`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`0022-3565/05/3123-1020 –1026$20.00
`THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
`Copyright © 2005 by The American Society for Pharmacology and Experimental Therapeutics
`JPET 312:1020–1026, 2005
`
`Vol. 312, No. 3
`78113/1191589
`Printed in U.S.A.
`
`Immunogenicity and Rapid Blood Clearance of Liposomes
`Containing Polyethylene Glycol-Lipid Conjugates and
`Nucleic Acid
`
`Sean C. Semple, Troy O. Harasym,1 Kathy A. Clow,2 Steven M. Ansell, Sandra K. Klimuk,
`and Michael J. Hope
`Inex Pharmaceuticals Corporation, Burnaby, British Columbia, Canada
`Received September 21, 2004; accepted October 29, 2004
`
`ABSTRACT
`Polyethylene glycol (PEG) is used widely in the pharmaceutical
`industry to improve the pharmacokinetics and reduce the immu-
`nogenicity of therapeutic and diagnostic agents. The incorpora-
`tion of lipid-conjugated PEG into liposomal drug delivery systems
`greatly enhances the circulation times of liposomes by providing a
`protective, steric barrier against interactions with plasma proteins
`and cells. Here we report that liposome compositions containing
`PEG-lipid derivatives and encapsulated antisense oligode-
`oxynucleotide (ODN) or plasmid DNA elicit a strong immune re-
`sponse that results in the rapid blood clearance of subsequent
`doses in mice. The magnitude of this response is sufficient to
`induce significant morbidity and, in some instances, mortality. This
`
`effect has been observed in several strains of mice and was
`independent of sequence motifs, such as immunostimulatory
`CpG motifs. The ODN-to-lipid ratio and ODN dose was also
`determined to be important, with abrogation of the response
`occurring at a ratio between 0.04 and 0.08 (w/w). Rapid elimina-
`tion of liposome-encapsulated ODN from blood depends on the
`presence of PEG-lipid in the membrane because the use of non-
`pegylated liposomes or liposomes containing rapidly exchange-
`able PEG-lipid also abrogated the response. These studies have
`important implications for the evaluation and therapeutic use of
`liposomal formulations of nucleic acid, as well as the potential
`development of liposomal vaccines.
`
`DNA- and RNA-based therapeutics have tremendous po-
`tential for exquisite selectivity in the management of disease,
`yet these agents have several properties that restrict their
`application as therapeutic agents, including nuclease sensi-
`tivity, rapid plasma elimination, poor intracellular delivery,
`and hemodynamic toxicities (Levin, 1999; Wang et al., 2003).
`This has prompted significant research into the development
`of delivery technologies for this class of drugs. Long-circulat-
`ing, sterically stabilized liposomes (SSL) containing amphi-
`pathic polyethylene glycol (PEG) have been used extensively
`over the past decade to improve the circulation lifetime of
`lipid vesicles and entrapped therapeutic agents, provide a
`
`1 Current address: Celator Technologies Inc., Vancouver, BC, Canada.
`2 Current address: Memorial University of Newfoundland, St John’s, NF,
`Canada.
`Article, publication date, and citation information can be found at
`http://jpet.aspetjournals.org.
`doi:10.1124/jpet.104.078113.
`
`steric barrier against interactions with plasma proteins and
`opsonins, improve disease-site delivery of therapeutic and
`diagnostic agents, and reduce liposome uptake by mononu-
`clear cells of the reticuloendothelial system (Allen and Han-
`sen, 1991; Senior et al., 1991; Boerman et al., 1997; Lasic et
`al., 1999). In this regard, SSL have been used in oncology
`(Goren and Gabizon, 1998; Lasic et al., 1999), antimicrobial
`(Bakker-Woudenberg and van Etten, 1998), and radiodiag-
`nostic applications (Boerman et al., 1997; Goins et al., 1998).
`As such, this type of delivery system is a natural candidate to
`enhance the pharmacokinetic and pharmacodynamic proper-
`ties of DNA- and RNA-based therapeutics (Lasic et al., 1999).
`In the absence of encapsulated or surface-coupled proteins,
`SSL and other nonviral lipid delivery systems are generally
`considered to be nonimmunogenic (van Rooijen and van
`Nieuwmegen, 1980; Alving, 1992; Harding et al., 1997). The
`immunogenicity and rapid plasma elimination of protein-
`
`ABBREVIATIONS: SSL, sterically stabilized liposomes; PEG, polyethylene glycol; ODN, oligodeoxynucleotide(s); SCID, severe-combined
`immunodeficient; DSPC, distearoylphosphatidylcholine; DSPE, distearoylphosphatidylethanolamine; DODAP, 1,2-dioleoyl-3-N,N-dimethyl-
`ammonium-propane; CH, cholesterol; biotin X-DSPE, N-[((6-biotinoyl)amino)hexanoyl]-1,2-distearoyl-sn-glycero-3-phosphoethanolamine;
`biotin-PEG2000-DSPE, N-[-biotinoylamino (polyethylene glycol)2000]-1,2-distearoyl-sn-glycero-3-phosphoethanolamine; PEG-CerC14, 1-O-
`(2⬘-(-methoxypolyethyleneglycol)succinoyl)-2-N-myristoylsphingosine; PEG-CerC20, 1-O-[2⬘-(-methoxypolyethyleneglycol)succinoyl]-2-
`N-arachidoylsphingosine; CHE, cholesteryl hexadecyl ether; ICAM, intercellular adhesion molecule; PO, phosphodiester; PS, phosphoro-
`thioate; SALP, stabilized antisense-lipid particle(s); ELISA, enzyme-linked immunosorbent assay; PK, pharmacokinetic(s).
`
`1020
`
`PROTIVA - EXHIBIT 2033
`Moderna Therapeutics, Inc. v. Protiva Biotherapeautics, Inc. - IPR2018-00739
`
`
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`Rapid Blood Clearance of Pegylated Liposomes Containing DNA
`
`1021
`
`coupled liposomal systems after repeat injections have been
`well documented (Aragnol and Leserman, 1986; Phillips and
`Emili, 1991; Phillips and Dahman, 1995; Harding et al.,
`1997; Tardi et al., 1997) and typically result from antibody-
`mediated recognition of protein. T cell-independent antibody
`responses to liposomal glycolipid antigens such as ganglio-
`side GM1 have also been described (Freimer et al., 1993).
`These responses were characterized by elevations in anti-
`body production primarily of the IgM class, with antibody
`recognition directed against the carbohydrate portion of the
`ganglioside.
`Nonmethylated bacterial DNA and synthetic oligode-
`oxynucleotides (ODN) can stimulate mononuclear cells and
`lymphocytes in vitro and in vivo, resulting in the secretion of
`interleukin-6, interleukin-12, interferon-␥, and IgM (Krieg,
`2002). This effect has been primarily attributed to CpG and
`palindromic sequence motifs, but phosphorothioate ODN all
`exhibit some degree of immune stimulation in vivo (Monteith
`et al., 1997). Given the relative inefficiency of nucleic acid-
`based therapeutics and the likely requirement for frequent
`administration, we evaluated the potential immunogenicity
`and circulation properties of SSL containing synthetic ODN,
`plasmid DNA, or ribozyme on repeated injections. Liposome
`elimination from the circulation was used as a convenient
`indicator of immunogenicity in vivo. The results presented in
`this study indicate that the presence of encapsulated nucleic
`acid in lipid vesicles containing surface-associated PEG stim-
`ulates an immune response against the carrier, irrespective
`of sequence motifs or DNA chemistry, and induces morbidity
`and rapid plasma elimination of subsequent administrations.
`The data further demonstrate that this response is directed
`specifically against the PEG-lipid.
`
`Materials and Methods
`Mice. Female 7- to 8-week-old ICR, C57BL/6, and BALB/c mice
`were obtained from Harlan (Indianapolis, IN). BALB/c nu/nu and
`BALB/c SCID-Rag2 mice were obtained from The Jackson Labora-
`tory (Bar Harbor, ME) and maintained under pathogen-free condi-
`tions. All animals were quarantined for at least 1 week prior to use.
`All procedures involving animals were performed in accordance with
`the guidelines established by the Canadian Council on Animal Care.
`Chemicals and Lipids. Distearoylphosphatidylcholine (DSPC),
`polyethylene glycol-conjugated distearoylphosphatidylethanolamine
`(PEG2000-DSPE) and 1,2-dioleoyl-3-N,N-dimethylammoniumpropane
`(DODAP) were purchased from Avanti Polar Lipids (Alabaster, AL).
`Cholesterol (CH) was purchased from Sigma-Aldrich (St. Louis, MO).
`Biotin-X-DSPE and biotin-PEG2000-DSPE were purchased from North-
`ern Lipids (Vancouver, BC, Canada). PEG-CerC14 and PEG-CerC20
`were synthesized and purified as described previously (Wheeler et al.,
`1999). [3H]Cholesteryl hexadecyl ether (CHE) was obtained from
`PerkinElmer Life and Analytical Sciences (Boston, MA).
`ODN and Plasmid DNA. The designations and 5⬘ to 3⬘ sequences of
`the ODN used in these studies were as follows: hICAM, GCCCAAGCT-
`GGCATCCGTCA (3⬘-untranslated region of human ICAM-1 mRNA);
`mICAM, TGCATCCCCCAGGCCACCAT (3⬘-untranslated region of
`murine ICAM-1 mRNA); EGFR, CCGTGGTCATGCTCC (human epi-
`dermal growth factor mRNA, receptor-translation termination codon
`region); c-myc, TAACGTTGAGGGGCAT (initiation codon region of hu-
`man/mouse c-myc proto-oncogene mRNA; and c-mycC, TAAGCAT-
`ACGGGGTGT (c-myc scrambled control). Phosphodiester (PO) and
`phosphorothioate (PS) ODN were purchased from Hybridon Specialty
`Products (Milford, MA). The backbone composition was confirmed by
`31P NMR. All ODN were analyzed for endotoxin by the manufacturer
`and contained less than 0.05 endotoxin units/mg. Plasmid DNA (pCM-
`
`VLuc) was produced in Escherichia coli, isolated, and purified as de-
`scribed previously (Wheeler et al., 1999).
`Encapsulation of ODN. Stabilized antisense-lipid particles
`(SALP) composed of DSPC/CH/DODAP/PEG-CerC14 or PEG-CerC20
`(molar ratio, 25:45:20:10) and encapsulated PS ODN were prepared
`as described previously (Semple et al., 2000). For PS ODN, 300 mM
`citrate buffer was used to dissolve the antisense, whereas 20 mM
`citrate, pH 4.0 was used for PO ODN and plasmid formulations. The
`lower citrate concentration was required to facilitate efficient charge
`interactions between DODAP and the PO ODN or plasmid, resulting
`in optimal encapsulation efficiencies (Stuart et al., 2004). At higher
`citrate concentrations, these charge interactions are presumably
`shielded, and significant reductions in encapsulation efficiencies are
`observed. Phosphorothioate-modified ODN bind strongly to cationic
`molecules, and encapsulation efficiencies are much less sensitive to
`differences in buffer and salt concentrations (Stuart et al., 2004).
`Plasmid formulations were not extruded, resulting in ⬃200-nm par-
`ticles. DSPC/CH (molar ratio, 55:45) and DSPC/CH/PEG2000-DSPE
`(molar ratio, 50:45:5) vesicles were prepared from dry lipid films by
`aqueous hydration in HBS (20 mM Hepes and 145 mM NaCl, pH
`7.4). Similarly, ODN encapsulation was achieved by hydration of 100
`mg of lipid with 100 mg of ODN in 1.0 ml HBS, followed by five cycles
`of freeze-thawing and extrusion through two stacked 100-nm filters
`(Semple et al., 2000). The resulting particles were approximately 110
`to 140 nm in diameter, as judged by quasi-elastic light scattering
`using a model 370 NICOMP submicron particle sizer (Particle Sizing
`Systems, Santa Barbara, CA). [3H]CHE, a nonexchangeable, nonme-
`tabolizable lipid marker, was incorporated into all vesicle composi-
`tions to monitor lipid levels in the blood (Stein et al., 1980).
`Liposome Elimination from the Circulation. Mice received a
`single intravenous (lateral tail vein) dose of empty liposomes (50
`mg/kg lipid) or liposome-encapsulated ODN (50 mg/kg lipid and 10
`mg/kg ODN, unless otherwise specified) containing [3H]CHE (⬃1
`Ci/mouse). Dosing occurred weekly unless otherwise noted. Blood
`(25 l) was collected 1 h postinjection by tail nicking unanesthetized
`mice, using a sterile scalpel (tails were wiped with 70% ethanol prior
`to nicking), and placed in 200 l of 5% EDTA. The blood was then
`digested (SOLVABLE, PerkinElmer Life and Analytical Sciences),
`decolorized and analyzed for radioactivity according to the manufac-
`turer’s instructions. The tail nicking procedure allowed all repeat-
`injection data to be collected from the same group of animals. A
`comparison of this procedure with blood (⬃0.5 ml) collected weekly
`by terminal cardiac puncture on anesthetized (ketamine/xylazine)
`mice produced equivalent results.
`ELISA. Groups of mice (n ⫽ 20 initially) were injected weekly
`(i.v.) with SALP (PEG-CerC20) containing c-myc ODN or empty lipo-
`somes of the same lipid composition. One week after each injection,
`a subgroup of animals (n ⫽ 5) was anesthetized (ketamine/xylazine),
`blood was collected from each animal by cardiac puncture (⬃0.5 ml),
`and the animals were subsequently euthanized. Plasma was col-
`lected for each animal after centrifuging the blood for 15 min at
`1200g in a refrigerated centrifuge (4°C). Individual plasma samples
`were pooled (n ⫽ 5), and serial dilutions were analyzed by ELISA as
`described below. The results are expressed for the 1:800 plasma
`dilution, which was the lowest dilution that exhibited minimal non-
`specific binding to control wells.
`The presence of liposome-reactive antibody was evaluated by
`ELISA using biotinylated liposomes bound to streptavidin-coated
`microplates. Liposome formulations bound to microtiter plates in-
`cluded: DSPC/CH/DODAP/PEG-CerC20/biotin-PEG2000-DSPE (mo-
`lar ratio, 24.5:45:25:5:0.5), DSPC/CH/biotin-X-DSPE (molar ratio,
`54.5:45:0.5), and DSPC/CH/PEG2000-DSPE/biotin-PEG2000-DSPE
`(molar ratio, 49.5:45:5:0.5). Biotinylated liposomes (10 nmol of total
`lipid/well) were incubated overnight at 4°C in clear SILENUS
`streptavidin-coated microwell plates (Chemicon International, Te-
`mecula, CA). Plates were washed, blocked with phosphate-buffered
`saline containing 3% bovine serum albumin and 0.1% Tween 20, and
`subsequently incubated with serial dilutions of plasma from PEG-
`
`
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`Fig. 1. Circulation levels of PEG liposomes on repeat administrations in
`immune-competent BALB/c mice (a), and immune-compromised BALB/c
`nude (b) and BALB/c SCID-Rag2 mice (c). Mice were injected i.v. with
`empty DSPC/CH/PEG2000-DSPE liposomes, DSPC/CH/PEG2000-DSPE li-
`posomes containing hICAM PS ODN, empty SALP (PEG-CerC20), or
`SALP (PEG-CerC20) containing hICAM ODN. Lipid doses were 50 mg/kg.
`The ODN/lipid ratios for the DSPC/CH/PEG2000-DSPE and SALP (PEG-
`CerC20) were 0.058 and 0.20, respectively. Injections were administered
`weekly, and the circulation levels at 1 h postinjection were monitored by
`the lipid label [3H]CHE. The bars represent the first (open bars), second
`(back slash), third (forward slash), and fourth (cross-hatched) injection.
`All bars represent the mean and standard deviation of eight mice.
`
`immunostimulatory and/or nonantisense effects (Stein and
`Krieg, 1997), the influence of oligonucleotide sequence was
`evaluated by encapsulating a variety of PS ODN in SALP
`(PEG-CerC20). Interestingly, all PS ODN encapsulated in
`SALP (PEG-CerC20) induced morbidity in mice and were
`rapidly removed from the circulation on repeat administra-
`tions (Fig. 2a). This was also observed for ODN that did not
`contain CpG or G-quartet motifs (mICAM) or contained CpG
`only (hICAM and EGFR), CpG and G-quartet (c-myc), or
`G-quartet only (c-mycC).
`Having demonstrated sequence independence of the rapid
`elimination phenomenon, the dependence on nucleic acid
`chemistry and structure was evaluated. PS or PO ODN,
`ribozyme, or plasmid DNA was encapsulated in the SALP
`(PEG-CerC20) lipid formulation, and the circulation levels at
`
`1022
`
`Semple et al.
`
`liposome (containing entrapped ODN)-treated animals fo r 1 h at
`room temperature. Following multiple washes with phosphate-buff-
`ered saline/0.1% Tween 20, IgM binding was evaluated by incubation
`with horseradish peroxidase-conjugated rat anti-mouse IgM mono-
`clonal antibody (1:1000 dilution; BD Biosciences PharMingen, San
`Diego, CA). The plates were washed and subsequently incubated
`with 3,3⬘,5,5⬘-tetramethylbenzidine substrate (Sigma-Aldrich) and
`read at 450 nm.
`
`Results
`Blood Levels of PEG Liposomes Containing Encap-
`sulated ODN. We have recently developed and character-
`ized a novel lipid formulation that can encapsulate antisense
`ODN in the aqueous space of lipid vesicles with high encap-
`sulation efficiency and ODN-to-lipid ratios (Semple et al.,
`2000). This formulation contains a PEG-ceramide lipid coat-
`ing that is required for the formulation step, and we have
`therefore called these vesicles SALP. Previous studies have
`shown that liposomes containing PEG covalently coupled to
`ceramide derivatives with 20 carbon acyl chains, a relatively
`nonexchangeable lipid anchor, have circulation profiles in-
`distinguishable from the same liposome compositions con-
`taining PEG2000-DSPE, the most commonly used PEG-lipid
`anchor (Harding et al., 1997; Woodle, 1998; Semple et al.,
`2000). Typically, these formulations are long-circulating,
`with 75 to 95% and 30 to 40% of the administered dose
`expected to remain in the circulation at 1 and 24 h, respec-
`tively. Thus, we initially compared the repeat dosing phar-
`macokinetics (PK) of SALP to various lipid formulations of
`antisense ODN, including traditional long-circulating, SSL,
`and DSPC/CH liposomes.
`For liposomes and lipid-based delivery systems, monitor-
`ing the circulation properties of repeated injections is a con-
`venient surrogate measure of carrier immunogenicity since
`this parameter is invariably altered by an immune response
`(Aragnol and Leserman, 1986; Phillips and Emili, 1991;
`Harding et al., 1997; Tardi et al., 1997; Goins et al., 1998). To
`evaluate the impact of repeated administrations on the cir-
`culation times of PEG liposomes containing hICAM ODN,
`the blood levels of DSPC/CH/PEG2000-DSPE liposomes or
`SALP (PEG-CerC20) were evaluated 1 h postinjection after
`weekly intravenous administrations. As expected, no differ-
`ences in elimination were observed for empty vesicles over
`several administrations (Fig. 1a). Surprisingly, rapid elimina-
`tion (⬍20% of the injected dose remained in the blood at 1 h) of
`ODN-containing vesicles was observed following the second and
`subsequent injections. This effect was accompanied by pro-
`nounced morbidity and, in some instances, resulted in death of
`the animal within 30 min postinjection. This rapid elimination
`phenomenon with PEG liposomes and ODN was observed in
`several strains of mice, including outbred ICR mice and inbred
`BALB/c and C57BL/6 strains (results not shown). To determine
`whether an immune component was involved in this response,
`these same studies were performed in T cell-deficient BALB/c
`nude mice and B and T cell-deficient BALB/c SCID-Rag2 mice.
`A rapid elimination response was observed in BALB/c nude
`mice (Fig. 1b) but not in BALB/c SCID-Rag2 mice (Fig. 1c),
`suggesting that the response depends on the presence of B cells
`and immunoglobulin.
`Influence of Nucleic Acid Composition on Clearance
`of PEG Liposomes. Since it has been shown that PS ODN
`containing CpG or G-quartet sequence motifs can exhibit
`
`
`
`Rapid Blood Clearance of Pegylated Liposomes Containing DNA
`
`1023
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`Fig. 2. Influence of nucleic acid sequence (a) and structure (b) on blood
`clearance of SALP (PEG-CerC20). ICR mice were injected i.v. with SALP
`(PEG-CerC20) containing PS ODN of various nucleotide sequences (a). PO
`hICAM ODN and bacterial plasmid DNA were also evaluated (b). The
`lipid dose was adjusted to 50 mg/kg, and the ODN/lipid ratio for each
`formulation was ⬃0.20. Injections were administered weekly, and the
`circulation levels at 1 h postinjection were monitored by the lipid label
`[3H]CHE. The bars and numbers of animals are indicated in the legend to
`Fig. 1.
`
`1 h postinjection were monitored after weekly injections (Fig.
`2b). Rapid elimination of the carrier was observed on the
`second and subsequent injections, indicating that closed cir-
`cular, double-stranded DNA was as effective at inducing the
`rapid elimination as ODN with free 5⬘ and 3⬘ ends. Similarly,
`the more nuclease-sensitive PO ODN also induced an immu-
`nogenic response, as did ribozyme (results not shown).
`Impact of Antisense/Lipid Ratio and Dose Schedules.
`In Fig. 1, the magnitude of blood clearance for DSPC/CH/
`PEG2000-DSPE vesicles containing encapsulated ODN was
`less pronounced than for SALP (PEG-CerC20). The major
`difference between these two formulations was the encapsu-
`lation procedure and the resulting ODN-to-lipid ratio. To test
`whether the amount of encapsulated ODN influences the
`generation of the immune response, ODN was encapsulated
`in SALP (PEG-CerC20) at different ODN/lipid ratios, and the
`circulating level of vesicles was monitored after weekly in-
`jections of 50 mg/kg lipid. Interestingly, at ODN/lipid ratios
`less than 0.04 (w/w), no apparent changes in elimination
`were observed, whereas marked decreases in circulation lev-
`els were observed at ratios greater than 0.08 (w/w) (Fig. 3a).
`Since the lipid dose was constant in these studies, the ODN-
`to-lipid ratio and/or the total ODN dose administered signif-
`icantly impact the initiation of this response.
`
`Fig. 3. Factors influencing the onset of rapid clearance of PEG liposomes
`containing nucleic acid. The influence of the DNA-to-lipid ratio (a) and
`dosing schedule (b) were evaluated in ICR mice. For the DNA-to-lipid
`ratio study, mice were injected weekly (i.v.) with SALP (PEG-CerC20)
`containing hICAM PS ODN at various ODN/lipid ratios. The bars and
`numbers of animals are indicated in the legend to Fig. 1. In the dose
`schedule study, mice were injected i.v. with SALP (PEG-CerC20) contain-
`ing hICAM PS ODN at various dosing schedules: daily (E), every 2 days
`(F), every 3 days (䡺), and weekly (f). In both studies, the lipid dose was
`adjusted to 50 mg/kg/dose, and circulation levels at 1 h postinjection were
`monitored by the lipid label [3H]CHE.
`
`Standard dosing schedules for antisense ODN therapies
`typically involve repeated injections or infusions. The rele-
`vance of the dosing schedule on circulating levels of SALP
`(PEG-CerC20) was examined by injecting mice daily or every
`2, 3, or 7 days. Liposome levels in the blood were evaluated
`1 h after each injection (Fig. 3b). For daily injections, the
`plasma levels of circulating carrier increased over the first
`three injections, which was not surprising given that 30 to
`40% of a given dose of PEG-coated liposomes remains in the
`circulation 24 h postinjection (Allen and Hansen, 1991; Har-
`ding et al., 1997; Woodle, 1998; Semple et al., 2000); however,
`this increase was followed by a dramatic decline in the cir-
`culation levels of subsequent doses. In all dosing schedules,
`rapid elimination of subsequent doses was observed begin-
`ning 4 to 6 days after the initial dose and was maintained for
`at least 50 days.
`PEG-Lipid Involvement in the Response. To evaluate
`the importance of PEG-lipid on the generation of the immune
`response observed in Fig. 1, PS ODN was encapsulated in
`100-nm DSPC/CH vesicles or in SALP containing PEG-
`CerC14. The CerC14 lipid anchor has shorter acyl chains than
`PEG-CerC20 and exchanges more rapidly out of the lipid
`bilayer (t1/2, ⬃1.1 h in vitro) (Wheeler et al., 1999). No dif-
`ferences in the circulation levels of these vesicles, whether
`empty or containing encapsulated ODN, were observed on
`repeated administrations (Fig. 4a). This was in striking con-
`trast to SALP (PEG-CerC20), which was rapidly eliminated
`
`
`
`1024
`
`Semple et al.
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`Fig. 4. Role of PEG-lipid in the rapid elimination of liposomes containing
`ODN. Panel a, mice injected i.v. with empty SALP (PEG-CerC20) (a),
`SALP (PEG-CerC20) (b), empty SALP (PEG-CerC14) (c), SALP (PEG-
`CerC14) (d), empty DSPC/CH liposomes (e), or DSPC/CH containing hI-
`CAM PS ODN [ODN-to-lipid ratio, 0.081, (w/w)] (f). The lipid dose was
`adjusted to 50 mg/kg/dose, and the circulation levels at 1 h postinjection
`were monitored by the lipid label [3H]CHE. The bars and numbers of
`animals are indicated in the legend to Fig. 1. Panel b, time course for
`exchange of PEG-CerC20 (F) and PEG-CerC14 (E) evaluated by monitor-
`ing the ratio of [3H]PEG-ceramide to [14C]CHE in the plasma of mice over
`24 h. The symbols represent the mean and standard deviation of six mice.
`
`after a second injection. PEG-CerC14 exchanged out of the
`carrier immediately after injection, with greater than 50%
`loss of PEG-lipid in approximately 3 min (Fig. 4b). This same
`level was not achieved for PEG-CerC20 until 24 h. Since
`neither empty DSPC/CH vesicles nor SALP containing rap-
`idly exchangeable PEG-lipid exhibited any differences in cir-
`culation levels on repeat administrations, we conclude that
`the presence of PEG-lipid in the external monolayer of the
`vesicles was critical for the rapid elimination of the carrier
`from the circulation.
`The role of PEG-lipid was further examined in crossover
`studies in which mice were sensitized with weekly injections
`(total of four) of SALP containing PEG-CerC20 and encapsu-
`lated ODN. This was followed with a fifth injection of empty
`vesicles of varying compositions. Crossover injections of
`empty DSPC/CH/PEG-CerC20 or DSPC/CH/PEG2000-DSPE
`vesicles were rapidly eliminated from the circulation,
`whereas crossover injections of DSPC/CH vesicles or SALP
`containing PEG-CerC14 exhibited prolonged circulation
`times (Fig. 5). The rapid clearance of DSPC/CH/PEG2000-
`DSPE vesicles from the circulation indicates that the PEG
`moiety, and not the lipid anchor, was the critical component
`recognized in this response. Similarly, the use of empty ves-
`icles that had never been exposed to ODN indicates that
`potential residual surface-associated ODN was not responsi-
`ble for mediating elimination. Similar results were observed
`in crossover studies in which, instead of SALP (PEG-CerC20),
`mice were pretreated with DSPC/CH/PEG2000-DSPE lipo-
`somes containing encapsulated ODN (results not shown).
`In a final set of studies designed to evaluate the presence of
`
`Fig. 5. Crossover studies in presensitized mice. Mice were injected i.v.
`with SALP (PEG-CerC20) for a total of four weekly injections. In a sub-
`sequent, final injection, mice received either SALP (PEG-CerC20), empty
`SALP (PEG-CerC20), empty SALP (PEG-CerC14), empty DSPC/CH/
`PEG2000-DSPE vesicles, or empty DSPC/CH liposomes. In each instance,
`the lipid dose was 50 mg/kg/dose, and the circulation levels at 1 h
`postinjection were monitored by the lipid label [3H]CHE. Each bar rep-
`resents the mean and standard deviation of eight mice.
`
`liposome-reactive antibody in the blood, mice were treated
`four times (weekly injections) with SALP (PEG-CerC20) or
`empty DSPC/CH/DODAP/PEG-CerC20 liposomes, and the
`pooled plasma of these animals was examined by ELISA
`using various biotinylated liposomes bound to streptavidin-
`coated microplates. When the pooled plasma from each group
`of mice was incubated with plates containing DSPC/CH/
`DODAP/PEG-CerC20 or DSPC/CH/PEG2000-DSPE, increases
`in liposome-reactive IgM were observed 1 week following the
`first injection and generally increased over the four injections
`(Fig. 6). However, when the same plasma was incubated in
`plates containing DSPC/CH (i.e., no PEG-lipid), very mini-
`mal IgM binding was observed, indicating the involvement of
`antibody in the clearance of PEG-liposomes containing ODN,
`as well as providing additional confirmation that the re-
`sponse is directed against PEG and not the other lipids
`comprising the formulation. The plasma from mice treated
`with empty PEG liposomes showed negligible reactivity in
`any of the plates.
`
`Discussion
`The majority of efficacy studies that use antisense oligo-
`nucleotides have required repeated dosing to observe biolog-
`ical activity in animal models. This is principally necessi-
`tated by the rapid plasma elimination of polyanionic DNA
`and minimal antisense ODN delivery to the disease site. To
`increase the disease site delivery of antisense ODN, we chose
`to evaluate pegylated lipid-based formulations of antisense
`ODN. Interestingly, we found that repeated injections of
`PEG liposomes containing ODN, plasmid DNA, or ribozyme
`induced a potent immunogenic response that resulted in both
`
`
`
`Rapid Blood Clearance of Pegylated Liposomes Containing DNA
`
`1025
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on October 26, 2018
`
`bound protein (Phillips and Emili, 1991; Phillips and
`Dahman, 1995; Harding et al., 1997; Tardi et al., 1997).
`Recently, a limited number of studies have demonstrated
`changes in the PK of repeated injections of PEG liposomes
`under certain time and dosing conditions in rats and a rhesus
`monkey (Dams et al., 2000; Laverman et al., 2001). Enhanced
`blood clearance of repeated doses of technetium-99m-PEG
`liposomes occurred when the second injection was adminis-
`tered between 5 days and 4 weeks after the initial injection
`(Goins et al., 1998; Oussoren and Storm, 1999; Dams et al.,
`2000). Moreover, PK changes were only observed when the
`doses were relatively low (⬍15 mol/kg) (Laverman et al.,
`2001). Ishida et al. (2003) have demonstrated the changes in
`the PK behavior of SSL in mice when a second dose (25
`mol/kg phospholipid) was given between 7 and 14 days after
`the initial dose. Our results differ from that study in that our
`injected lipid doses were much higher (⬃65–72 mol/kg) and
`the magnitude of the clearance response was much greater;
`moreover, pronounced morbidity was observed on repeat in-
`jections of SSL containing high levels of DNA, which has not
`been reported previously. Dams et al. (2000) have suggested
`that a 150-kDa nonantibody-soluble serum factor mediates
`the rapid clearance phenomenon in rats and monkeys,
`whereas our data in immunocompromised mice, as well as
`the IgM studies, strongly suggest an antibody response.
`Whereas the mechanism of the immune response and the cell
`populations that facilitate it have not yet been fully elucidated,
`the studies involving nude and SCID-Rag2 mice suggest that B
`cells and immunoglobulin, and not T cells, are critical. Immune-
`competent and nude mice that were injected repeatedly with
`PEG liposomes containing ODN showed signs of morbidity and
`difficulty bleeding and,
`in extreme cases, exhibited rapid
`breathing and seizures. These symptoms are typical of a shock
`response and could be generated through a number of mecha-
`nisms. The delivery of bacterial DNA and synthetic oligonucle-
`otides to macrophages and monocytes can result in acute cyto-
`kine release and tumor necrosis factor-␣-mediated lethal shock
`in mice (Sparwasser et al., 1997). In our study, clinical signs
`only developed with repeat injections and were associated with
`rapid removal of the carrier from the blood, suggesting a hu-
`moral response. IgM responses typically occur 3 to 7 days after
`antigen exposure, which was consistent with the onset of the
`immunogenic response observed here (Fig. 3b). In this regard,
`increases in PEG-reactive plasma IgM were observed in mice
`treated repeatedly with PEG liposomes containing ODN. IgM-
`antibodies against the glycolipid ganglioside GM1 are common
`in patients with neuropathy and have been shown to result in
`strong complement-mediated lysis of GM1-containing liposomes
`(Mitzutamari et al., 1998). The generation of antibody and
`putative complement activation are a likely explanation for the
`rapid elimination of the vesicles from the blood. IgG, IgM, and
`iC3b are prominent opsonins associated with liposome formu-
`lations that exhibit rapid plasma clearance (Chonn et al., 1992).
`That the presence of encapsulated ODN in PEG liposomes
`could potentially stimulate the production of antibodies is per-
`haps not surprising. Some phosphorothioate antisense ODN
`and bacterial DNA have been shown to have strong mitogenic
`properties in vitro, resulting in lymphocyte proliferation and
`production of IgM (Krieg, 2002). These same ODN produced
`splenomegaly and increased cellularity/activation in vivo (Mon-
`teith et al., 1997). That the presence of encapsulated DNA could
`stimulate the production of antibody to the PEG-lipid is of
`
`Fig. 6. IgM binding to pegylated liposomes. Groups of mice (n ⫽ 5) were
`injected weekly (i.v.) with SALP (PEG-CerC20) containing c-myc ODN or
`empty liposomes of the same lipid composition. One week after each
`injection, mice were bled, plasma was collected and pooled, and serial
`dilutions were subsequently analyzed on different microtiter plates as
`described under Materials and Methods. Each plate contained a different
`liposome formulation (indicated in each panel) bound to the wells through
`biotin-streptavidin interactions. The results are expressed for the 1:800
`plasma dilution. The results for mice injected with empty liposomes are
`presented for the fourth and final injection.
`
`the removal of the carrier from the circulation and pro-
`nounced morbidity in mice.
`An immune component of this response was verified using
`immune-compromised BALB/c nude mice, where rapid blood
`clearance was observed, and in BALB/c