inhibited tumor formation by SK -HB -1 cells (Fig. 4, E and F).
`Ectodomain Shedding of Pro -HB -EGF Is Essential for Tumor
`Formation. A previous study indicated that ectodomain shedding of
`pro -HB -EGF is critical for growth factor activity (12). To examine the
`
`A
`r""
`E 25
`E
`A 20
`
`15-
`
`a-SKOV3
`0-oSK181-1
`-+SK181-2
`o--uSK181-3
`
`a--nRt
`cR181-1
`o
`__ R181-2
`o-QR181-3
`
`0
`
`1
`
`2
`
`3 4
`
`5 6 7 8 910
`(Weeks)
`
`C)
`
`E
`E 251
`o c) 20-
`15
`
`a
`E 10
`ó >
`ó
`E o
`
`o--o SK-HB-1
`.--- SK-HB-2
`4--o SK-HB-3
`
`10
`(Weeks)
`
`All SK -HB cell clones formed larger tumors in nude mice than the
`parental SKOV3 cells. Mice that received injection with SK -HB cells
`died within 6 weeks of subcutaneous injection (Fig. 3C). Similar
`results, i.e., enhanced tumorigenicity, were also observed in R -HB
`cells obtained by transfecting RMG -1 cells with wild -type pro -HB-
`EGF (data not shown).
`To confirm the requirement for pro -HB -EGF in tumor formation of
`ovarian cancer cells, pro -HB -EGF expression was suppressed by
`vector -encoded siRNA. A plasmid coexpressing the pro -HB -EGF
`siRNA and a puromycin resistance gene was transfected into either
`SKOV3 or RMG -1 cells. After selection in puromycin- containing
`media, we isolated the surviving colonies. The specific knockdown of
`pro -HB -EGF expression
`isolated clones (referred
`the
`in
`to as
`SK181 -1, SKI81 -2, and SK181 -3 for SKOV3 transfectants and
`R181-1, R181-2, and R181-3 for RMG -1 transfectants) was con-
`firmed by RT -PCR (Fig. 2E). DT binding also revealed reduced levels
`of pro -HB -EGF on the cell surface in these siRNA- expressing cells,
`although the reductions observed were minimal in clone R181 -3 (Fig.
`2D). SKOV3, RMG -1, and the respective transfectants were injected
`subcutaneously (5 x 106 cells /mouse) into nude mice. Whereas
`Fig. 3. Tumor formation of ovarian cancer cells
`in nude mice. SKOV3 cells and
`SKOV3 cells rapidly formed tumors in nude mice, the pro -HB -EGF
`HB -EGF- targeting siRNA- expressing SK -181 cells (A), RMG -1 and HB- EGF -targeting
`knockdown cell clones, SK181 -1, SK181 -2, and SK181 -3, did not
`siRNA- expressing 8181 cells (B), SK -HB cells (C), and SK -MHB and SK -SHB cells (D)
`form tumors until 10 weeks after subcutaneous injection (Fig. 3A).
`were injected subcutaneously into nude mice. Every week, beginning 1 week after
`injection of cells, tumor size at the injection sites was measured. Tumor volume was then
`Similarly, whereas RMG -1 cells developed into tumors more rapidly
`calculated as described in "Materials and Methods." Each tumor volume represents the
`than SKOV3 cells, R181 -1 and R181 -2 did not form tumors until 6
`mean ± SD (n = 10).
`5723
`
`o- oSK-SHB-1
`SK-SHB-2
`n 0SK-SHB-3
`
`o---0SK-MHB-1
`
`-- SK-M H$-2
`
`a- -aSK-MHB-3
`
`0
`
`5 6 7 8 910
`(Weeks)
`
`Downloaded from cancerres.aacrjournals.org on July 18, 2019. © 2004 American Association for Cancer
`Research.
`
`

`

`SKOV3
`
`o-o CR1.1197(-)
`4,---* CRPd197(+)
`
`&^o
`
`A
`
`E
`
`oc 20
`
`-t<-15
`
`lì
`
`10-
`
`5
`
`0
`
`0
`
`1
`
`2 3 4
`
`5
`
`9 10
`7 8
`(Weeks)
`
`E
`E
`c 20
`xis
`
`10
`
`o
`
`E o
`z
`ü
`
`OVMG1
`
`o-o CRPr1197(-)
`--- CRM197(+)
`
`7 8 910
`(Weeks)
`
`r
`
`o
`
`2
`
`3 4
`
`5 6
`
`25
`
`E
`a
`;220
`X
`
`15
`
`10-
`
`5._
`
`E
`
`ó >
`L
`0
`E
`
`E
`É 2',
`p20 ?
`
`-
`W15
`'
`o
`o
`-6
`
`5-
`
`1IB -EGF IS A TARGET FOR OVARIAN CANCER THERAPY
`
`RMG-1
`
`CRh1197(-)
`-+CRt.1197(+)
`
`o
`
`1
`
`2
`
`4
`
`5 6 7 8 910
`(Weeks)
`
`SK-HB-1
`
`25
`ó 20._
`
`K
`
`15
`
`E
`
`210 ó >
`
`P
`
`F-
`
`a
`
`0
`
`F
`
`25-
`g 2°_
`15-
`
`co
`
`g 10-
`
`}
`.- 5-
`É
`}3 0
`
`o--oCRh1197(-)
`
`.-. C Rra197(+)
`
`1
`
`2 3
`
`4 5 6 7:
`10
`(Weeks)
`
`SK-HB-1
`
`4 4
`
`a-o Taxo1(-)
`--Taxol(+)
`4 5 6 7 8 Ó
`
`(Weeks)
`
`ovarian cancer cells. In ovarian cancer patients, LPA levels are
`markedly elevated in plasma and ascites (22). In addition, using
`different cell lines, we and others have shown that LPA induces
`ectodomain shedding of pro -HB -EGF (14, 15, 36). Thus, we next
`focused on the contribution of LPA to the ectodomain shedding of
`pro -HB -EGF in ovarian cancer cells.
`We first confirmed whether exogenously added LPA actually in-
`duces pro -HB -EGF ectodomain shedding in ovarian cancer cells.
`SKOV3, RMG -1, and OVMG1 cells were treated with saturated or
`unsaturated LPA, and pro -HB -EGF ectodomain shedding was deter-
`mined. Ectodomain shedding was quantitated by measuring the
`amount of pro -HB -EGF remaining on the cell surface using the DT
`binding assay (8). Addition of LPA with unsaturated fatty acids
`(18:1), but not LPA with saturated fatty acids (18:0), to these ovarian
`cancer cells induced ectodomain shedding of pro -HB -EGF (Supple-
`mentary Fig. 1). The metalloprotease inhibitor GM6001, which inhib-
`its ectodomain shedding of EGFR ligands, blocked LPA- induced
`decreases in pro -HB -EGF surface levels, confirming that the reduc-
`tion resulted from ectodomain shedding.
`LPA- induced pro -HB -EGF ectodomain shedding resulted in trans -
`activation of EGFR and the downstream kinase extracellular signal -
`regulated kinase (ERK) /MAPK. As shown in Fig. 5, A and B, addition
`of LPA 18:1 (unless otherwise specified, LPA 18:1 was used in all of
`the following experiments) enhanced EGFR and ERK/MAPK activa-
`tion, and GM6001 blocked LPA- induced EGFR and ERK/MAPK
`activation. In contrast, the activation of EGFR and ERK/MAPK by
`exogenously added sHB -EGF was not inhibited by GM6001 treat-
`ment. By preventing the binding of EGFR ligands to the EGFR
`extracellular domain, an anti -EGFR antibody, ICR -3R, also blocked
`LPA- induced activation of EGFR and ERK/MAPK. These results
`confirm that LPA- induced activation of EGFR and ERK/MAPK in
`SKOV3 and RMG -1 cells occurred via a ligand- dependent mecha-
`nism. SKOV3 and RMG -1 cells express other EGFR ligands includ-
`ing TGF -a, amphiregulin, and epiregulin at levels lower than that of
`HB -EGF (Fig. 2, A and B). However, inhibition of HB -EGF protein
`by CRM197 or HB -EGF gene expression by siRNA prevented LPA -
`induced transactivation of EGFR and ERK/MAPK (Fig. 5, C and D).
`requirement for pro -HB -EGF ectodomain shedding for tumor forma-
`These results indicate that HB -EGF is the primary EGFR ligand
`contributing to LPA- induced transactivation of EGFR and ERK/
`tion, we prepared SKOV3 cells ectopically expressing mutant forms
`MAPK in ovarian cancer cells.
`of pro -HB -EGF. SK -MHB and SK -SHB cells were obtained by trans -
`Self -Production of LPA in Ovarian Cancer Cells Results in
`fecting SKOV3 cells with an uncleavable pro -HB -EGF mutant (uc)
`Constitutive HB -EGF Shedding and EGFR Activation. LPA is
`and an HB -EGF form with its transmembrane domain deleted (ATM).
`constitutively produced in ovarian cancer cells, including SKOV3 and
`The uc form is resistant to ectodomain shedding resulting from
`RMG -1 (22, 37). This constitutive production of LPA potentially
`induction by various shedding- inducing stimuli, whereas the ATM
`contributes to autonomous induction of pro -HB -EGF shedding. The
`secretes sHB -EGF in the absence of shedding stimuli (12). SK -MHB
`cell clones expressed the uc form of pro -HB -EGF mutants on the cell
`DT binding assay revealed that incubation of SKOV3 cells with
`GM6001 or suramin,