An inhibitor of mTOR reduces neoplasia and
`normalizes p70yS6 kinase activity in
`Pten1/2 mice
`
`Katrina Podsypanina*, Richard T. Lee*, Chris Politis*, Ian Hennessy*, Allison Crane*, Janusz Puc*, Mehran Neshat†,
`Hong Wang‡, Lin Yang*, Jay Gibbons§, Phil Frost§, Valley Dreisbach¶, John Blenis¶, Zbigniew Gaciongi,
`Peter Fisher*, Charles Sawyers†, Lora Hedrick-Ellenson‡, and Ramon Parsons*,**
`
`*Institute of Cancer Genetics, Departments of Pathology and Medicine, College of Physicians and Surgeons, Columbia University, 1150 St. Nicholas Avenue,
`Russ Berrie Pavilion, New York, NY 10032; †Department of Medicine, Molecular Biology Institute, University of California, Los Angeles, CA 90095-1678;
`‡Department of Pathology, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021; §Wyeth-Ayerst Research, 401
`Middletown Road, Pearl River, NY 10965; ¶Department of Cell Biology, Harvard Medical School, Boston, MA 02115; and iDepartment of
`Internal Diseases and Hypertension, Medical University of Warsaw, 1a Banacha Street, 02-097 Warsaw, Poland
`
`Edited by Bert Vogelstein, Johns Hopkins Oncology Center, Baltimore, MD, and approved June 14, 2001 (received for review February 6, 2001)
`
`PTEN phosphatase acts as a tumor suppressor by negatively reg-
`ulating the phosphoinositide 3-kinase (PI3K) signaling pathway. It
`is unclear which downstream components of this pathway are
`necessary for oncogenic transformation. In this report we show
`that transformed cells of PTEN1/2 mice have elevated levels of
`phosphorylated Akt and activated p70yS6 kinase associated with
`an increase in proliferation. Pharmacological inactivation of mTORy
`RAFTyFRAP reduced neoplastic proliferation, tumor size, and
`p70yS6 kinase activity, but did not affect the status of Akt. These
`data suggest that p70yS6K and possibly other targets of mTOR
`contribute significantly to tumor development and that inhibition
`of these proteins may be therapeutic for cancer patients with
`deranged PI3K signaling.
`
`The PTEN tumor suppressor is mutated in a wide variety of
`
`human sporadic and inherited cancers (1). PTEN acts as a
`negative regulator of the phosphoinositide 3-kinase (PI3K)
`signaling pathway by dephosphorylating the second messengers
`phosphatidylinositol-3,4,5-trisphosphate [PtdIns(3,4,5)P3] and
`phosphatidylinositol-3,4-bisphosphate [PtdIns(3,4)P2] at the D3
`position of the inositol ring, thereby opposing PI3K function (2).
`Consistent with the role of PTEN as a PtdIns(3,4,5)P3 phospha-
`tase, Pten-deficient cells have elevated levels of intracellular
`PtdIns(3,4,5)P3 (3, 4).
`In flies, expression of PTEN can rescue lethality caused by
`overexpression of d-PI3K (Dp110) or the fly insulin receptor
`(Inr) (5, 6). The loss-of-function phenotypes of dPTEN, in-
`creased cell size and proliferation, are suppressed by inactivating
`mutations in dAKT1 and the translational initiation factor eif4A,
`suggesting that dPTEN acts through the AKT-signaling pathway
`to regulate translation (7). Loss-of-function mutations in an-
`other translational regulator, Drosophila p70yS6 kinase (dS6K)
`(8), as well as its upstream regulators dPI3K, Inr, and chico (fly
`insulin receptor substrate 1–4) decrease cell size in Drosophila
`(9). For p70yS6 kinase (S6K) the ability to control cell size is
`conserved in mammals (10, 11). In addition, S6K2/2 mouse
`embryonic stem cells have a defect in proliferation with a greater
`proportion of cells in G0yG1 (10). The increased size and
`proliferation of dPTEN-deficient cells is consistent with the
`antagonistic role of PTEN in the PI3K-signaling pathway and
`suggests that PTEN may play a role in regulating S6K.
`Mitogen-induced activation of S6K is mediated through the
`PI3K-dependent phosphorylation of several residues (12, 13).
`This activation is in part performed by 3-phosphoinositide-
`dependent kinase 1 (14, 15). In addition, membrane-tethered
`AKT is able to activate S6K, whereas untethered, activated
`mutants of AKT do not have this effect (16). Activation of S6K
`can be blocked by the pharmacological agent rapamycin (17, 18).
`Rapamycin has potent immunosuppressant and tumor inhibitory
`
`activities (19). To exert its effect, rapamycin binds an immu-
`nophilin, FK-506-binding protein 12, and this complex inhibits
`the cellular target of rapamycin, mTORyRAFTyFRAP (20–22).
`mTOR is a member of the ataxia-telangiectasia-mutated (ATM)
`family of kinases that seems to function in a checkpoint for
`nutritional status in G1 and in response to the PI3KyAKT
`pathway (23, 24). AKT can directly phosphorylate mTOR (25,
`26), although the impact of this phosphorylation on the activity
`of mTOR has not been firmly established. Several studies have
`demonstrated control of S6K activity by mTOR by direct (27, 28)
`and indirect (29–31) mechanisms. Recent studies of the fly
`homolog of mTOR, dTOR, have demonstrated that mutants of
`dTOR have reduced cell size and proliferation and fail to
`develop to maturity (32, 33). Overexpression of dS6K rescued
`dTOR mutants from embryonic lethality (32). Moreover, the
`large cell size and hyperproliferative phenotypes of dPTEN were
`completely masked by mutation of dTOR. These data suggest
`that dS6K is a critical downstream target of dTOR and dPTEN.
`S6K is amplified and overexpressed in breast cancer, which
`suggests a potential oncogenic function (34, 35). Constitutive
`activation of S6K in PTEN-deficient tumor cells has been
`reported previously and can be corrected by reintroduction of
`PTEN (36). To investigate the potential contribution of the
`mTORyS6K pathway to the transformation induced by Pten loss,
`we examined the effect of inhibiting mTOR with the rapamycin
`ester CCI-779 in the Pten1/2 mouse tumor model system.
`
`Materials and Methods
`Mice and Treatment. Pten1/2 mice were generated as described
`(37). The rapamycin analog CCI-779 was provided by Wyeth
`Ayerst Laboratories (Marietta, PA). The drug was first diluted
`to 50 mgyml in 100% ethanol and then quickly mixed with 5%
`Tween-80 (GIBCOyBRL)y5% polyethylene glycol-400 (Sigma)
`to a 2 mgyml drugy4% ethanol final concentration. The drug
`solution, or the vehicle alone, was delivered to mice through the
`tail vein at a dose of 20 mgykg (10 mlyg of body weight).
`Histology. Mice were given i.p. injections of 125 mgykg of BrdUrd
`(Sigma) 1 h before euthanasia. Organs for histological analysis
`
`This paper was submitted directly (Track II) to the PNAS office.
`
`Abbreviations: PI3K, phosphoinositide 3-kinase; CAH, complex atypical hyperplasia;
`PtdIns(3,4,5)P3, phosphatidylinositol-3,4,5-trisphosphate; TUNEL, terminal deoxynucleoti-
`dyltransferase-mediated dUTP nick end labeling.
`
`See commentary on page 10031.
`
`**To whom reprint requests should be addressed. E-mail: rep15@columbia.edu.
`
`The publication costs of this article were defrayed in part by page charge payment. This
`article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.
`§1734 solely to indicate this fact.
`
`10320 –10325 u PNAS u August 28, 2001 u vol. 98 u no. 18
`
`www.pnas.orgycgiydoiy10.1073ypnas.171060098
`
`West-Ward Exhibit 1094
`Podsypanina 2001
`Page 001
`
`

`

`MEDICALSCIENCES
`
`were kept in 10% formalin overnight, then changed to 70%
`ethanol. Paraffin embedding was performed no later than a week
`after organ collection. For the long-term CCI-779 experiment,
`paraffin tissue blocks from individual mice were coded from 1 to
`20 and hematoxylinyeosin stains of those were analyzed in
`blinded fashion by at least three investigators (K.P., R.P., P.F.,
`and L.H.-E.). Catecholamines were measured from blood col-
`lected at the time of death with an HPLC kit from Bio-Rad
`according to the manufacturer’s instructions.
`
`immunohistochemistry stains were
`Immunohistochemistry. All
`performed on 4-mm-thick tissue slices as described (38). The
`following antibodies and dilutions were used: mouse monoclonal
`anti-BrdUrd (Becton Dickinson) 1:200, rabbit polyclonal anti-
`PTEN (Neomarkers Ab-2) 1:500, rabbit polyclonal anti-
`phospho-AKT (Ser-473; NEB, Beverly, MA) 1:50, and mouse
`monoclonal anti-p27 (Transduction Laboratories, Lexington,
`KY) 1:500. Apoptosis was measured with the terminal
`deoxynucleotidyltransferase-mediated dUTP nick end labeling
`(TUNEL) assay. Positive controls included irradiated organs
`and DNase-treated sections. The apoptotic index was calculated
`similar to the BrdUrd incorporation index (see below). TUNEL
`staining was performed on paraffin-embedded sections that
`were deparaffinized in xylenes and transferred to 95% methanol
`and then water. Slides then were treated with 20 mgyml pro-
`teinase K for 20 min, washed, and endogenous peroxidases were
`blocked in 3% H2O2 in methanol, dipped in terminal de-
`oxynucleotidyltransferase (TdT) buffer, and incubated for 60
`min at 37°C with the TdTyBio-16-dUTP mix. After a wash, slides
`were incubated with Avidin-horseradish peroxidase (Dako)
`1:400 for 20 min. The horseradish peroxidase substrate 3-amino-
`9-ethylcarbazole was incubated with the slides in a glass con-
`tained in the acetate buffer (10.5 mM acetic acidy80 mM Na
`acetate solution, pH 5.5) until full color development and
`counterstained with Mayer’s hematoxylin.
`
`Measurement of Proliferation, Apoptosis, Lesion Size. Anti-BrdUrd
`and TUNEL-stained uterine cross-sections (3–5 per mouse) and
`adrenal medullas were acquired at 340 magnification by a
`Diagnostic Instruments (Sterling Heights, MI) digital SPOT
`(Diagnostic Instruments, Sterling Heights, MI) camera in Adobe
`PHOTOSHOP. Vertical and horizontal diameters of the uteri,
`complex atypical hyperplasia (CAH) lesions, and medullas were
`measured by using the loop tool. All BrdUrd- and TUNEL-
`positive cells were counted in the secretory epithelium of the
`uterus and in the medulla. Resulting numbers were entered in a
`Microsoft EXCEL spreadsheet. Areas were calculated by averag-
`ing horizontal and vertical diameters to obtain the radius. The
`BrdUrd and TUNEL indexes for adrenals in all experiments and
`untreated and short-term-treated uterine samples were calcu-
`lated by dividing the absolute number of positive cells by the
`uterine or adrenal section area. In transition zones, up to 100
`nuclei were counted in transformed and nontransformed re-
`gions, and the BrdUrd index was calculated per total number of
`nuclei. For the long-term treatment group, all secretory epithe-
`lial cells were counted in one section per mouse, and the BrdUrd
`and TUNEL index was calculated per total number of cells.
`Lesions in stained sections were acquired at 325 magnification
`and measured with use of NIH IMAGE 1.62. P values were calcu-
`lated with Student’s t test. Error bars represent standard devi-
`ation. P values were obtained by comparing two given groups by
`Student’s two-tailed t test.
`
`Western Blotting. Frozen uteri and adrenals were ground in liquid
`nitrogen by mortar and pestle and tissue powder was transferred
`into 13 loading buffer and boiled for 5 min. Samples were spun
`and soluble protein concentrations were determined before
`loading on a gel. Antibodies to AKT and phospho-389-S6K were
`
`obtained from NEB and anti-tubulin was purchased from Babco
`(Richmond, CA). The C-2 antibody for S6K was used.
`
`Pten Loss of Heterozygosity. To study loss of heterozygosity of
`Pten in the CAH of the endometrium, the wild-type and
`mutant alleles were amplified from DNA prepared from
`microdissected, formalin-fixed, paraffin-embedded uterine le-
`sions. Both the mutant and wild-type alleles were amplified
`simultaneously by using a common 59 primer within intron 4
`and two 39 primers, one within exon 5 of Pten and one within
`the Pgk gene: GGGATTATCTTTTTGCAACAGT (Pten 59 ),
`GGCCTCTTGTGCCTTTA (Pten 39), and TTCCTGAC-
`TAGGGGAGGAGT (Pgk 39). Tail DNAs of a healthy PTEN
`heterozygous mouse and a wild-type mouse were used as
`controls. PCR was performed in 50-ml reactions containing 10
`mM TriszHCl (pH 9.2), 1.5 mM MgCl2, 75 mM KCl, 0.4 mM of
`each 39 primer, 0.8 mM 59 primer, 160 mM each dNTP, and 2.5
`units of Taq polymerase(GIBCO). Forty cycles of PCR were
`performed; each cycle consisted of 1 min at 95°C, 1 min at
`57°C, and 1 min at 72°C followed by a single 5-min extension
`at 72°C. To study the loss of heterozygosity of Pten in the
`adrenals, Southern blotting was performed on DNA extracted
`from normal adrenals, pheochromocytomas, and tail DNA as
`a control. 39 probe flanking the targeted region was used on
`the PstI-digested DNA.
`
`S6K Assay. The S6K kinase assay was performed essentially as
`described previously (10, 39). In short, frozen uteri of 35- to
`50-week-old animals were homogenized in 10 mM KPO4, 10 mM
`MgCl2, 1 mM EDTA, and 0.1% Nonidet P-40 in the presence of
`protease and phosphatase inhibitors. Protein concentration was
`measured from the soluble fraction, and samples were normal-
`ized to equal protein concentration in each experiment. S6K was
`immunoprecipitated from tissue lysates with protein AyG aga-
`rose (C-18, Santa Cruz Biotechnology) at 4°C overnight. Sam-
`ples were washed twice in the lysis buffer followed by a wash in
`kinase buffer (20 mM Tris, pH 7.5y10 mM MgCl2y0.1 mg/ml
`BSAy0.4 mM DTT). The kinase reaction was performed at 30°C
`for15 min in the presence of 100 mM ATP, 200 mCiyml
`[g-32P]ATP, and 125 mM S6 peptide substrate (Upstate Bio-
`technology, Lake Placid, NY). Stopped reactions were loaded
`onto phosphocellulose columns (Pierce) and unbound label was
`washed with 75 mM phosphoric acid. Bound, labeled probe was
`measured in a liquid scintillation counter.
`
`Results
`To use the Pten1/2 mice for preclinical trials of candidate drugs,
`the penetrance and variability of tumor phenotypes was docu-
`mented. Multifocal CAH developed in the uterine secretory
`epithelium of almost every (29y30) Pten1/2 female mouse by 26
`weeks of age. Two types of transformed lesions were present:
`cribriform glands and transformed cysts. Cribriform glands were
`defined as continuous foci of crowded glands. Transformed cysts
`were defined as cavities fully or partially lined with transformed
`epithelium. Some cavities appeared empty and some were filled
`with necrotic masses. In some sections a stretch of normal
`epithelium was observed in the cyst wall, with a clear transition
`zone between normal and transformed epithelium. Some of the
`older wild-type mice had cysts in the endometrium, but the
`epithelial lining was never transformed. We also observed that
`nearly all of the Pten1/2 mice developed neoplasia of the
`chromaffin cells of the adrenal medulla by 6 months (48y49; Fig.
`1 A and B). This neoplasia was bilateral and multifocal. In mice
`more than 1 year of age the tumors were frequently diagnosed
`as pheochromocytomas. Elevated serum levels of both norepi-
`nephrine (P 5 0.069) and epinephrine (P 5 0.039) suggested that
`the tumor cells retained some of the functional characteristics of
`the chromaffin cell (Fig. 1 C and D).
`
`Podsypanina et al.
`
`PNAS u August 28, 2001 u vol. 98 u no. 18 u 10321
`
`West-Ward Exhibit 1094
`Podsypanina 2001
`Page 002
`
`

`

`Pten1/2 mice develop pheochromocytomas of the adrenal medulla.
`Fig. 1.
`Morphology of the wild-type adrenal (A) and the Pten1/2 adrenal containing
`a pheochromocytoma (B). (Magnification, 340.) The normal medulla can be
`seen in the center of the wild-type adrenal cortex. Paraffin sections were
`stained with hematoxylinyeosin. PTEN1/2 animals (mutant) have elevated
`levels of serum norepinephrine (C) and epinephrine (D) relative to wild type.
`
`Proliferation Is Increased in the Lesions. Loss of Pten has been
`linked to both increased proliferation and to defects in apoptosis.
`To investigate whether either of these mechanisms contributed
`to uterine neoplasia, we first studied the frequency of BrdUrd
`incorporation in wild-type and mutant uteri of 35- to 38-week-
`old animals. Overall, Pten1/2 uterine CAH had a 2-fold increase
`in BrdUrd-positive cells when compared with wild-type secre-
`tory epithelium (1y2, n 5 4; wild type, n 5 3; Fig. 2A). Analysis
`of seven cystic lesions composed of both transformed and
`untransformed epithelium revealed a 3-fold increase in BrdUrd-
`positive cells in the transformed epithelium (Fig. 2B; P 5 0.007).
`At the same time we measured the level of BrdUrd incorporation
`in the adrenal medulla. We found that there was a substantial
`increase in the proliferation of medullary cells of Pten1/2 mice
`that occurred in regions of neoplasia (Fig. 2 C–E; P , 0.001).
`
`Increased proliferation in the neoplastic regions of Pten1/2 uteri and
`Fig. 2.
`adrenals. Mice were injected with 125 mgykg of BrdUrd for 1 h before death
`and sections were stained with an antibody recognizing BrdUrd. (A) Prolifer-
`ation index in Pten1/1 (h) and Pten1/2 (n) uteri was calculated by comparing
`the proliferation index of the secretory epithelium in wild type with that of
`the CAH. (B) Proliferation index in normal (h) and transformed (n) regions of
`cysts of Pten1/2 uteri. BrdUrd-positive cells were counted per total number of
`nuclei. (C) Proliferation index of wild-type (h) and 1y2 (n) adrenal medulla.
`Error bars indicate SD. Examples BrdUrd staining of the wild-type (D) and
`Pten1/2 (E) medulla. Increased BrdUrd incorporation can be seen in E relative
`to D.
`
`Fig. 3. Neoplastic lesions in Pten1/2 uteri have lower levels of Pten, and
`higher active Akt. (A) Loss of heterozygosity in hyperplastic lesions of the
`endometrium. Products from wild-type and mutant Pten alleles are amplified
`in a duplex reaction. Controls consist of products generated from tail DNA
`isolated from Pten heterozygous (lane 1) and wild-type (lane 2) mice. Lanes 3,
`4, and 5 are amplified products from microdissected, hyperplastic endometrial
`lesions from three Pten heterozygous mice at 32 weeks of age. Loss of the
`wild-type Pten allele is present in one lesion (lane 3), and both alleles are
`retained in the other two lesions (lanes 4 and 5). (B) Loss of heterozygosity in
`Pten1/2 adrenals. Adrenal DNA was prepared from six Pten1/2 mice. After
`probing the wild-type (wt) and mutant alleles (mut) (arrowheads), we ob-
`served that five of the six Pten1/2 adrenals had undergone loss of heterozy-
`gosity. Control (1y2) and wild-type DNA (1y1) were prepared from tails.
`(C–E) Transition zone in Pten1/2-transformed uterine cysts. Slides were stained
`with hematoxylinyeosin (C), rabbit polyclonal anti-PTEN (D), and rabbit poly-
`clonal anti-phospho-AKT (Ser-473) (E). (Magnification, 3600.) (F and G) Al-
`tered PTEN and phospho-AKT expression are detected in the adrenal medulla.
`Reduced PTEN staining correlates with transformation and phospho-AKT
`staining. (F) A small representative focus of reduced PTEN expression in a
`Pten1/2 adrenal medulla. Notice that most PTEN staining within the medullary
`cells occurs in the nucleus. (G) A small focus of increased phospho-AKT staining
`correlates with reduced PTEN expression. (Magnification, 3600.) Cortex (C)
`stains nonspecifically for PTEN and phospho-AKT.
`
`With use of terminal deoxynucleotidyltransferase labeling of
`DNA nicks with the TUNEL assay on the same tissues, no
`difference in the apoptotic frequency was observed between
`wild-type and heterozygous tissues (data not shown).
`
`Loss of the Wild-Type Allele Occurs in the Lesions. Uteri then were
`examined for loss of wild-type Pten. Protein expression analysis
`of the total lysates of mutant uteri demonstrated reduced PTEN
`expression relative to wild type (data not shown). PCR analysis
`of the individual lesions in seven Pten1/2 mice detected loss of
`the wild-type Pten allele in 30% (9y30) lesions studied (Fig. 3A).
`An example of loss of heterozygosity in a lesion is shown in lane
`3; lesions with no discernible loss of heterozygosity are shown in
`lanes 4 and 5 (Fig. 3A). The frequency of loss may be an
`underestimate because of normal tissue contamination during
`microdissection. In the adrenal lesions, loss of the wild-type
`
`10322 u www.pnas.orgycgiydoiy10.1073ypnas.171060098
`
`Podsypanina et al.
`
`West-Ward Exhibit 1094
`Podsypanina 2001
`Page 003
`
`

`

`MEDICALSCIENCES
`
`S6K activity but not AKT phosphorylation can be inhibited with
`Fig. 4.
`CCI-779. (A) S6K activity in Pten1/2 (F), Pten1/2 treated with CCI-779 for 3 days
`(E), and Pten1/1 (h) uterine lysates. Protein concentration was measured from
`the soluble fraction, and samples were normalized for equal protein concen-
`tration before the immunoprecipitation and measurement of S6K activity. (B)
`Short-term CCI-779 treatment reduces the BrdUrd incorporation index. Br-
`dUrd incorporation index in mock (n)- and drug (h)-treated Pten1/2 uterine
`epithelium treated for 3 days with vehicle or CCI-779. (C) Phosphorylated S6K
`levels in 293 cell line and mouse uterine lysates. (Lanes 1 and 2) 293 cells pulsed
`with epidermal growth factor or starved. Note reduced mobility of S6K in lane
`1. Pten1/1 (lanes 3 and 4) and Pten1/2 (lanes 5– 8) uterine lysates analyzed on
`an 8% polyacrylamide gel. Frozen uteri were ground and transferred into
`loading SDS buffer, and protein concentrations were normalized by anti-
`MAPK signal. A slower migrating band was seen in lysates of mice that were
`not treated with CCI-779 (lanes 7 and 8). This band was not present in Pten1/2
`lysates of mice treated with CCI-779 for 3 days (lanes 5 and 6) or in treated or
`untreated wild-type lysates (lanes 3 and 4). (D) Uterine (Upper) and adrenal
`(Lower) lysates from wild-type (1y1) and mutant animals (1y2) were re-
`solved on a 4 –20% gradient gel, blotted, and probed with anti-phospho-473
`and total AKT antibodies. Each sample was collected from a Pten1/2 mouse
`injected with either diluent or CCI-779 (Drug) for 3 days.
`
`(weeks 1, 2, 4, 6, and 8: 5 days on, 2 days off; weeks 3, 5, 7: 7 days
`off; week 9: 4 days on, 3 days off; week 10: 2 days on). Tissues
`were collected on the day after the last injection. Long-term
`treatment with CCI-779 produced detectable improvement in
`the health of the animals. Animals receiving drug injections
`appeared more active, and by the end of the study all were alive,
`whereas three animals died in the untreated and mock-treated
`groups. The cause of death was not determined, but was typically
`caused by uterine or gastrointestinal tumors.
`We chose to focus on the drug’s effect on the two tumor
`phenotypes with the highest penetrance by 25 weeks of age,
`uterine and adrenal medullary neoplasia. Morphological analysis
`showed that drug-treated Pten heterozygotes had a marked
`reduction in uterine and adrenal lesion size when compared with
`the mock-treated or untreated group (Fig. 5 A and B; P 5 0.09,
`P 5 0.039). However, the effect appeared to be cytostatic
`because lesion size of the treated group and untreated 26-week-
`old mice was similar. Drug-treated mice also had a substantial
`reduction in the frequency of BrdUrd incorporation in both
`types of neoplasia relative to mock-treated controls (Fig. 5 C and
`D; P 5 0.028, P , 0.001). Immunohistochemical analysis of
`uterine sections still detected reduced Pten and activated Akt
`levels in drug-treated lesions (n 5 35),
`indicating that the
`intervention occurred downstream of these molecules (Fig. 5 E
`and F). Although both PTEN and rapamycin have been linked
`to the regulation of p27, no alteration of p27 was detected by
`
`allele was observed in five of six heterozygous adrenals by
`Southern blotting (Fig. 3B).
`
`Neoplasia Is Characterized by Reduced PTEN Expression and Increased
`Phosphorylation of AKT. Immunohistochemical analysis of uterine
`sections demonstrated that untransformed epithelial cells
`stained intensely for PTEN in the cytoplasm, whereas signifi-
`cantly decreased levels of Pten staining occurred in regions of
`transformation (n 5 60; Fig. 3 C and D). Pten-deficient cells
`typically have activated AKT. Analysis of phosphorylated Akt in
`the serial sections of the uteri of Pten1/2 mice detected phospho-
`Akt (Ser-473) in all of the areas of transformation (n 5 60) in
`a membrane-specific pattern (Fig. 3E). The signal also corre-
`sponded precisely to the areas of Pten down-regulation. Staining
`for total AKT revealed that nearly all of the AKT shifted from
`the cytoplasm and nucleus in normal epithelium to the mem-
`brane in CAH (data not shown). We did not detect phospho-Akt
`in any of the uterine sections of 35- to 38-week-old wild-type
`mice (data not shown). In the adrenal medulla, staining for
`PTEN occurred in both the nucleus and cytoplasm of medullary
`chromaffin cells (Fig. 3F). In Pten1/2 mice, multifocal regions of
`reduced PTEN expression were found. An example of a focus of
`reduced staining is shown in Fig. 3F. In addition, increased
`staining for phospho-AKT could be detected in areas of reduced
`PTEN staining (Fig. 3G).
`
`Altered Activity of S6K in the Neoplastic Uterus. Because CAH was
`consistently found in older Pten1/2 mice, we decided to deter-
`mine whether S6K kinase activity was elevated in their uteri. We
`also tested whether a mTOR inhibitor could affect S6K activity
`in established endogenous tumors. We chose to use the rapa-
`mycin ester, CCI-779, which was developed for i.v. administra-
`tion in cancer patients (19, ††). For 3 days, 34- to 44-week-old
`Pten1/2 females were injected once daily with 20 mgykg CCI-779
`or the vehicle only. The choice of dose was based on prior studies
`of mouse response to CCI-779 (J.G., unpublished observations).
`Tissues were collected on the last day of injection from treated
`(n 5 3) and untreated (n 5 4) Pten1/2 and untreated wild-type
`(n 5 4) mice. S6K activity was elevated in the uteri of heterozy-
`gous mice relative to wild type (Fig. 4A). CCI-779 seemed to
`inhibit kinase activity to wild-type levels. Uterine lysates also
`were analyzed for the mobility of S6K, because its slower
`migrating form is associated with increased phosphorylation and
`kinase activity. Lysates from starved and epidermal growth
`factor-pulsed 293 cells were loaded as controls for the detection
`of the fast- and slow-moving species. The slow-moving species of
`S6K was observed only in the epidermal growth factor-treated
`293 lysate and the lysates from two untreated Pten heterozygous
`uteri (Fig. 4C). CCI-779 treatment led to the presence of only the
`hypophosphorylated, inactive, and faster migrating form. Uteri
`of Pten heterozygous females that received CCI-779 injections
`for 3 days had a modest 40% reduction in epithelial proliferation
`(Fig. 4B). Although CCI-779 had a marked effect on S6K
`activity, the level of phospho-Akt (Ser-473) was not affected in
`either uterine or adrenal tissues (Fig. 4D). No difference in
`apoptosis levels was detected among the different groups as
`assessed by terminal deoxynucleotidyltransferase labeling of
`DNA nicks (data not shown).
`
`Trial of CCI-779 in Pten1y2 Mice. To determine whether CCI-779
`could be used to treat the mouse tumors, a longer course of
`CCI-779 was given. A second group of Pten1/2 females (24–28
`weeks old) were injected daily with 20 mgykg CCI-779 (n 5 7)
`or vehicle (n 5 7), or were left untreated (n 5 6) for 10 weeks
`
`††Gibbons, J. J., Discafani, C., Petersen, R., Hernandez, R., Skotnicki, J. & Frost, P. (1999) Proc.
`Am. Assoc. Cancer Res. 40, 301 (abstr.).
`
`Podsypanina et al.
`
`PNAS u August 28, 2001 u vol. 98 u no. 18 u 10323
`
`West-Ward Exhibit 1094
`Podsypanina 2001
`Page 004
`
`

`

`dTOR mutation is associated with G0yG1 accumulation and lack
`of animal viability that can be rescued by overexpression of dS6K
`(32). Such data suggest that inhibition of S6K is an important
`mediator of the antiproliferative effects of mTOR.
`Another regulator of translation and cell growth, 4E-BP1, is
`controlled by the PI3KyAKT and mTOR pathways (24, 25, 43,
`44). In its unphosphorylated state, 4E-BP1 binds to EIF-4E to
`inhibit the translation of 59-capped messages (45). On stimula-
`tion of cell growth, 4E-BP1 becomes phosphorylated and no
`longer inhibits translation. Inhibitors of mTOR block phosphor-
`ylation of 4E-BP1. Although we have not studied 4E-BP1
`phosphorylation, alterations of its function may be contributing
`to the neoplasias that we see.
`We conclude that the tumor stasis and the reduced prolifer-
`ation that we have observed with the rapamycin analog CCI-779
`is in part caused by the inhibition of the elevated S6K activity
`found in the tumors (Figs. 4 and 5). Our findings suggest that S6K
`and possibly other proteins regulated by mTOR contribute to the
`oncogenic effects of Pten loss.
`Although we see a reduction in tumor proliferation in the
`mouse tumors, rapamycin and CCI-779 are not broadly antipro-
`liferative. Rapamycin is well tolerated when administered in vivo
`and inhibits the growth of only a subset of tumors expressing
`mTOR (46). In a recent report by the Vogt lab, rapamycin was
`found to inhibit the growth of fibroblasts transformed with AKT
`and PI3K but had no effect on cells transformed with v-Jun or
`v-Src (47). This group found that the growth of v-H-Ras and
`v-Myc transformants was stimulated by rapamycin. It also has
`been reported that rapamycin is able to induce apoptosis in
`tumors. We have not seen such apoptosis and presume that this
`may be a reflection of the benign nature of the mouse neoplasias.
`Huang et al. have recently shed light on this paradox (48). They
`found that tumor cells and mouse embryo fibroblasts lacking
`intact p53 or p21 were unable to arrest in G1 in response to
`rapamycin and instead underwent apoptosis. However, when the
`p53 pathway was reconstituted or intact, cells arrested in G1 and
`did not die. These data suggest that rapamycin analogs may be
`more potent in the clinical setting in which the PTEN and p53
`pathways are altered.
`We have found that disease progression caused by Pten
`mutation can be delayed by inhibiting mTOR and biochemical
`targets downstream of mTOR such as S6K. This finding suggests
`that enzymes other than AKT are excellent targets for the
`treatment of PTEN2/2 tumors. With respect to human endome-
`trial cancers, which lack PTEN in more than 60% of cases,
`inhibition of mTOR may prove to be a useful agent for patients
`with disease that is refractory to standard treatments. Moreover,
`rapamycin and its analog CCI-779 are well tolerated in people,
`suggesting that there may be a usable therapeutic dose with
`limited systemic toxicity (19). In the future, it will be interesting
`to determine in Pten1/2 mice whether the inducible disruption
`of S6K1, mTOR, or4E-BP1 or a combination of these will have
`antitumor effects that are similar to CCI-779.
`
`We thank Giorgio Cattoretti for his assistance with immunohistochem-
`ical staining and generous sharing of reagents. R.T.L. was supported by
`the Peter Jay Sharp Foundation, the Don Shula Foundation, and the
`American Society of Clinical Oncology. This work was supported by
`National Cancer Institute Grant CA 75553.
`
`Long-term CCI-779 treatment prevents tumor growth and prolifer-
`Fig. 5.
`ation in Pten1/2 without affecting Akt activity. (A) Size of neoplastic lesions in
`mock, untreated (none) and CCI-779-treated (CCI) uteri. All mice are Pten1/2
`females and average age of each cohort is indicated. (B) Size of the untreated
`(none) wild-type (wt), untreated Pten1/2, mock-treated Pten1/2, and CCI-779-
`treated (CCI) Pten1/2 adrenal medullas. (C) Proliferation in mock (n)- and drug
`(h)-treated uteri. BrdUrd-positive cells were counted per total number of
`nuclei in CAH. (D) Proliferation in mock-treated Pten1/2 (n) and CCI-779-
`treated Pten1/2 (h) adrenal medullas. (E and F) Phosoho-473 Akt levels in the
`mock (E)- and drug (F)-treated uteri. (Magnification, 3400).
`
`immunohistochemistry in either treated or untreated lesions
`(40, 41).
`
`Discussion
`It is likely that the loss of Pten found in the tumors of PTEN1/2
`mice leads to increased levels of PtdIns(3,4,5)P3, which in turn
`is able to activate AKT, 3-phosphoinositide-dependent kinase 1,
`S6K, mTOR, and many other proteins. In combination, these
`activated proteins probably contribute to the transformation and
`increased tumor proliferation that was observed in a variety of
`organs (Figs. 1 and 2). Of these activated proteins, S6K is likely
`to play a major role in the progression of the cell cycle into the
`S phase. Microinjection of anti-S6K antibodies into quiescent rat
`embryo fibroblasts prevents the mitogenic effect of serum (32,
`33). In T cells, which are unable to proliferate in the presence of
`rapamycin, a rapamycin-resistant allele of S6K is sufficient to
`rescue the activation of an E2F reporter (42). S6K12/2 mouse
`embryonic stem cells have an elevated proportion of cells in
`G0yG1 and slower proliferation relative to wild type (10). Finally,
`
`1. Ali, I. U., Schriml, L. M. & Dean, M. (1999) J. Natl. Cancer Inst. 91, 1922–1932.
`2. Cantley, L. C. & Neel, B. G. (1999) Proc. Natl. Acad. Sci. USA 96, 4240–4245.
`3. Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C.,
`Sasaki, T., Ruland, J., Penninger, J. M., Siderovski, D. P. & Mak, T. W. (1998)
`Cell 95, 29–39.
`4. Sun, H., Lesche, R., Li, D. M., Liliental, J., Zhang, H., Gao, J., Gavrilova,
`N., Mueller, B., Liu, X