throbber
  ÿ  
ÿÿ
ÿ
  ÿÿÿ
`
`
`
`6)37%'2ÿ)&5ÿ688129ÿ:%,%&'ÿ;5<)&,%2ÿ-&ÿ'(%ÿ=%<%18>*%&'ÿ8?ÿ;&'-@AB
`C/,1%-,ÿ;,-52
`
`DEÿGHIJKHLMNOJPQÿREÿSEÿTUVWXJPLMYZYJÿ[V\ÿ]Eÿ^JKP[_L`JKK[VPa
`
`bcdefegehÿjkÿlmnmdfehohpqmÿrÿsfhtkjfufcmÿvwxykz{|krnm}~ÿ€b~ÿlmngkÿ‚kuchoxpfuhÿjkÿfkcufmdÿjkÿomÿ€mogj~ÿƒ„jm…ÿjko
`hchuftfkcehÿd†c~ÿƒntfoomÿ‡ˆ‡‰‰~ÿŠnmcmjm~ÿ€ymfc
`
`;02'3),'9ÿ`JO[‹Œ‹ŒÿDÿŽŒKYÿ`D‘Qÿ‹XJÿI[’HKÿJ‹ŒH_H“ŒW[_ÿ[“JV‹ÿH”ÿ‹K[V”YŒHVL[HWŒ[‹J\ÿVHVL]QÿVHVL^ÿXJO[‹Œ‹ŒQÿŒÿ[
`JŽJKJÿXJ[_‹XÿOKH•_JIÿ[””JW‹ŒV“ÿYOÿ‹Hÿ–—ÿH”ÿ‹XJÿ˜HK_\ÿOHOY_[‹ŒHVEÿTŒVWJÿŒ‹ÿŒ\JV‹Œ”ŒW[‹ŒHVÿŒVÿ™š›šQÿJVHKIHYÿJ””HK‹ÿX[ŽJ
`•JJVÿI[\Jÿ‹HÿWX[K[W‹JKŒPJÿ‹XJÿŽŒK[_ÿWœW_JEÿ`H˜JŽJKQÿI[Vœÿ\J‹[Œ_ÿKJ“[K\ŒV“ÿ‹XJÿŽŒKYÿOJVJ‹K[‹ŒHVÿH”ÿXJO[‹HWœ‹JQÿŒ‹
`KJO_ŒW[‹ŒHVÿ[V\ÿ‹K[V_[‹ŒHVQÿ[V\ÿ‹XJÿ[JI•_ŒV“ÿH”ÿŽŒKŒHVÿKJI[ŒVÿYVžVH˜VQÿIH‹_œÿ•JW[YJÿH”ÿ[ÿ_[WžÿH”ÿ[VÿJ””ŒWŒJV‹ÿWY_‹YKJ
`œ‹JIEÿŸXŒÿX[ÿ[_HÿX[IOJKJ\ÿ‹XJÿ\JŽJ_HOIJV‹ÿH”ÿ”Y__œÿJ””JW‹ŒŽJÿ[V‹ŒŽŒK[_ÿ\KY“EÿDYKKJV‹ÿ‹KJ[‹IJV‹ÿ•[J\ÿHVÿ‹XJ
`WHI•ŒV[‹ŒHVÿH”ÿŒV‹JK”JKHVÿ[V\ÿKŒ•[ŽŒKŒVÿ‹KŒ““JKÿ[ÿY‹[ŒVJ\ÿŽŒKH_H“ŒW[_ÿKJOHVJÿŒVÿHV_œÿ ¡—ÿH”ÿŒV”JW‹J\ÿŒV\ŒŽŒ\Y[_Qÿ‹XY
`‹XJÿ\JŽJ_HOIJV‹ÿH”ÿ[_‹JKV[‹ŒŽJÿ‹XJK[OJY‹ŒWÿ‹K[‹J“ŒJÿŒÿ[ÿI[’HKÿKJJ[KWXÿ“H[_Eÿ¢YW_JŒWÿ[WŒ\ÿ•[J\ÿ‹XJK[OJY‹ŒWÿ[“JV‹ÿI[œ
`•JÿH”ÿHIJÿOH‹JV‹Œ[_ÿŒVÿXJO[‹Œ‹ŒÿDÿ‹KJ[‹IJV‹Eÿ£VÿKJWJV‹ÿœJ[KQÿIYWXÿJ””HK‹ÿX[ÿ“HVJÿŒV‹Hÿ‹XJÿŒIOKHŽJIJV‹ÿH”ÿ¤¢]ÿ[V\
`G¢]ÿIH_JWY_Jÿ[ÿOJWŒ”ŒWÿ“JVJÿŒ_JVWŒV“ÿ‹HH_EÿŸXŒÿKJŽŒJ˜ÿYII[KŒPJÿ‹XJÿ‹[‹JÿH”ÿ‹XJÿ[K‹ÿŒVÿ‹XJÿ\JŽJ_HOIJV‹ÿH”ÿVJ˜
``Dÿ‹XJK[OŒJQÿO[œŒV“ÿOJWŒ[_ÿ[‹‹JV‹ŒHVÿ‹Hÿ‹XHJÿŒVŽH_ŽŒV“ÿ[V‹ŒJVJÿH_Œ“HVYW_JH‹Œ\JQÿ[O‹[IJKQÿKŒ•HPœIJQÿ\JWHœÿ[V\
`ŒG¢]ÿŒVXŒ•Œ‹HKEÿŸXJÿŒ\JV‹Œ”ŒW[‹ŒHVÿH”ÿOH‹JV‹Œ[_ÿŽŒK[_ÿ‹[K“J‹ÿŒÿ[_Hÿ\ŒWYJ\E
`
`¥%¦§83529ÿ`DQÿXJO[‹Œ‹ŒÿDQÿ“JVJÿŒ_JVWŒV“QÿG¢]L•[J\ÿŒVXŒ•Œ‹HKQÿKŒ•HPœIJQÿ[V‹ŒJVJQÿ[O‹[IJKQÿŒG¢]E
`
`¨©C©:;4ÿª©;6«:©+
`
``JO[‹Œ‹ŒÿDÿŽŒKYÿ`D‘ÿŒV”JW‹ŒHVÿŒÿ[ÿI[’HKÿ“_H•[_
`XJ[_‹XÿOKH•_JIEÿ¬HKJÿ‹X[Vÿ–—ÿH”ÿ‹XJÿ˜HK_\ÿOHOY_[‹ŒHVÿŒ
`[””JW‹J\ÿ­`®ÿ\[‹[‘Qÿ[_‹XHY“Xÿ‹XJÿŒVWŒ\JVWJÿŽ[KŒJÿ”KHIÿHVJ
`KJ“ŒHVÿ‹Hÿ[VH‹XJKEÿ®VWJÿ‹XJÿŽŒKYÿX[ÿJV‹JKJ\ÿ‹XJÿ•H\œÿŒ‹
`ŒV”JW‹ÿ‹XJÿ_ŒŽJKÿWJ__ÿ[V\ÿ•J“ŒVÿ‹HÿKJO_ŒW[‹JEÿTHIJÿ™¯L°¯—
`H”ÿŒV”JW‹J\ÿŒV\ŒŽŒ\Y[_ÿ\JŽJ_HOÿJ””JW‹ŒŽJÿ•[KKŒJKÿ‹X[‹ÿ”ŒV[__œ
`KJH_ŽJÿ‹XJÿŒV”JW‹ŒHVQÿ•Y‹ÿ‹XJÿKJI[ŒV\JKÿY””JKÿ‹XJÿ_HV“L‹JKI
`KJO_ŒW[‹ŒHVÿH”ÿ‹XJÿŽŒKYÿ±™²EÿŸXJJÿO[‹ŒJV‹ÿYY[__œÿKJI[ŒV
`[œIO‹HI[‹ŒWÿ”HKÿœJ[Kÿ•J”HKJÿXH˜ŒV“ÿ”Œ•KHŒÿ‹X[‹ÿI[œQÿŒV
`HIJÿ–¡—ÿH”ÿ‹XJJÿW[JQÿ“K[\Y[__œÿOKH“KJÿ‹HÿWŒKKXHŒÿ[V\
`JŽJVÿXJO[‹HWJ__Y_[KÿW[KWŒVHI[Eÿ]‹ÿ‹XŒÿ‹[“JQÿ‹XJÿHV_œ
`‹KJ[‹IJV‹ÿOHŒ•_JÿŒÿ[ÿ_ŒŽJKÿ‹K[VO_[V‹³ÿŒV\JJ\QÿXJO[‹Œ‹ŒÿD
`O[‹ŒJV‹ÿ”Œ“YKJÿ‹KHV“_œÿHVÿ_ŒŽJKÿ‹K[VO_[V‹ÿ˜[Œ‹ŒV“ÿ_Œ‹ÿ±°²E
`
`DYKKJV‹ÿ‹XJK[OŒJQÿ•[J\ÿHVÿ‹XJÿWHI•ŒV[‹ŒHVÿH”ÿŒV‹JK”JKHV
`£R¢‘ÿ[V\ÿKŒ•[ŽŒKŒVQÿ[KJÿJ””JW‹ŒŽJÿŒVÿHV_œÿ ¡—ÿH”ÿO[‹ŒJV‹E
`ŸXJÿXŒ“XÿIY‹[‹ŒHVÿK[‹JÿH”ÿ‹XJÿ`Dÿ“JVHIJÿ[V\ÿ‹XJÿŽŒKY
`[•Œ_Œ‹œÿ‹HÿJW[OJÿ‹XJÿŒIIYVJÿœ‹JIÿ[KJÿO[K‹Œ[__œÿKJOHVŒ•_J
`”HKÿ‹XŒÿ”[Œ_YKJEÿŸXYÿ‹XJÿŒ\JV‹Œ”ŒW[‹ŒHVÿH”ÿVJ˜ÿ‹[K“J‹ÿ[V\ÿ‹XJ
`J[KWXÿ”HKÿ”Y__œÿJ””JW‹ŒŽJÿ[V‹ŒŽŒK[_ÿWHIOHYV\ÿ[KJÿI[’HK
`“H[_ÿH”ÿ`DÿKJJ[KWXE
`
``Dÿ•J_HV“ÿ‹Hÿ‹XJÿ´kymuf„fngdkdÿ”[IŒ_œÿR_[ŽŒŽŒKŒ\[J‘Q
`˜XŒWXÿŒVW_Y\JÿœJ__H˜ÿ”JŽJKÿŽŒKYÿ‹XJÿW_[ŒWÿ”_[ŽŒŽŒKY‘Q
`•HŽŒVJÿ\Œ[KKXJ[ÿŽŒKYÿ^¤Qÿ[ÿOJ‹ŒŽŒKY‘ÿ[V\ÿµ^ÿŽŒKYE
`ŸXJÿ`Dÿ“JVHIJÿXH˜ÿ“KJ[‹ÿŽ[KŒ[•Œ_Œ‹œÿ˜XŒWXÿ[__H˜ÿ‹XJ
`Œ\JV‹Œ”ŒW[‹ŒHVÿH”ÿŒ¶ÿ“JVH‹œOJÿ±–²ÿ\Œ””JKŒV“ÿ”KHIÿHVJÿH‹XJK
`•œÿYOÿ‹Hÿ–¡—ÿŒVÿ‹XJŒKÿVYW_JH‹Œ\JÿJZYJVWJÿKJŽŒJ˜J\ÿŒVÿ± ²‘E
`RYK‹XJKÿY•‹œOJÿ[V\ÿŒH_[‹JÿH”ÿ‹XJJÿ\Œ””JKJV‹ÿ“JVH‹œOJ
`
`a]\\KJÿWHKKJOHV\JVWJÿ‹Hÿ‹XŒÿ[Y‹XHKÿ[‹ÿ‹XJÿ£V‹Œ‹Y‹Hÿ\Jÿ·[K[Œ‹H_H“¸[ÿœ
`^ŒHIJ\ŒWŒV[ÿ¹MNOJPL¢JœK[ºÿDT£DQÿ·[KZYJÿŸJWVH_N“ŒWHÿ\JÿDŒJVWŒ[ÿ\Jÿ_[
`T[_Y\Qÿ]Ž\[Eÿ\J_ÿDHVHWŒIŒJV‹Hÿ»VQÿ]KIŒ__[ÿ™›™¡¡QÿµK[V[\[QÿTO[ŒV³ÿŸJ_¼
`½– ÿš¯›ÿ™›ÿ™¾ÿ ›³ÿR[¶¼ÿ½– ÿš¯›ÿ™›ÿ™¾ÿ–°³ÿ¿LI[Œ_¼ÿ[•JKP[_XÀŒO•EWŒWEJ
`
`Ž[KœŒV“ÿŒVÿ‹XJŒKÿŽŒKY_JVWJÿX[ŽJÿ[_Hÿ•JJVÿ\JWKŒ•J\EÿŒK[_
`“JVH‹œOJÿW_J[K_œÿ[””JW‹ÿ‹XJÿYWWJÿH”ÿŒV‹JK”JKHVÿ‹XJK[OœQ
`[_‹XHY“XÿVHÿW_J[KÿWHKKJ_[‹ŒHVÿ˜Œ‹XÿŽŒKY_JVWJÿJ¶Œ‹E
`
`£Vÿ[\\Œ‹ŒHVQÿ‹XJÿ`DÿOHOY_[‹ŒHVÿOKJJV‹ÿŒVÿ[VÿŒV”JW‹J\
`O[‹ŒJV‹ÿŒÿ‹KYW‹YKJ\ÿŒVÿ‹JKIÿH”ÿgmdfdykufkdEÿŸXŒÿ‹JKI
`\J”ŒVJÿ‹XJÿW_HJ_œÿKJ_[‹J\ÿJZYJVWJÿH”ÿ[ÿXJ‹JKH“JVJHY
`ŽŒK[_ÿOHOY_[‹ŒHVÿŒV”JW‹ŒV“ÿ[ÿŒV“_JÿŒV\ŒŽŒ\Y[_ÿ±¯²EÿµJVHIŒW
`JZYJVWJÿ\ŒŽJKŒ‹œÿŒÿI[ŒV_œÿ\YJÿ‹Hÿ‹XJÿXŒ“XÿŽŒK[_ÿKJO_ŒW[‹ŒHV
`K[‹Jÿ[V\ÿ‹XJÿIY‹[‹ŒHVÿŒV‹KH\YWJ\ÿ•œÿŽŒK[_ÿG¢]L\JOJV\JV‹
`G¢]ÿOH_œIJK[JÿG\GO‘ÿ\YKŒV“ÿ‹XJÿKJO_ŒW[‹ŒHVÿH”ÿ‹XJÿŽŒK[_
`“JVHIJÿ±¾QÿÁ²EÿÂY[ŒOJWŒJÿ‹KYW‹YKJÿX[ÿ•JJVÿ[HWŒ[‹J\
`˜Œ‹Xÿ‹XJÿ”[Œ_YKJÿH”ÿŒV”JW‹J\ÿOJHO_Jÿ‹HÿW_J[Kÿ‹XJÿŽŒKYÿ[V\ÿ‹XJ
`Y•JZYJV‹ÿ\JŽJ_HOIJV‹ÿH”ÿ[ÿWXKHVŒWÿŒV”JW‹ŒHVÿ±›²Eÿ£‹ÿX[
`•JJVÿKJOHK‹J\ÿ‹X[‹ÿ‹XJÿŽŒK[_ÿOHOY_[‹ŒHVÿŒV”JW‹ŒV“ÿŒIIYVHL
`YOOKJJ\ÿO[‹ŒJV‹ÿXH˜ÿ[ÿKJ\YWJ\ÿOKH•[•Œ_Œ‹œÿH”ÿIY‹[‹ŒHV
`WHIO[KJ\ÿ‹Hÿ‹X[‹ÿJJVÿŒVÿVHVLŒIIYVHWHIOKHIŒJ\
`ŒV\ŒŽŒ\Y[_ÿ±šL™™²Eÿ]ÿ‹KHV“ÿXH‹ÿŒIIYVJÿKJOHVJÿI[œ
`JVWHYK[“Jÿ‹XJÿ[OOJ[K[VWJÿH”ÿKJŒ‹[V‹ÿŽ[KŒ[V‹E
`
``DÿŽŒKŒHVÿX[ŽJÿ[ÿ\Œ[IJ‹JKÿH”ÿ¯¯L¾¯ÿVIÿ±™°²ÿ[V\ÿW[V
`•Jÿ\J‹JW‹J\ÿŒVÿO[‹ŒJV‹ÿJKYIÿJŒ‹XJKÿWHIO_J¶J\ÿ‹HÿŒIIYVHL
`“_H•Y_ŒVÿHKÿ_H˜ÿ\JVŒ‹œÿ_ŒOHOKH‹JŒVQÿHKÿ[ÿ”KJJÿŽŒK[_
`O[K‹ŒW_Jÿ±™–²EÿŸXJÿ“JVJ‹ŒWÿI[‹JKŒ[_ÿŒÿ•HYV\ÿ‹Hÿ‹XJÿWHKJ
`OKH‹JŒVQÿ”HKIŒV“ÿ[VÿŒWH[J\KŒWÿW[OŒ\EÿŸXŒÿŒÿŒVÿ‹YKVÿWHŽJKJ\
`•œÿ[ÿ_ŒOŒ\ÿJVŽJ_HOJEÿ]ÿXJ‹JKH\ŒIJKŒWÿWHIO_J¶ÿWHVŒ‹ŒV“ÿH”
`‹XJÿŽŒK[_ÿ“_œWHOKH‹JŒVÿ¿™ÿ[V\ÿ¿°Qÿ‹ŒWžÿHY‹ÿ‹XKHY“Xÿ‹XŒ
`JVŽJ_HOJÿ_ŒžJÿOŒžJÿ±™ ²E
`
`ŸXJÿ`Dÿ“JVHIJÿŒÿ[ÿš¾¡¡ÿVYW_JH‹Œ\JL_HV“QÿŒV“_J
`‹K[V\J\ÿOHŒ‹ŒŽJÿG¢]ÿIH_JWY_JÿRŒ“Eÿ‘³ÿ±™¯L™Á²‘Eÿ£‹
`WHV‹[ŒVÿ‹˜HÿXŒ“X_œÿWHVJKŽJ\ÿYV‹K[V_[‹[•_JÿKJ“ŒHVÿÃŸG‘
`”_[VžŒV“ÿ‹XJÿWH\ŒV“ÿJZYJVWJQÿ˜XŒWXÿO_[œÿ[VÿJJV‹Œ[_ÿKH_JÿŒV
`ŽŒK[_ÿ‹K[V_[‹ŒHVÿ[V\ÿKJO_ŒW[‹ŒHVÿ±™›L°™²EÿŸXJÿŽŒK[_ÿOKH‹JŒV
`[KJÿœV‹XJŒPJ\ÿ[ÿ[ÿŒV“_JÿOKJWYKHKÿ‹X[‹ÿŒÿ‹XJVÿWHLÿ[V\
`OH‹L‹K[V_[‹ŒHV[__œÿOKHWJJ\ÿ•œÿ•H‹XÿŽŒK[_ÿ[V\ÿWJ__Y_[K
`
`ÿÿÿ !"!
`
`#ÿÿ$%&'()*ÿ+,-%&,%ÿ./01-2(%32ÿ4'5!
`
`1
`
`GIL2020
`I-MAK, INC. V GILEAD PHARMASSET LLC
`IPR2018-00123
`
`

`

`122
`Infectious Disorders - Drug Targets 2006, Vol. 6, No. 2
` ÿÿÿÿ 
`
ÿ

`
ÿÿ ÿ
ÿ ÿ
`ÿÿ
`ÿ
`
`SUTR
`
`Berzal-Herranz et al.
`
` ÿÿ
`
`CRE
`
`3 UTR
`
`ft
`
`
`
`Protease
`
`formation
`
`RdRp
`
` Replication complex
`
`
`
`
`
`
`
`
`
`
`
`Envelope
`
`Protease/helicase
`Viral maturation
`
`Replication
`Resistance tolFN
`
`NS3 cofacior
`
`747 810
`
`«1027
`
`1658 1712
`
`1973
`
`2471
`
`3011
`
`Unknown
`function
`
`Fig. (1). Genetic organization and protein products of HCV. Above: the HCV genome, showing the 5’ and 3’ untranslated regions. The
`^_`aÿbcaÿd%0%$/-ÿ#"=&0/Z&$/#0ÿ&01ÿ!"#$%/0ÿ!"#1,-$'ÿ#EÿF3G(ÿBH#7%eÿ$+%ÿF3Gÿ=%0#J%5ÿ'+#I/0=ÿ$+%ÿDfÿ&01ÿ@fÿ,0$"&0'.&$%1ÿ"%=/#0'(ÿ*+%
`proposed secondary structure for the CRE domain (cis-response element) is also shown. IRES-dependenttranslation generates a 3011 amino
`!"#!#'%1ÿ'%-#01&"<ÿ'$",-$,"%ÿE#"ÿ$+%ÿ3N8ÿ1#J&/0ÿ2ghi;"%'!#0'%ÿ%.%J%0$4ÿ/'ÿ&.'#ÿ'+#I0(ÿSN8?;1%!%01%0$ÿ$"&0'.&$/#0ÿ=%0%"&$%'ÿ&ÿ@j99ÿ&J/0#
`acid-long polyprotein product (below) which is subsequently processed into structural and non-structural proteins. The proteolysis products
`&-/1;.#0=ÿ!#.<!"#$%/0ÿ!"#1,-$ÿ2H%.#I4ÿI+/-+ÿ/'ÿ',H'%k,%0$.<ÿ!"#-%''%1ÿ/0$#ÿ'$",-$,"&.ÿ&01ÿ0#0;'$",-$,"&.ÿ!"#$%/0'(ÿ*+%ÿ!"#$%#.<'/'ÿ!"#1,-$'
`andtheir functionsare indicated.
`&01ÿ$+%/"ÿE,0-$/#0'ÿ&"%ÿ/01/-&$%1(
`
`proteases. The structural proteins include the capsid protein
`!"#$%&'%'(ÿ*+%ÿ'$",-$,"&.ÿ!"#$%/0'ÿ/0-.,1%ÿ$+%ÿ-&!'/1ÿ!"#$%/0
`(C), p7 and the envelope proteins El and E2. The non-
`2345ÿ!6ÿ&01ÿ$+%ÿ%07%.#!%ÿ!"#$%/0'ÿ89ÿ&01ÿ8:(ÿ*+%ÿ0#0;
`structural products are involved in polyprotein processing
`'$",-$,"&.ÿ!"#1,-$'ÿ&"%ÿ/07#.7%1ÿ/0ÿ!#.<!"#$%/0ÿ!"#-%''/0=
`(NS2, NS3, NS4A) and replication (NS4B, NS5SA and
`2>?:5ÿ>?@5ÿ>?AB4ÿ&01ÿ"%!./-&$/#0ÿ2>?AC5ÿ>?DBÿ&01
`NS5B).
`>?DC4(
`
`The success of HCV infection is conditioned by how well
`*+%ÿ',--%''ÿ#EÿF3Gÿ/0E%-$/#0ÿ/'ÿ-#01/$/#0%1ÿH<ÿ+#IÿI%..
`the virus avoids the immune host response. The initial
`$+%ÿ7/",'ÿ&7#/1'ÿ$+%ÿ/JJ,0%ÿ+#'$ÿ"%'!#0'%(ÿ*+%ÿ/0/$/&.
`defense reaction depends on the viral pathogen-associated
`1%E%0'%ÿ"%&-$/#0ÿ1%!%01'ÿ#0ÿ$+%ÿ7/"&.ÿ!&$+#=%0;&''#-/&$%1
`molecular pattern (PAMP). For HCV, the PAMP includes
`J#.%-,.&"ÿ!&$$%"0ÿ2KBLK4(ÿM#"ÿF3G5ÿ$+%ÿKBLKÿ/0-.,1%'
`the genomic RNA, the NS5A protein, the core protein, and
`$+%ÿ=%0#J/-ÿN>B5ÿ$+%ÿ>?DBÿ!"#$%/05ÿ$+%ÿ-#"%ÿ!"#$%/05ÿ&01
`even entire viral particles, all of which can be presented by
`%7%0ÿ%0$/"%ÿ7/"&.ÿ!&"$/-.%'5ÿ&..ÿ#EÿI+/-+ÿ-&0ÿH%ÿ!"%'%0$%1ÿH<
`dendritic cells (for a review, see [22]). PAMP presentation
`1%01"/$/-ÿ-%..'ÿ2E#"ÿ&ÿ"%7/%I5ÿ'%%ÿO::P4(ÿKBLKÿ!"%'%0$&$/#0
`initiates the production of interferon and cytokines [23] in an
`/0/$/&$%'ÿ$+%ÿ!"#1,-$/#0ÿ#Eÿ/0$%"E%"#0ÿ&01ÿ-<$#Q/0%'ÿO:@Pÿ/0ÿ&0
`autoregulatory fashion ([24]; reviewed in [22]). It has been
`&,$#"%=,.&$#"<ÿE&'+/#0ÿ2O:APRÿ"%7/%I%1ÿ/0ÿO::P4(ÿS$ÿ+&'ÿH%%0
`teported that the NS3/4A protein acts as an antagonist of
`"%!#"$%1ÿ$+&$ÿ$+%ÿ>?@TABÿ!"#$%/0ÿ&-$'ÿ&'ÿ&0ÿ&0$&=#0/'$ÿ#E
`certain key factors in the induction of the immuneresponse.
`-%"$&/0ÿQ%<ÿE&-$#"'ÿ/0ÿ$+%ÿ/01,-$/#0ÿ#Eÿ$+%ÿ/JJ,0%ÿ"%'!#0'%(
`This mainly involves a reduction in IFN production, thus
`*+/'ÿJ&/0.<ÿ/07#.7%'ÿ&ÿ"%1,-$/#0ÿ/0ÿSM>ÿ!"#1,-$/#05ÿ$+,'
`inducing alterations in the pathways and complexes whose
`/01,-/0=ÿ&.$%"&$/#0'ÿ/0ÿ$+%ÿ!&$+I&<'ÿ&01ÿ-#J!.%U%'ÿI+#'%
`functioning is dependent on it. For example, antigen
`E,0-$/#0/0=ÿ/'ÿ1%!%01%0$ÿ#0ÿ/$(ÿM#"ÿ%U&J!.%5ÿ&0$/=%0
`presentation is greatly reduced, meaning T cells cannot be
`!"%'%0$&$/#0ÿ/'ÿ="%&$.<ÿ"%1,-%15ÿJ%&0/0=ÿ*ÿ-%..'ÿ-&00#$ÿH%
`stimulated. NS3/4A has also been related to a prolonged
`'$/J,.&$%1(ÿ>?@TABÿ+&'ÿ&.'#ÿH%%0ÿ"%.&$%1ÿ$#ÿ&ÿ!"#.#0=%1
`blocking of pro-apoptotic factor activity, providing a
`H.#-Q/0=ÿ#Eÿ!"#;&!#!$#$/-ÿE&-$#"ÿ&-$/7/$<5ÿ!"#7/1/0=ÿ&
`molecular link between HCV infection and the development
`J#.%-,.&"ÿ./0QÿH%$I%%0ÿF3Gÿ/0E%-$/#0ÿ&01ÿ$+%ÿ1%7%.#!J%0$
`
`of hepatocellular carcinoma [25]. Similarly,
`the NSS5A
`#Eÿ+%!&$#-%..,.&"ÿ-&"-/0#J&ÿO:DP(ÿ?/J/.&".<5ÿ$+%ÿ>?DB
`protein may activate IL-8 production, which interferes with
`!"#$%/0ÿJ&<ÿ&-$/7&$%ÿSV;Wÿ!"#1,-$/#05ÿI+/-+ÿ/0$%"E%"%'ÿI/$+
`IFN-mediated response pathways, and in conjunction with
`SM>;J%1/&$%1ÿ"%'!#0'%ÿ!&$+I&<'5ÿ&01ÿ/0ÿ-#0X,0-$/#0ÿI/$+
`E2 it may block protein kinase R (PKR), an enzymeinvolved
`8:ÿ/$ÿJ&<ÿH.#-Qÿ!"#$%/0ÿQ/0&'%ÿNÿ2KYN45ÿ&0ÿ%0Z<J%ÿ/07#.7%1
`in the amplification of the immuneresponse. The intensity of
`/0ÿ$+%ÿ&J!./E/-&$/#0ÿ#Eÿ$+%ÿ/JJ,0%ÿ"%'!#0'%(ÿ*+%ÿ/0$%0'/$<ÿ#E
`these effects differs depending on the genetic diversity of the
`$+%'%ÿ%EE%-$'ÿ1/EE%"'ÿ1%!%01/0=ÿ#0ÿ$+%ÿ=%0%$/-ÿ1/7%"'/$<ÿ#Eÿ$+%
`infecting viral pool. Finally, HCV genotypes 1a and 1b have
`/0E%-$/0=ÿ7/"&.ÿ!##.(ÿM/0&..<5ÿF3Gÿ=%0#$<!%'ÿ9&ÿ&01ÿ9Hÿ+&7%
`a smaller number of UU and AUsites than genotypes2 or3,
`&ÿ'J&..%"ÿ0,JH%"ÿ#Eÿ[[ÿ&01ÿB[ÿ'/$%'ÿ$+&0ÿ=%0#$<!%'ÿ:ÿ#"ÿ@5
`impeding RNase L-mediated degradation of the HCV
`/J!%1/0=ÿN>&'%ÿV;J%1/&$%1ÿ1%="&1&$/#0ÿ#Eÿ$+%ÿF3G
`genome(this enzyme specifically cleaves nucleic acids at
`=%0#J%ÿ2$+/'ÿ%0Z<J%ÿ'!%-/E/-&..<ÿ-.%&7%'ÿ0,-.%/-ÿ&-/1'ÿ&$
`these sites;
`[26]). This provides another possibility for
`$+%'%ÿ'/$%'RÿO:\P4(ÿ*+/'ÿ!"#7/1%'ÿ&0#$+%"ÿ!#''/H/./$<ÿE#"
`variation in terms of resistance to IFN since RNase L is
`7&"/&$/#0ÿ/0ÿ$%"J'ÿ#Eÿ"%'/'$&0-%ÿ$#ÿSM>ÿ'/0-%ÿN>&'%ÿVÿ/'
`activated by this molecule.
`&-$/7&$%1ÿH<ÿ$+/'ÿJ#.%-,.%(
`
`The identification of HCV in 1989 by Houghton and co-
`*+%ÿ/1%0$/E/-&$/#0ÿ#EÿF3Gÿ/0ÿ9]W]ÿH<ÿF#,=+$#0ÿ&01ÿ-#;
`workers [15] led to numerous studies aimed at deciphering
`I#"Q%"'ÿO9DPÿ.%1ÿ$#ÿ0,J%"#,'ÿ'$,1/%'ÿ&/J%1ÿ&$ÿ1%-/!+%"/0=
`its molecular biology, but advances in our knowledge
`/$'ÿJ#.%-,.&"ÿH/#.#=<5ÿH,$ÿ&17&0-%'ÿ/0ÿ#,"ÿQ0#I.%1=%
`tegarding the viral cycle have been hindered by the lack of
`"%=&"1/0=ÿ$+%ÿ7/"&.ÿ-<-.%ÿ+&7%ÿH%%0ÿ+/01%"%1ÿH<ÿ$+%ÿ.&-Qÿ#E
`an efficient and stable culture system. However, recent
`&0ÿ%EE/-/%0$ÿ&01ÿ'$&H.%ÿ-,.$,"%ÿ'<'$%J(ÿF#I%7%"5ÿ"%-%0$
`advances in replicon and pseudoparticle production methods
`&17&0-%'ÿ/0ÿ"%!./-#0ÿ&01ÿ!'%,1#!&"$/-.%ÿ!"#1,-$/#0ÿJ%$+#1'
`[27, 28] have allowed a more detailed understanding of HCV
`O:65ÿ:WPÿ+&7%ÿ&..#I%1ÿ&ÿJ#"%ÿ1%$&/.%1ÿ,01%"'$&01/0=ÿ#EÿF3G
`spread and replication to be grasped. In addition, the latest
`'!"%&1ÿ&01ÿ"%!./-&$/#0ÿ$#ÿH%ÿ="&'!%1(ÿS0ÿ&11/$/#05ÿ$+%ÿ.&$%'$
`virion production strategies provide the starting point for the
`7/"/#0ÿ!"#1,-$/#0ÿ'$"&$%=/%'ÿ!"#7/1%ÿ$+%ÿ'$&"$/0=ÿ!#/0$ÿE#"ÿ$+%
`
`2
`
`

`

`  ÿ  ÿ
`
` 
`
`
 
`ÿ
` ÿÿ ÿ  ÿÿ
` ÿÿ
`ÿÿÿÿÿ
`
` !"#$%"&!ÿ%!ÿ (%)*%"&!ÿ&#ÿ! +ÿ(,%)ÿ"%,- ".ÿ%!ÿ"/
` ( )&01 !"ÿ&#ÿ!&( )ÿ%!"(,%)ÿ,*-.ÿ23456789
`
`:/.ÿ, ( +ÿ.$*.. .ÿ"/ ÿ1%!ÿ# %"*, .ÿ%!ÿ#*!$"&!.ÿ&#
`"/ ÿ;<=ÿ"%,- ".ÿ"/%"ÿ%, ÿ> !-ÿ ?0)&, @ÿ%!ÿ"/ ÿ"/ ,%0 *"$
`%- !".ÿ0, . !")Aÿ!ÿ*. 9ÿB +ÿ", %"1 !".ÿ>%. ÿ&!ÿ"/ ÿ*. ÿ&#
`!*$) $ÿ%$.@ÿ0&" !"%))Aÿ( ,Aÿ0&+ ,#*)ÿ%!"5;<=ÿ%- !".@ÿ%,
`.$*.. 9
`
`CDEFGÿIFEJKIL
`
`:/ ÿ/-/ÿ1*"%"&!ÿ,%" ÿ&#ÿ"/ ÿ;<=ÿ- !&1 ÿ.ÿ%ÿM A
` " ,1!%!"ÿ!ÿ"/ ÿ%00 %,%!$ ÿ&#ÿ(%,%!".ÿ, .."%!"ÿ"&ÿ1%!A
`&#ÿ"/ ÿ%!"(,%)ÿ$&10&*!.ÿ" ." ÿ"&ÿ%" 9ÿN( ,ÿ, $ !"ÿA %,.@
`1*$/ÿ ##&,"ÿ/%.ÿ> !ÿ.0 !"ÿ&!ÿ"/ ÿ !"#$%"&!ÿ&#ÿ! +
`"/ ,%0 *"$ÿ"%,- ".ÿ%!ÿ"/ ÿ ( )&01 !"ÿ&#ÿ ## $"( ÿ%!"5
`;<=ÿ,*-.Oÿ:/ ÿ1&."ÿ$&11&!ÿ,*-ÿ"%,- ".ÿ*! ,ÿ."*Aÿ%,
`"/ ÿPQÿ%!ÿ6Qÿ*!",%!.)%" ÿ, -&!.ÿRPQS:T@ÿ6QS:TUÿ%!ÿ"/
`BV6ÿ%!ÿBVPWÿ0,&" !.Xÿ"/ . ÿ%, ÿ10&,"%!"ÿ!ÿ"/ ÿ(,%)
`$A$) ÿ%!ÿ"/ ,ÿ$&!. ,(%"&!ÿ,%" .ÿ%, ÿ/-/9ÿ:/.ÿ. $"&!
`.*11%,Y .ÿ"/ ÿ1%!ÿ# %"*, .ÿ%!ÿ,&) .ÿ&#ÿ"/ . ÿ ) 1 !".ÿ!
`"/ ÿ(,%)ÿ$A$) 9
`
`IZKÿ[\ÿ]^IEF^LGFIK_ÿEKJD`^
`
`:/.ÿ.ÿ"/ ÿ1&."ÿ$&11&!)Aÿ$/&. !ÿ"%,- "ÿ#&,ÿ"/ ÿ .-!
`&#ÿ;<=ÿ!/>"&,.ÿ>%. ÿ&!ÿ(,%)ÿ!*$) $ÿ%$ÿ$/ 1.",AO
`:/.ÿ6a7ÿ!"5)&!-ÿ, -&!ÿ.ÿ&! ÿ&#ÿ"/ ÿ1&."ÿ$&!. ,( ÿ&#ÿ"/
` !", ÿ;<=ÿ- !&1 bÿ. c* !$ ÿ !""Aÿ.ÿ ."1%" ÿ%"ÿ%,&*!
`dPeÿ#&,ÿ%))ÿ(,%)ÿ.&)%" .ÿ263@ÿ6689ÿf&1%!.ÿ .. !"%)ÿ#&,ÿ"/
`!"%"&!ÿ&#ÿ(,%)ÿ, 0)$%"&!ÿ23g8ÿ%!ÿ",%!.)%"&!ÿ27d@ÿ748
`/%( ÿ> !ÿ !"# ÿ+"/!ÿ"/ ÿPQÿS:T9ÿ:/ ÿ.A!"/ ..ÿ&#ÿ"/
`;<=ÿ0&)A0,&" !ÿ.ÿ1 %" ÿ>Aÿ%!ÿ!" ,!%)ÿ,>&.&1 ÿ !",A
`." ÿ&1%!ÿRhTiVXÿ#,&1ÿ!"ÿagÿ"&ÿ6jgUÿ!ÿ%ÿ$%05! 0 ! !"
`1%!! ,ÿRk-9ÿRUXÿ26a8U9ÿ:/*.@ÿ"/ ÿPQÿ. c* !$ ÿ$&!-ÿ#&,ÿ"/
`$%0.ÿ0,&" !ÿ0%,"$0%" .ÿ!ÿ"/ ÿ!"%"&!ÿ&#ÿ",%!.)%"&!ÿ%!
`1%Aÿ1&*)%" ÿ"/ ÿ ##$ !$Aÿ&#ÿ"/.ÿhTiVÿ26P89ÿl&, &( ,@ÿ"
`/%.ÿ, $ !")Aÿ> !ÿ, 0&," ÿ"/%"ÿ"/ ÿB5" ,1!%)ÿ$&, ÿ&1%!
`1-/"ÿ!" ,%$"ÿ+"/ÿ"/ ÿPQS:Tÿ, -&!ÿ%!ÿ, -*)%" ÿ(,%)
`",%!.)%"&!ÿ26m@ÿ6j89
`
`:/ ÿ. $&!%,Aÿ.",*$"*, ÿ&#ÿ"/ ÿPQS:Tÿ, -&!ÿ+%.
`&,-!%))Aÿ0,&0&. ÿ>Aÿn 1&!ÿ%!ÿ$&5+&,M ,.ÿ26d89ÿ;&+5
` ( ,@ÿ#*,"/ ,ÿ.",*$"*,%)ÿ%!ÿ#*!$"&!%)ÿ%!%)A. .ÿ0,&10" ÿ".
`,  #!"&!ÿ"&ÿ!$)* ÿ. ( ,%)ÿ! +ÿ1&"#.ÿ%!ÿ!" ,%$"&!.9
`:/ ÿ1&."ÿ$&11&!)Aÿ%$$ 0" ÿ$&!#&,1%"&!ÿ.ÿ./&+!ÿ!ÿk-9
`RU9ÿ:/ ÿPQS:Tÿ, -&!ÿ.ÿ#&) ÿ!"&ÿ. ( ,%)ÿ." 15)&&0
`1&"#.ÿ"/%"ÿ #! ÿ## , !"ÿ#*!$"&!%)ÿ&1%!.9ÿ:/
` ."%>)./1 !"ÿ&#ÿ" ,"%,Aÿ!" ,%$"&!.ÿ%1&!-ÿ"/ 1ÿ/%.ÿ> !
` .$,> 9ÿh".ÿ1%!" !%!$ ÿ.ÿ$,"$%)ÿ#&,ÿhTiVÿ%$"("Aÿ26489
`
`5ÿopqrstÿvÿ&#ÿ"/ ÿPQS:Tÿ, -&!ÿ.ÿ$,*$%)ÿ#&,ÿ"/ ÿ, 0)$%"&!
`&#ÿ"/ ÿ;<=ÿ- !&1 ÿ23g89ÿh"ÿ1&*)%" .ÿ(,%)ÿ0&)A0,&" !
`",%!.)%"&!ÿ>*"ÿ"ÿ.ÿ!&"ÿ .. !"%)ÿ#&,ÿhTiV51 %" ÿ#*!$"&!.
`2ag@ÿa789
`
`5ÿwxyÿzst{y|ÿ|y}sptÿ~y€yytÿpqrst‚ÿvÿrtÿvvÿ%00 %,.ÿ"&ÿ>
`%!ÿ*!.",*$"*, @ÿ.!-) 5.",%! ÿ. c* !$ @ÿ>*"ÿ!ÿ#%$"ÿ"ÿ"%M .
`0%,"ÿ!ÿ)&!-5,%!- ÿTBƒ5TBƒÿ!" ,%$"&!.ÿ!(&)(!-ÿ"/
`!*$) &" .ÿ%"ÿ0&."&!.ÿ„a635„a6dÿ2a389ÿ:/ ÿ, .*)"!-ÿ*0) ?
`#%(&,.ÿ"/ ÿ$, %"&!ÿ&#ÿ%ÿ)%,- ÿ)&&05)M ÿ.",*$"*, ÿ!ÿ+/$/ÿ"/
`hTiVÿ, -&!ÿ.ÿ !$)&. 9ÿh".ÿ#&,1%"&!ÿ1-/"@ÿ!ÿ.&1 ÿ+%A@
`1&*)%" ÿhTiV5 0 ! !"ÿ0,&" !ÿ.A!"/ ..9ÿ:/.ÿ.ÿ!ÿ-&&
`%-, 1 !"ÿ+"/ÿ0, (&*.ÿ, 0&,".ÿ .$,>!-ÿ"/%"ÿ1*"%"&!.ÿ%"
`"/.ÿ) ( )ÿ%## $"ÿhTiV5 0 ! !"ÿ0,&" !ÿ.A!"/ ..ÿ2a689
`
`5ÿopqrstÿvvÿ&#ÿ"/ ÿPQS:Tÿ, -&!ÿ$&!..".ÿ&#ÿ"+&ÿ/ )$%)
`. -1 !".ÿ. 0%,%" ÿ>Aÿ%ÿ/-/)Aÿ$&!. ,( ÿ!" ,!%)ÿ)&&0ÿ2aa@
`aP8ÿ"/&*-/"ÿ"&ÿ0%,"$0%" ÿ!ÿ)&!-5,%!- ÿ!" ,%$"&!.ÿ+"/
`&"/ ,ÿ(,%)ÿTBƒÿ&1%!.ÿ26489ÿ:/.ÿ)&&0ÿ1%Aÿ%).&ÿ0,&( ÿ%
`." ÿ#&,ÿ"/ ÿ%..&$%"&!ÿ&#ÿ",%!.)%"&!ÿ!"%"&!ÿ#%$"&,.ÿ2am@
`aj89ÿ:/ ÿ!*$) &" .ÿ&#ÿ"/ ÿ%0$%)ÿ)&&0ÿ&#ÿ&1%!ÿhhÿ #!
`%!ÿ .. !"%)ÿ)&$%"&!ÿ+/ , ÿ0,&" !ÿ%!ÿTBƒÿ)-%!.ÿ$%!
`%""%$/ÿ264@ÿad5Pg89
`
`5ÿopqrstÿvvvÿ&#ÿ"/ ÿPQS:Tÿ, -&!ÿ.ÿ"/ ÿ%!$/&,%- ÿ." ÿ#&,
`"/ ÿ hk6ÿ#%$"&,ÿ%!ÿ"/ ÿagVÿ,>&.&1%)ÿ.*>*!"ÿ2Pg@ÿP789ÿh"ÿ.
`$&10&. ÿ&#ÿ. ( ,%)ÿ.*>&1%!.ÿ"/%"ÿ#&)ÿ!"&ÿ." 15)&&0
`.",*$"*, .ÿ%>) ÿ"&ÿ!" ,%$"ÿ+"/ÿ&"/ ,ÿ&1%!.ÿ&#ÿ"/ ÿhTiV
`26489ÿ:/ ÿhhh%>$ÿ.*>&1%!ÿ$&!..".ÿ&#ÿ"/, ÿ." 15)&&0
` ) 1 !".ÿ"/%"ÿ#&,1ÿ%ÿ#&*,5+%Aÿ…*!$"&!ÿ!(&)( ÿ!ÿ>!!-
`+"/ÿ"/ ÿagVÿ,>&.&1%)ÿ.*>*!"9ÿ:/.ÿ.ÿ!  ÿ#&,ÿ hk6
`#%$"&,ÿ, $,*"1 !"ÿ2P789ÿ:/ ÿ.*>&1%!.ÿhhhÿ%!ÿhhh ÿ#&,1
`"/ ÿ1%!ÿ%!$/&,!-ÿ." .ÿ#&,ÿ"/ ÿagVÿ,>&.&1%)ÿ.*>*!"ÿ2P75
`P689ÿW $%*. ÿ&#ÿ"/ ,ÿ10&,"%!$ ÿ!ÿhTiV5 0 ! !"
`",%!.)%"&!@ÿ"/ Aÿ/%( ÿ> !ÿ"/ ÿ.*>… $"ÿ&#ÿ1*$/ÿ, . %,$/ÿ%!
`%, ÿ$&!. , ÿ ?$ )) !"ÿ$%!%" .ÿ#&,ÿ;<=ÿ"%,- "!-9ÿBlT
`."* .ÿ/%( ÿ, ( %) ÿ"/ ÿ"/, ÿ1 !.&!%)ÿ.",*$"*, ÿ&#
`.*>&1%!.ÿhhhÿ%!ÿhhh @ÿ$)%,#A!-ÿ"/ ,ÿ$,"$%)ÿ,&) ÿ!
`hTiVÿ$&!#&,1%"&!ÿ%!ÿ"/ ÿ1%!" !%!$ ÿ&#ÿ".ÿ>&)&-$%)
`#*!$"&!ÿ2P6@ÿPa89ÿV*>&1%!ÿhhhÿ%&0".ÿ%ÿ." 15)&&0
`.",*$"*, ÿ!" ,,*0" ÿ>Aÿ%!ÿ!" ,!%)ÿi5)&&0ÿ$)&. ÿ>Aÿ%ÿ/-/)A
`$&!. ,( ÿ%0$%)ÿ)&&0ÿ+/$/ÿ#&).ÿ!"&ÿ%ÿS5"*,!ÿ.",*$"*, 9
`:/.ÿ ?0&. .ÿ"/ ÿ!*$) &" .ÿ%!ÿ#%(&,.ÿ"/ ,ÿ!" ,%$"&!ÿ+"/
`&"/ ,ÿ(,%)ÿ. c* !$ .ÿ%!ÿ0,&" !.9ÿ:/ ÿ.*>&1%!ÿhhh
`$&!"%!.ÿ%ÿ/-/)Aÿ$&!. ,( ÿ„ƒSƒÿ" ",%)&&0ÿ%..&$%" ÿ+"/
`%!ÿ ##$ !"ÿ(,%)ÿ0&)A0,&" !ÿ.A!"/ ..ÿ2P689ÿƒ!ÿ10&,"%!"
`# %"*, ÿ&#ÿ&1%!ÿhhhÿ.ÿ"/ ÿ#&,1%"&!ÿ&#ÿ%ÿ$&!. ,( 
`0. *&M!&"ÿ.",*$"*, ÿ!(&)(!-ÿ.*>&1%!ÿhhh#ÿ%!ÿ%
`0A,1! 5,$/ÿ, -&!ÿR0&."&!.ÿ63P566gXÿ2PP8U9ÿ:/.
`0. *&M!&"ÿ/%.ÿ> !ÿ0,&0&. ÿ"&ÿ!" ,%$"ÿ, $")Aÿ+"/ÿ"/
`agVÿ,>&.&1%)ÿ.*>*!"ÿ2Pg@ÿP789ÿh"ÿ.ÿ%).&ÿ0, . !"ÿ!ÿ, )%" 
`(,*. .ÿ%!ÿ/%.ÿ> !ÿ%..&$%" ÿ+"/ÿ"/ ÿ, -*)%"&!ÿ&#
`",%!.)%"&!ÿ!"%"&!ÿ2PP@ÿPm89
`
`5ÿopqrstÿv†ÿ&#ÿ"/ ÿPQS:Tÿ, -&!ÿ$&!"%!.ÿ"/ ÿƒS„
`!"%"&!ÿ$&&!ÿ%"ÿ!*$) &" ÿ6a3ÿ"/%"ÿ.ÿ!$)* ÿ!ÿ%!
`%0$%)ÿ)&&0ÿ !$)&.!-ÿ%ÿ/ )$%)ÿ1&"#@ÿ"/ ÿ."%>)"Aÿ&#ÿ+/$/ÿ.
`!( ,. )Aÿ, )%" ÿ"&ÿhTiVÿ",%!.)%"&!%)ÿ ##$ !$Aÿ2Pj89
`
`ƒ.ÿ1 !"&! ÿ%>&( @ÿ"/ ÿ1%!" !%!$ ÿ&#ÿ"/ ÿhTiV
`. $&!%,Aÿ%!ÿ" ,"%,Aÿ.",*$"*, ÿ.ÿ$,"$%)ÿ!ÿhTiV5 0 ! !"
`",%!.)%"&!9ÿ:/ ÿ## , !"ÿ&1%!.ÿ1%Aÿ> /%( ÿ%.ÿ!"%"&!
`#%$"&,.ÿ%>) ÿ"&ÿ$%0"*, ÿ0,&" !.ÿ! $ ..%,Aÿ#&,ÿ"/ ÿ.A!"/ ..ÿ&#
`"/ ÿ(,%)ÿ0, $*,.&,ÿ0&)A0,&" !9ÿ:/ ÿPQS:Tÿ, -&!ÿ, $,*".
` hk6ÿ%!ÿ"/ ÿagVÿ,>&.&1%)ÿ.*>*!"ÿ"&ÿ#&,1ÿ%ÿ,>&5
`!*$) &0,&" !ÿ$&10) ?ÿ"/%"ÿ*!) %./ .ÿ"/ ÿ#&,1%"&!ÿ&#ÿ%$"(
`dgVÿ,>&.&1%)ÿ.A." 1.@ÿ%!ÿ"/ , #&, ÿ0,&1&" .ÿ0&)A0,&" !
`",%!.)%"&!ÿ2Pg@ÿPd89
`
`:/ ÿ .. !"%)ÿ,&) ÿ&#ÿ"/.ÿ, -&!ÿ!ÿ"/ ÿ(,%)ÿ$A$) ÿ%!ÿ".
`/-/ÿ$&!. ,(%"&!ÿ,%" ÿ1%M ÿ"ÿ%ÿ( ,Aÿ%"",%$"( ÿ"/ ,%0 *"$
`"%,- "9
`
`IZKÿ\ÿ]^IEF^LGFIK_ÿEKJD`^
`
`:/.ÿ, -&!ÿ.ÿ%ÿ3gg53agÿ!"5)&!-ÿ. c* !$ ÿ)&$%" ÿ%"ÿ"/
`6Qÿ !ÿ&#ÿ"/ ÿ;<=ÿTBƒÿ- !&1 9ÿh".ÿ. $&!%,Aÿ.",*$"*, ÿ.
`1%!"%! ÿ%$,&..ÿ## , !"ÿ(,%)ÿ.&)%" .ÿRk-9ÿRUXÿ2P48U9
`l*"%"&!%)ÿ%!%)A..ÿ/%.ÿ> !ÿ*. ÿ"&ÿ $0/ ,ÿ"/ ÿ>&)&-$%)
`,&) ÿ&#ÿ"/ ÿ6QÿS:Tÿ2mg89ÿi!YA1%"$ÿ%!ÿ$/ 1$%)ÿ%!%)A. .
`
`3
`
`

`

`124
`Infectious Disorders - Drug Targets 2006, Vol. 6, No. 2
` ÿÿÿÿ
`
ÿ
`  ÿÿ
ÿ ÿ ÿ ÿÿ ÿ
`
`Berzal-Herranz et al.
`
` ! ÿ ÿ
`
`c
`
`™,
`
`cA
`UA
`GC
`Gc
`esi
`G6
`GcA
`A
`wv
`ac
`1g0-GC
`A Un 220
`cG
`CG
`GA
`UG
`UA
`
`G
`
`i
`
`AU
`la
`|gsueeee
`eC
`we
`;
`Avr
`a.
`SGG"G an,
`A
`ccec-u
`
`Gc
`GC=%0
`g8
`Ot,
`UA
`CG
`UA
`GC
`ge
`GC
`UA
`
`G
`U
`G
`c
`
`c
`U
`60 -G
`U
`<
`“
`Me
`
`elF3
`
`405
`Ribosomal
`subunit
`
`
`
`Il
`c
`c*c
`A
`ao-—U.
`
`A
`U
`ome
`UG
`Gc
`cG
`
`et
`“ "e
`G
`oA
`AU
`CG
`GA
`
`CG
`yu
`
`u
`
`Cc
`
`A
`
`U
`
`Cd
`noo
`AG |
`6cca
`vaGuGlYg
`CGGA A AGCGC,|<G
`Ay G
`C280
`ee
`140 —A UGU
`St
`ca
`cc
`cG
`GU
`Gc
`Gc’
`US 120
`I -
`AU
`eG |
`. Ife
`5’ GCCA GACACUCCACCAUGAAUCACUCC
`ACCCCCCCUCCCGGG
`cccUS,
`GGAGGGCCC,,
`GCN.
`.U
`UGG.
`ke?
`40
`ce
`|GA
`CG
`uy 300
`cg
`i llr
`uu
`Gg
`—
`
`
`
`Fig. (2). Proposed secondary structure of the 5°UTR domain of HCV. Domains involved in the interaction with eIF3 factor and ribosomal
`"#$%ÿ& '%ÿ()*+*,-.ÿ,-0*1.2)3ÿ,4)5045)-ÿ*6ÿ47-ÿ89:;<ÿ.*=2>1ÿ*6ÿ?@ABÿC*=2>1,ÿ>1D*ED-.ÿ>1ÿ47-ÿ>14-)204>*1ÿF>47ÿ-GHIÿ6204*)ÿ21.ÿ)>J*,*=2E
`subunit 40S are marked in boxes. The translation start codon is shown in bold.
`,5J51>4ÿKLMÿ2)-ÿ=2)N-.ÿ>1ÿJ*O-,Bÿ;7-ÿ4)21,E24>*1ÿ,42)4ÿ0*.*1ÿ>,ÿ,7*F1ÿ>1ÿJ*E.B
`
`4
`
`

`

`  ÿ  ÿ
`
` 
`
`
 
`ÿ
` ÿÿ ÿ  ÿÿ
` ÿÿ
`ÿÿÿÿÿ
`
`
`
` !ÿ#$%!ÿ&'()*')(+,ÿ./01,ÿ2(/2/310ÿ4/(ÿ'51ÿ678ÿ9:;<=ÿ31>.1?'@ÿ<51ÿ0A441(1?'ÿ0/.+A?3ÿ/4ÿ'51ÿ1?'A(1ÿ31*/?0+(Bÿ3'()*')(1ÿ+(1ÿA?0A*+'10@
`
`5+C1ÿA01?'A4A10ÿ'5(11ÿ0A441(1?'ÿ0/.+A?3Dÿ'51ÿ8=ÿ(1>A/?Eÿ'51
`2/,B;F7ÿ'(+*'ÿ+?0ÿ9:Gÿ(1>A/?ÿHIJEÿIKL@
`
`<51ÿ9:;<=ÿM1>A?3ÿNA'5ÿ+ÿ35/('ÿ+?0ÿ5A>5,BÿC+(A+M,1
`31O)1?*1Eÿ+,'5/)>5ÿA'ÿ+,3/ÿ*/?'+A?3ÿ+ÿ*/?31(C10ÿ./'A4ÿ+?0
`;Pÿ0A?)*,1/'A01ÿHI9L@ÿ<5A3ÿ0/.+A?ÿA3ÿ?+.10ÿ8=ÿQC+(A+M,1
`(1>A/?Rÿ+?0ÿA'ÿ5+3ÿM11?ÿ35/N?ÿA'3ÿA.2,A*+'A/?ÿA?ÿCA(+,ÿ=ST
`3B?'513A3ÿ)3A?>ÿ3)M>1?/.A*ÿ(12,A*/?ÿ3B3'1.3ÿHKJL@
`
`Tÿ2/,B;F7U(A*5ÿ'(+*'ÿ/4ÿC+(A+M,1ÿ,1?>'5ÿ+?0ÿ*/.2/3A'A/?
`4/,,/N3ÿ'51ÿ8=ÿ31O)1?*1@ÿ<5A3ÿ*+?ÿA?'1(+*'ÿNA'5ÿ5/3'
`2(/'1A?3ÿ+?0ÿ(1>),+'1ÿCA(+,ÿ'(+?3,+'A/?ÿHIVEÿIWL@ÿ&/.1ÿ/4ÿ'5131
`5/3'ÿ2(/'1A?3ÿ5+C1ÿM11?ÿA01?'A4A10Eÿ1@>@Eÿ2/,B2B(A.A0A?1ÿ'(+*'U
`MA?0A?>ÿ2(/'1A?ÿQX<YREÿ51'1(/>1?1/)3ÿ?)*,1+(ÿ(AM/?)U
`*,1/2(/'1A?ÿ7ÿQ5?=SXÿ7Rÿ+?0ÿ>,B*1(+,015B01U9U25/325+'1
`015B0(/>1?+31ÿQPTZX6REÿ+./?>ÿ/'51(3ÿHIIUI[L@
`
`\A?+,,BEÿ'51ÿ9:;<=ÿ(1>A/?ÿ*/?'+A?3ÿ+ÿ][ÿ?'U,/?>ÿ0/.+A?
`^?/N?ÿ+3ÿ'51ÿ9:Gÿ(1>A/?ÿ_ÿ/?1ÿ/4ÿ'51ÿ./3'ÿ*/?31(C10ÿ./'A43
`NA'5A?ÿ'5A3ÿ(1>A/?@ÿ`'ÿ4/,03ÿA?'/ÿ'5(11ÿ0A441(1?'ÿ3'1.U,//2
`./'A43ÿ_ÿ&aJEÿ&aKÿ+?0ÿ&a9ÿHW]Lÿ_ÿ+?0ÿA3ÿA?C/,C10ÿA?ÿCA(+,
`=STÿ(12,A*+'A/?ÿHKJEÿI]UbJLÿ+?0ÿCA(A/?ÿA?41*'ACA'Bÿcdÿfcfg
`HIhL@ÿ`'3ÿA?'1(+*'A/?ÿNA'5ÿ5).+?ÿ(AM/3/.+,ÿ*/.2,1i13ÿ5+3
`
`+,3/ÿM11?ÿ(12/('10Eÿ3)>>13'A?>ÿ+ÿ2/'1?'A+,ÿ(/,1ÿA?ÿ'51
`./0),+'A/?ÿ/4ÿ`=j&U0121?01?'ÿ'(+?3,+'A/?ÿHbKL@ÿ`'ÿA3
`A.2/('+?'ÿ'/ÿ?/'1ÿ'5+'ÿ'5A3ÿ0/.+A?ÿA3ÿ1i*,)3AC1ÿ'/ÿ678
`Q(1CA1N10ÿA?ÿHb9LRÿ+?0ÿA3ÿ+?ÿ1i*1,,1?'ÿ*+?0A0+'1ÿ'+(>1'ÿ4/(
`?1Nÿ+?'ACA(+,ÿ0()>3@
`
`klmÿno$ÿpqrkmsn
`
`t?1ÿ/4ÿ'51ÿ./3'ÿ1i'1?3AC1,Bÿ3')0A10ÿ+?0ÿM13'ÿ)?01(3'//0
`'+(>1'3ÿA?ÿ+?'AU678ÿ'51(+2BÿA3ÿ'51ÿS&9ÿ2(/'1A?ÿUÿ+
`.),'A4)?*'A/?+,ÿ./,1*),1ÿ*/.2/310ÿ/4ÿ'N/ÿ0/.+A?3ÿNA'5
`31(A?1ÿ2(/'1+31ÿ+?0ÿ51,A*+31ÿ+*'ACA'BÿHbVEÿbWL@
`
`X(/'1+31ÿ+*'ACA'BÿA3ÿ/?1ÿ/4ÿ'51ÿ2(141((10ÿ'+(>1'3ÿ4/(ÿ'51
`013A>?1(3ÿ/4ÿ?1Nÿ0()>3@ÿX(/'1+31ÿ5+3ÿ+ÿ^1Bÿ(/,1ÿA?ÿ678
`A?41*'A/?ÿ3A?*1ÿA'ÿA3ÿ(132/?3AM,1ÿ4/(ÿ2/,B2(/'1A?ÿ2(/*133A?>
`0)(A?>ÿCA()3ÿ.+')(+'A/?@ÿ<51ÿ5/3'ÿ2(/'1+313ÿ4A(3'ÿ*,1+C1ÿ'51
`2(1*)(3/(ÿ'/ÿ(1,1+31ÿ'51ÿ3'()*')(+,ÿ2(/'1A?3@ÿ&1*/?0,BEÿCA(+,,BU
`1?*/010ÿS&KFS&9ÿ2(/'1+313ÿBA1,0ÿ'51ÿ.+')(1ÿS&9ÿ2(/'1A?
`HbILÿN5A*5ÿA?A'A+'13ÿ'51ÿ*,1+C+>1ÿ/4ÿ'51ÿ(1.+A?A?>ÿ'+(>1'ÿ3A'13
`A?ÿ+?ÿu>KvU0121?01?'ÿ(1+*'A/?ÿHbbLDÿ4A(3'Eÿ*/'(+?3,+'A/?+,,Bÿ+'
`'51ÿS&9FS&VTÿw)?*'A/?Eÿ+?0ÿ'51?ÿA?ÿ'51ÿ/(01(ÿS&WTUWYE
`S&VTUVYÿ+?0ÿS&VYUWTÿHb[L@ÿ<51ÿxcyÿ*,1+C+>1ÿA3ÿ>/C1(?10
`
`5
`
`

`

`126
`Infectious Disorders - Drug Targets 2006, Vol. 6, No. 2
` ÿÿÿÿ
`
ÿ
`  ÿÿ
ÿ ÿ ÿ ÿÿ ÿ
`
`Berzal-Herranz et al.
`
` ÿ ÿ
`
`by the intrinsic folding of the polyprotein, which brings the
`!"ÿ$%&ÿ'($)'(*'+ÿ,-./'(0ÿ-,ÿ$%&ÿ1-."1)-$&'(2ÿ3%'+%ÿ!)'(0*ÿ$%&
`protease domain andits substrate close together. The trans-
`1)-$&4*&ÿ/-54'(ÿ4(/ÿ'$*ÿ*6!*$)4$&ÿ+.-*&ÿ$-0&$%&)7ÿ8%&ÿ9:;<=>
`Teaction has more stringent
`requirements including the
`)&4+$'-(ÿ%4*ÿ5-)&ÿ*$)'(0&($ÿ)&?6')&5&($*ÿ'(+.6/'(0ÿ$%&
`correct positioning of the protease and its polyprotein
`+-))&+$ÿ1-*'$'-('(0ÿ-,ÿ$%&ÿ1)-$&4*&ÿ4(/ÿ'$*ÿ1-."1)-$&'(
`substrate (reviewedin [79]).
`*6!*$)4$&ÿ@)&A'&3&/ÿ'(ÿBCDEF7
`
`The proteolytic processing mediated by NS3 is dependent
`8%&ÿ1)-$&-."$'+ÿ1)-+&**'(0ÿ5&/'4$&/ÿ!"ÿGHIÿ'*ÿ/&1&(/&($
`on NS4A, a small polypeptide composed of only 54
`-(ÿGHJK2ÿ4ÿ*54..ÿ1-."1&1$'/&ÿ+-51-*&/ÿ-,ÿ-(."ÿLJ
`aminoacids [80, 81]. The interaction between them mapsto
`45'(-4+'/*ÿBMN2ÿMOE7ÿ8%&ÿ'($&)4+$'-(ÿ!&$3&&(ÿ$%&5ÿ541*ÿ$-
`the 22 residues most N-terminal of the NS3 protein [82, 83]
`$%&ÿPPÿ)&*'/6&*ÿ5-*$ÿG>$&)5'(4.ÿ-,ÿ$%&ÿGHIÿ1)-$&'(ÿBMP2ÿMIE
`and induces several conformational changes affecting the
`4(/ÿ'(/6+&*ÿ*&A&)4.ÿ+-(,-)54$'-(4.ÿ+%4(0&*ÿ4,,&+$'(0ÿ$%&
`catalytic residues, giving rise to a highly stable complex
`+4$4."$'+ÿ)&*'/6&*2ÿ0'A'(0ÿ)'*&ÿ$-ÿ4ÿ%'0%."ÿ*$4!.&ÿ+-51.&Q
`containing NS4A [84]. NS3 has no membrane anchoring
`+-($4'('(0ÿGHJKÿBMJE7ÿGHIÿ%4*ÿ(-ÿ5&5!)4(&ÿ4(+%-)'(0
`domains itself, but its cofactor NS4A is an amphipathic
`/-54'(*ÿ'$*&.,2ÿ!6$ÿ'$*ÿ+-,4+$-)ÿGHJKÿ'*ÿ4(ÿ451%'14$%'+
`peptide that can interact with membranes via a highly
`1&1$'/&ÿ$%4$ÿ+4(ÿ'($&)4+$ÿ3'$%ÿ5&5!)4(&*ÿA'4ÿ4ÿ%'0%."
`hydrophobic stretch of aminoacids to form a transmembrane
`%"/)-1%-!'+ÿ*$)&$+%ÿ-,ÿ45'(-4+'/*ÿ$-ÿ,-)5ÿ4ÿ$)4(*5&5!)4(&
`helix. This allows the NS3/4A complex to be immobilized
`%&.'Q7ÿ8%'*ÿ4..-3*ÿ$%&ÿGHIRJKÿ+-51.&Qÿ$-ÿ!&ÿ'55-!'.'S&/
`on the surface of the endoplasmic reticulum (ER; [85]), a
`-(ÿ$%&ÿ*6),4+&ÿ-,ÿ$%&ÿ&(/-1.4*5'+ÿ)&$'+6.65ÿ@TUVÿBMLEF2ÿ4
`tequirementfor the establishment of the replication complex.
`)&?6')&5&($ÿ,-)ÿ$%&ÿ&*$4!.'*%5&($ÿ-,ÿ$%&ÿ)&1.'+4$'-(ÿ+-51.&Q7
`
`The structure of the protease-NS4A complex has been
`8%&ÿ*$)6+$6)&ÿ-,ÿ$%&ÿ1)-$&4*&>GHJKÿ+-51.&Qÿ%4*ÿ!&&(
`tesolved by X-ray crystallography. This information has
`)&*-.A&/ÿ!"ÿW>)4"ÿ+)"*$4..-0)41%"7ÿ8%'*ÿ'(,-)54$'-(ÿ%4*
`given rise to intensive efforts to identify potential targets for
`0'A&(ÿ)'*&ÿ$-ÿ'($&(*'A&ÿ&,,-)$*ÿ$-ÿ'/&($',"ÿ1-$&($'4.ÿ$4)0&$*ÿ,-)
`new antiviral drugs. As a result, a chymotrypsin-like folding
`(&3ÿ4($'A')4.ÿ/)60*7ÿK*ÿ4ÿ)&*6.$2ÿ4ÿ+%"5-$)"1*'(>.'X&ÿ,-./'(0
`with an exposed Zn-binding site located on the surface of the
`3'$%ÿ4(ÿ&Q1-*&/ÿY(>!'(/'(0ÿ*'$&ÿ.-+4$&/ÿ-(ÿ$%&ÿ*6),4+&ÿ-,ÿ$%&
`complex was detected [86]. Zinc ions (a requisite for
`+-51.&Qÿ34*ÿ/&$&+$&/ÿBMZE7ÿY'(+ÿ'-(*ÿ@4ÿ)&?6'*'$&ÿ,-)
`catalytic activity; [87]), are coordinated via three cysteine
`+4$4."$'+ÿ4+$'A'$"VÿBMCEF2ÿ4)&ÿ+--)/'(4$&/ÿA'4ÿ$%)&&ÿ+"*$&'(&
`tesidues in a long loop region that acts as a linker between
`)&*'/6&*ÿ'(ÿ4ÿ.-(0ÿ.--1ÿ)&0'-(ÿ$%4$ÿ4+$*ÿ4*ÿ4ÿ.'(X&)ÿ!&$3&&(
`two f-barrel domains and which contributes to the confor-
`$3-ÿ[>!4))&.ÿ/-54'(*ÿ4(/ÿ3%'+%ÿ+-($)'!6$&*ÿ$-ÿ$%&ÿ+-(,-)>
`mational integrity of the molecule as a whole (reviewed in
`54$'-(4.ÿ'($&0)'$"ÿ-,ÿ$%&ÿ5-.&+6.&ÿ4*ÿ4ÿ3%-.&ÿ@)&A'&3&/ÿ'(
`[88]). This structural feature clearly differentiates NS3/4A
`BMMEF7ÿ8%'*ÿ*$)6+$6)4.ÿ,&4$6)&ÿ+.&4)."ÿ/',,&)&($'4$&*ÿGHIRJK
`from other members of
`the
`serine-protease
`family.
`,)-5ÿ-$%&)ÿ5&5!&)*ÿ-,ÿ$%&ÿ*&)'(&>1)-$&4*&ÿ,45'."7
`Consequently, it is plausible that compoundsaffecting the
`\-(*&?6&($."2ÿ'$ÿ'*ÿ1.46*'!.&ÿ$%4$ÿ+-51-6(/*ÿ4,,&+$'(0ÿ$%&
`coordination sphere of the metal ions could act as effective
`+--)/'(4$'-(ÿ*1%&)&ÿ-,ÿ$%&ÿ5&$4.ÿ'-(*ÿ+-6./ÿ4+$ÿ4*ÿ&,,&+$'A&
`and specific inhibitors of protease activity. Research into the
`4(/ÿ*1&+','+ÿ'(%'!'$-)*ÿ-,ÿ1)-$&4*&ÿ4+$'A'$"7ÿU&*&4)+%ÿ'($-ÿ$%&
`three dimensional structure of the protease-NS4A complex
`$%)&&ÿ/'5&(*'-(4.ÿ*$)6+$6)&ÿ-,ÿ$%&ÿ1)-$&4*&>GHJKÿ+-51.&Q
`has also contributed to the identification of the substrate-
`%4*ÿ4.*-ÿ+-($)'!6$&/ÿ$-ÿ$%&ÿ'/&($','+4$'-(ÿ-,ÿ$%&ÿ*6!*$)4$&>
`binding site. This is positioned in a wide, very exposedcleft
`!'(/'(0ÿ*'$&7ÿ8%'*ÿ'*ÿ1-*'$'-(&/ÿ'(ÿ4ÿ3'/&2ÿA&)"ÿ&Q1-*&/ÿ+.&,$
`(reviewed in [89]) and can bind a minimum 10 amino acid-
`@)&A'&3&/ÿ'(ÿBMDEFÿ4(/ÿ+4(ÿ!'(/ÿ4ÿ5'('565ÿONÿ45'(-ÿ4+'/>
`long substrate. Competitive inhibitors based on the structure
`.-(0ÿ*6!*$)4$&7ÿ\-51&$'$'A&ÿ'(%'!'$-)*ÿ!4*&/ÿ-(ÿ$%&ÿ*$)6+$6)&
`of the cleavable substrate have been designed (reviewed in
`-,ÿ$%&ÿ+.&4A4!.&ÿ*6!*$)4$&ÿ%4A&ÿ!&&(ÿ/&*'0(&/ÿ@)&A'&3&/ÿ'(
`[90]). The enzymeis also clearly inhibited by its reaction
`BDNEF7ÿ8%&ÿ&(S"5&ÿ'*ÿ4.*-ÿ+.&4)."ÿ'(%'!'$&/ÿ!"ÿ'$*ÿ)&4+$'-(
`products [91], which opens a broad range of possibilities for
`1)-/6+$*ÿBDOE2ÿ3%'+%ÿ-1&(*ÿ4ÿ!)-4/ÿ)4(0&ÿ-,ÿ1-**'!'.'$'&*ÿ,-)
`the design of mimetic peptide drugs.
`$%&ÿ/&*'0(ÿ-,ÿ5'5&$'+ÿ1&1$'/&ÿ/)60*7
`
`The helicase activity of NS3 maps to its C-terminal end.
`8%&ÿ%&.'+4*&ÿ4+$'A'$"ÿ-,ÿGHIÿ541*ÿ$-ÿ'$*ÿ\>$&)5'(4.ÿ&(/7
`This domain mediates the RNA duplex unwinding promoted
`8%'*ÿ/-54'(ÿ5&/'4$&*ÿ$%&ÿUGKÿ/61.&Qÿ6(3'(/'(0ÿ1)-5-$&/
`by NTP hydrolysis during viral replication, suggesting that
`!"ÿG8]ÿ%"/)-."*'*ÿ/6)'(0ÿA')4.ÿ)&1.'+4$'-(2ÿ*600&*$'(0ÿ$%4$
`this helicase also has NTPase activity [92]. RNA duplex
`$%'*ÿ%&.'+4*&ÿ4.*-ÿ%4*ÿG8]4*&ÿ4+$'A'$"ÿBDPE7ÿUGKÿ/61.&Q
`separation requires Mg”’ and is
`severely inhibited by
`*&14)4$'-(ÿ)&?6')&*ÿ^0P_ÿ4(/ÿ'*ÿ*&A&)&."ÿ'(%'!'$&/ÿ!"
`monovalentions [77].
`5-(-A4.&($ÿ'-(*ÿBCCE7
`
`Crystallography studies and mutational assays of the
`\)"*$4..-0)41%"ÿ*$6/'&*ÿ4(/ÿ56$4$'-(4.ÿ4**4"*ÿ-,ÿ$%&
`helicase domain have shown it to have a unique Y shape in
`%&.'+4*&ÿ/-54'(ÿ%4A&ÿ*%-3(ÿ'$ÿ$-ÿ%4A&ÿ4ÿ6('?6&ÿ`ÿ*%41&ÿ'(
`which three domains are defined by each arm of the Y [93-
`3%'+%ÿ$%)&&ÿ/-54'(*ÿ4)&ÿ/&,'(&/ÿ!"ÿ&4+%ÿ4)5ÿ-,ÿ$%&ÿ`ÿBDI>
`97]. Although separated by clefts, the different domains may
`DCE7ÿK.$%-60%ÿ*&14)4$&/ÿ!"ÿ+.&,$*2ÿ$%&ÿ/',,&)&($ÿ/-54'(*ÿ54"
`interact with each other. This finding has led to the design of
`'($&)4+$ÿ3'$%ÿ&4+%ÿ-$%&)7ÿ8%'*ÿ,'(/'(0ÿ%4*ÿ.&/ÿ$-ÿ$%&ÿ/&*'0(ÿ-,
`new helicase inhibitors
`that affect different
`functions
`(&3ÿ%&.'+4*&ÿ'(%'!'$-)*ÿ$%4$ÿ4,,&+$ÿ/',,&)&($ÿ,6(+$'-(*
`simultaneously.
`*'56.$4(&-6*."7
`
`The different NS3 activities show a high level of
`8%&ÿ/',,&)&($ÿGHIÿ4+$'A'$'&*ÿ*%-3ÿ4ÿ%'0%ÿ.&A&.ÿ-,
`interdependence. It seems clear that NTPase capacity is
`'($&)/&1&(/&(+&7ÿa$ÿ*&&5*ÿ+.&4)ÿ$%4$ÿG8]4*&ÿ+414+'$"ÿ'*
`necessary but not sufficient for helicase activity [97-100].
`(&+&**4)"ÿ!6$ÿ(-$ÿ*6,,'+'&($ÿ,-)ÿ%&.'+4*&ÿ4+$'A'$"ÿBDC>ONNE7
`Moreover, NS3 helicase and protease activities are activated
`^-)&-A&)2ÿGHIÿ%&.'+4*&ÿ4(/ÿ1)-$&4*&ÿ4+$'A'$'&*ÿ4)&ÿ4+$'A4$&/
`
`by polynucleotides, preferentially by poly(U) [101]. These
`!"ÿ1-."(6+.&-$'/&*2ÿ1)&,&)&($'4.."ÿ!"ÿ1-."@bFÿBONOE7ÿ8%&*&
`observations suggest
`that genomic RNA modulates the
`-!*&)A4$'-(*ÿ*600&*$ÿ$%4$ÿ0&(-5'+ÿUGKÿ5-/6.4$&*ÿ$%&
`interplay between the different functions of NS3 to help form
`'($&)1.4"ÿ!&$3&&(ÿ$%&ÿ/',,&)&($ÿ,6(+$'-(*ÿ-,ÿGHIÿ$-ÿ%&.1ÿ,-)5
`a stable replication complex [101]. Recently, it has also been
`4ÿ*$4!.&ÿ)&1.'+4$'-(ÿ+-51.&QÿBONOE7ÿU&+&($."2ÿ'$ÿ%4*ÿ4.*-ÿ!&&(
`suggested that a relationship exists between the helicase and
`*600&*$&/ÿ$%4$ÿ4ÿ)&.4$'-(*%'1ÿ&Q'*$*ÿ!&$3&&(ÿ$%&ÿ%&.'+4*&ÿ4(/
`protease domains, and that this interaction positively modu-
`1)-$&4*&ÿ/-54'(*2ÿ4(/ÿ$%4$ÿ$%'*ÿ'($&)4+$'-(ÿ1-*'$'A&."ÿ5-/6>
`lates duplex unwinding and viral polyprotein processing
`.4$&*ÿ/61.&Qÿ6(3'(/'(0ÿ4(/ÿA')4.ÿ1-."1)-$&'(ÿ1)-+&**'(0
`[102, 103].
`BONP2ÿONIE7
`
`The above features have led to the proposal that NS3 may
`8%&ÿ4!-A&ÿ,&4$6)&*ÿ%4A&ÿ.&/ÿ$-ÿ$%&ÿ1)-1-*4.ÿ$%4$ÿGHIÿ54"
`be an excellent target for the inactivation of HCV. The
`!&ÿ4(ÿ&Q+&..&($ÿ$4)0&$ÿ,-)ÿ$%&ÿ'(4+$'A4$'-(ÿ-,ÿc\d7ÿ8%&
`existence of
`several domains with different catalytic
`&Q'*$&(+&ÿ-,ÿ*&A&)4.ÿ/-54'(*ÿ3'$%ÿ/',,&)&($ÿ+4$4."$'+
`activities essential for HCV infection provides a good target
`4+$'A'$'&*ÿ&**&($'4.ÿ,-)ÿc\dÿ'(,&+$'-(ÿ1)-A'/&*ÿ4ÿ0--/ÿ$4)0&$
`series for possible drugs or combinations of drugs with
`*&)'&*ÿ,-)ÿ1-**'!.&ÿ/)60*ÿ-)ÿ+-5!'(4$'-(*ÿ-,ÿ/)60*ÿ3'$%
`different specificities.
`/',,&)&($ÿ*1&+','+'$'&*7
`THE NS5B PROTEIN
`efgÿhijkÿlmnegoh
`
`The NSSB protein is a key enzymein the viral cycle
`8%&ÿGHLpÿ1)-$&'(ÿ'*ÿ4ÿX&"ÿ&(S"5&ÿ'(ÿ$%&ÿA')4.ÿ+"+.&
`because of its RNA-dependent RNA polymerase activity
`!&+46*&ÿ-,ÿ'$*ÿUGK>/&1&(/&($ÿUGKÿ1-."5&)4*&ÿ4+$'A'$"
`(RdRp). This enzyme is required for the synthesis of the
`@U/U1F7ÿ8%'*ÿ&(S"5&ÿ'*ÿ)&?6')&/ÿ,-)ÿ$%&ÿ*"($%&*'*ÿ-,ÿ$%&
`negative and positive RNA strands during the replication of
`(&04$'A&ÿ4(/ÿ1-*'$'A&ÿUGKÿ*$)4(/*ÿ/6)'(0ÿ$%&ÿ)&1.'+4$'-(ÿ-,
`the genome. The NSS5B protein is highly conserved across
`$%&ÿ0&(-5&7ÿ8%&ÿGHLpÿ1)-$&'(ÿ'*ÿ%'0%."ÿ+-(*&)A&/ÿ4+)-**
`different HCV genotypes (and their subtypes andisolates),
`/',,&)&($ÿc\dÿ0&(-$"1&*ÿ@4(/ÿ$%&')ÿ*6!$"1&*ÿ4(/ÿ'*-.4$&*F2
`tendering it a potential target for the design of antiviral
`)&(/&)'(0ÿ'$ÿ4ÿ1-$&($'4.ÿ$4)0&$ÿ,-)ÿ$%&ÿ/&*'0(ÿ-,ÿ4($'A')4.
`compounds with minimalside effects (reviewed in [104]).
`+-51-6(/*ÿ3'$%ÿ5'('54.ÿ*'/&ÿ&,,&+$*ÿ@)&A'&3&/ÿ'(ÿBONJEF7
`
`NSSB is produced as part of the polyprotein HCV
`GHLpÿ'*ÿ1)-/6+&/ÿ4*ÿ14)$ÿ-,ÿ$%&ÿ1-."1)-$&'(ÿc\d
`precursor. Onceit is processed by the NS3/NS4A complex,it
`1)&+6)*-)7ÿq(+&ÿ'$ÿ'*ÿ1)-+&**&/ÿ!"ÿ$%&ÿGHIRGHJKÿ+-51.&Q2ÿ'$
`is transported to the ER membranes and anchored there
`'*ÿ$)4(*1-)$&/ÿ$-ÿ$%&ÿTUÿ5&5!)4(&*ÿ4(/ÿ4(+%-)&/ÿ$%&)&
`through the highly hydrophobic C-terminal end,
`the N-
`$%)-60%ÿ$%&ÿ%'0%."ÿ%"/)-1%-!'+ÿ\>$&)5'(4.ÿ&(/2ÿ$%&ÿG>
`terminal domain facing the cytosol [105]. Here, NS5B is
`$&)5'(4.ÿ/-54'(ÿ,4+'(0ÿ$%&ÿ+"$-*-.ÿBONLE7ÿc&)&2ÿGHLpÿ'*
`involved in the recruitment of non-structural HCV proteins
`'(A-.A&/ÿ'(ÿ$%&ÿ)&+)6'$5&($ÿ-,ÿ(-(>*$)6+$6)4.ÿc\dÿ1)-$&'(*
`for
`the
`formation of
`the
`replication
`complex,
`an
`,-)ÿ$%&ÿ,-)54$'-(ÿ-,ÿ$%&ÿ)&1.'+4$'-(ÿ+-51.&Q2ÿ4(
`indispensable step [106-108]. This association of HCV
`'(/'*1&(*4!.&ÿ*$&1ÿBONZ>ONME7ÿ8%'*ÿ4**-+'4$'-(ÿ-,ÿc\d
`structural and non-structural proteins plus genomic RNA
`*$)6+$6)4.ÿ4(/ÿ(-(>*$)6+$6)4.ÿ1)-$&'(*ÿ1.6*ÿ0&(-5'+ÿUGK
`causes a deformation ofthe lipid layer in the ER membranes
`+46*&*ÿ4ÿ/&,-)54$'-(ÿ-,ÿ$%&ÿ.'1'/ÿ.4"&)ÿ'(ÿ$%&ÿTUÿ5&5!)4(&*
`that can be appreciated by electron microscopy [106, 108,
`$%4$ÿ+4(ÿ!&ÿ411)&+'4$&/ÿ!"ÿ&.&+$)-(ÿ5'+)-*+-1"ÿBONZ2ÿONM2
`109]. This alteration, known as a membranous web,
`is
`ONDE7ÿ8%'*ÿ4.$&)4$'-(2ÿX(-3(ÿ4*ÿ4ÿ5&5!)4(-6*ÿ3&!2ÿ'*
`similar to the “sponge-like inclusions” detected in the liver
`*'5'.4)ÿ$-ÿ$%&ÿr*1-(0&>.'X&ÿ'(+.6*'-(*sÿ/&$&+$&/ÿ'(ÿ$%&ÿ.'A&)
`of infected chimpanzees
`[110]. These macromolecular
`-,ÿ'(,&+$&/ÿ+%'514(S&&*ÿBOONE7ÿ8%&*&ÿ54+)-5-.&+6.4)
`structures are components of a strategy developed by RNA
`*$)6+

This document is available on Docket Alarm but you must sign up to view it.


Or .

Accessing this document will incur an additional charge of $.

After purchase, you can access this document again without charge.

Accept $ Charge
throbber

Still Working On It

This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.

Give it another minute or two to complete, and then try the refresh button.

throbber

A few More Minutes ... Still Working

It can take up to 5 minutes for us to download a document if the court servers are running slowly.

Thank you for your continued patience.

This document could not be displayed.

We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.

You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.

Set your membership status to view this document.

With a Docket Alarm membership, you'll get a whole lot more, including:

  • Up-to-date information for this case.
  • Email alerts whenever there is an update.
  • Full text search for other cases.
  • Get email alerts whenever a new case matches your search.

Become a Member

One Moment Please

The filing “” is large (MB) and is being downloaded.

Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!

If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document

We are unable to display this document, it may be under a court ordered seal.

If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.


Access Government Site

We are redirecting you
to a mobile optimized page.





Document Unreadable or Corrupt

Refresh this Document
Go to the Docket

We are unable to display this document.

Refresh this Document
Go to the Docket