MTX1057
`ModernaTX, Inc. v. CureVac AG
`IPR2017-02194
`
`1
`
`

`

`U.S. Patent
`
`May 31,1994
`
`5,316,908
`
`_ FIRST KIT
`
`SIZE POSITION
`
`SECOND KIT
`
`SIZE POSITION
`
`
`
`23994
`
`22624
`
`15004 meres
`
`56j —_
`
`11203
`
`11919
`
`C6 —_—_—_—_—
`
`916 ee
`
`C271 ewe
`
`742 orc
`
`440 —_—_
`
`8271
`
`7421
`
`6442
`
`ib —_—_—_
`
`54158 ee
`
`4716 — 4716 —————
`
`4333 ees
`4045
`310 ———eeS812 eee
`59 3397
`3101 meee
`3(0)
`C876 cee
`2876 ee
`40\6,0
`2650 ee
`2433
`emmeneenenne
`9433 eee
`;C83etT°::—
`9243 ee
`2015 eee
`740)be I
`
`73 1672 xm
`
`1431 ————
`1420 ————
`
`Wi—_—_
`
`14310 ——
`1287
`
`910 ee
`
`910 een
`
`THQ ee
`
`G55 ees
`
`784 —
`
`653 eee
`
`526 526 ae«6Ssds‘.
`
`2
`
`

`

`1
`
`5,316,908
`
`SIZE MARKERS FOR ELECTROPHORETIC
`ANALYSIS OF DNA
`
`FIELD OF THE INVENTION
`
`The present invention is in the field of molecular
`biology and specifically relates to the technique of gel
`electrophoresis of nucleic acid fragments.
`BACKGROUNDOF THE INVENTION
`
`A number of mixtures of nucleic acid fragments are
`commercially available that can be used as markers for
`determining thesizes of nucleic acid molecules of exper-
`imental interest. For example, Collaborative Research,
`Inc.
`(Lexington, Mass.) has sold a marker ladder
`(“Quik-Kit Size Markers”, cat. no. 30013) that is a mix-
`ture of 12 bacteriophage A (lambda) fragments. They
`are visualized by hybridization with two 32P-labeled
`12-nucleotide synthetic oligonucleotides, complemen-
`tary to the left and right bacteriophage cossites.
`A large number of other DNA marker fragments are
`available from numerous suppliers. In every case, ex-
`cept the Collaborative markers, these marker fragments
`are restriction digests of several bacteriophage or plas-
`mid DNAS. Every DNA fragment in the digests can
`then be visualized by hybridization to the same bacte-
`riophage or plasmid DNAS.
`Other DNA marker ladders often use collections of
`fragments that have a quasi-random size distribution.
`For example, the quasi-random size distribution may be
`made by a digest of a DNA, often A DNA,bya single
`restriction enzyme. Alternatively, the fragments may
`vary linearly with molecular weight, i.e. adjacent bands
`may differ by about 1000 base pairs (e.g. “1 Kb DNA
`Ladder”, cat. no. 5615SA, BRL, Gaithersburg, Md.).
`Bandsin these linear ladders are not evenly spaced after
`electrophoresis, they are “compressed”in the “upper”,
`higher molecular weight region of a gel. However some
`ladders have been constructed and sold that are loga-
`rithmically spaced (“GenePrint TM’, cat. no. DG1911,
`Promega, Madison, Wis.).
`SUMMARYOF THE INVENTION
`The drawback of conventional markerladdersis that
`the signal generated by each fragmentis proportional to
`its length. As a result, levels of signal that allow visual-
`ization of small fragments (e.g. 500 base pairs (bp)) give
`too muchsignal in large fragments (e.g. 20 kbp) for
`optimal resolution. This drawback is overcomein the
`marker ladder of the present invention.
`The invention consists of a “target DNA” and a
`“probe DNA”. Target DNA is constructed by pooling
`several restriction endonuclease digests of a single
`DNA of known sequence. Each restriction endonucle-
`ase digest generates a number of DNA fragments, one
`of which contains a specific sequence “S”. The restric-
`tion endonucleases and the sequence “S” are chosen so
`that the set of DNA fragments containing the same
`sequence “S” would give approximately a logarithmic
`distribution of lengths. In other words, when electro-
`phoresed through a gel where nucleic acid fragments
`migrate as a logarithmic function of molecular weight,
`the marker fragments will be approximately evenly
`spaced and will leave no molecular weight range with-
`out a marker. When the pooled, digested DNAiselec-
`trophoresed in a gel matrix, a ladder of fragments is
`
`2
`generated containing sequence “S”, with approximately
`equal spacing between them.
`The probe DNAis complementary to sequence “S”,
`and therefore can be boundspecifically to sequence “S”
`by nucleic acid hybridization. When the probe DNAis
`labeled (for example, with radioactive phosphorus,bio-
`tin, or alkaline phosphatase) it allows visualization of
`the DNAfragments containing sequence “S”.
`The present
`invention preferably utilizes internal
`labeling sites,
`thus allowing both ends of the DNA
`fragment
`to be altered by restriction endonuclease
`cleavage. Therefore, a greater variety of DNA frag-
`ment sizes can be generated.
`The present invention is expected to be useful to
`research laboratories employing DNA or RNAanalysis
`techniquesandit is especially useful to laboratories and
`law enforcement agencies using DNAanalysis to iden-
`tify individuals.
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`FIG.1 is a schematic, scale drawing of the how the
`first and second molecular marker kits would migrate
`on an electrophoretic gel. The positions were calculated
`by assumingthat relative mobilities are a linear function
`of the logarithm of the length of the fragment in base
`pairs (bp). The length of each bandin bpis indicated to
`the left of the band.
`
`25
`
`DETAILED DESCRIPTION OF THE
`INVENTION
`
`The present invention is a DNA size marker system,
`preferably a DNA markerladder, having pooled DNA
`restriction endonuclease digests. By the term “DNA
`marker ladder” is meant DNA fragments of varying
`sizes containing the sequence “S” that when electro-
`phoresed through a gel matrix migrate with approxi-
`mately equal spacing between them. “Equal spacing”
`mayrefer either to the physical location on a gel after
`electrophoresis (e.g. bands about 0.5 cm. apart) or to the
`size being marked (e.g. bands differing in size by 1,000
`bp). Each restriction digest contains at least one DNA
`fragment having an “S” sequence complementary to a
`probe and one or more other DNA fragments not com-
`plementary to the probe. The same probeis thus used
`for all restriction digests. The region of complementar-
`ity between the probe and the first DNA fragment of
`each digest is a double-stranded segment ofthe first
`fragment.
`The numberofrestriction digests pooledis at least 5,
`preferably at least 10, more preferably at least 15, yet
`more preferably at least 20, and most preferably at least
`25. In the present invention, the largest target fragment
`is at least 10-fold, preferably 14-fold, and most prefera-
`bly 17-fold, longer than the smallest target fragment.
`In some embodiments, target fragments most similar
`in size differ in length by defined amounts. As defined
`herein, the “measure”, M, of the difference in size is
`herein calculated by the formula M=log;o(U)—-
`logio(L), where U and L are the respective lengths in bp
`of the upper and lowerof the two adjacent bands being
`compared. This equation is equivalent to 10@=U/L. As
`a meansofillustration, Table 1 showsthe relationship
`between M,U, and L, (U and L are in bp) with thelatter
`being held constant at 1,000 bp. Note that if U and L are
`both changed bythe same factor or multiple, M remains
`constant. For example, bands of 1,059 bp and 1,000 bp
`and bands of 530 bp and 500 bp both differ in size by
`measures of 0.025.
`
`45
`
`60
`
`65
`
`3
`
`

`

`3
`Preferably, target fragment pairs most similar in size
`differ in size by no more than a measure of about 0.1
`(e.g. bands of 1,259 bp and 1,000 bp), and, most prefera-
`bly, by no more than a measure of about 0.075 (e.g.
`bands of 1,188 bp and 1,000 bp). In other words, bands
`that after gel electrophoresis and Southern blotting
`would be adjacent to each other differ in size by no
`more than a measure of about 0.1. As exemplified
`herein, the target fragment pairs most similar in size
`differ in size by at least a measure of about 0.025 (e.g.
`bands of 1,059 bp and 1,000 bp).
`Preferably, the target fragments all anneal to a single
`probe sequence or its complement. More than one mo-
`lecular species may be in the probe, provided that each
`digest contains at least one fragment that can anneal to
`a probe molecule and at least one fragment that cannot
`anneal to a probe molecule. Although not meant to be
`limiting, as exemplified herein, the target fragments are
`derived from bacteriophage A. As also exemplified
`herein, the target fragments may be detected with a
`probe having sequencepresentin or a sequence comple-
`mentary to a sequence present in nucleotides 33,783 to
`34,212 of bacteriophage A.
`The present invention mayfurther be includedin a kit
`having,
`in addition to the target fragments, a probe
`nucleic acid complementary to target DNA fragments.
`As exemplified herein,
`the sequence of the probe is
`present in or is complementary to a sequencepresent in
`nucleotides 33,783 to 34,212 of bacteriophage A.
`The kit may further include an enzyme capable of
`radioactively labeling the probe, e.g. polynucleotide
`kinase or the Klenow fragment of E. coli DNA poly-
`merase I.
`Preferably, the target DNA is constructed from a
`single bacteriophage or plasmid. The target DNApref-
`erably consists of at least 10 restriction endonuclease
`digests of that target DNA. Eachrestriction digest of
`the target DNA creates one fragment complementary
`to the probe DNA,and the lengths of these fragments
`may be distributed in a logarithmic array.
`Preferably, the probe DNAis supplied as a pair of
`synthetic oligonucleotides. Each of the probe oligonu-
`cleotides is preferably at least 20 nucleotides in length
`and are complementary to each other for 15 to 30 base
`pairs at their 3’-ends. These oligonucleotides can then
`be labeled by incorporation of labeled nucleotides in a
`chain extension reaction, with each oligonucleotide
`serving as a primer and using the other as a template in
`the chain extension reaction. As an illustration, in the
`following arrangement the upper and lowercaseletters
`are complements of each other:
`
`S’abc. .
`
`. Imnopq3’
`3'OPQRST. .. XYZ5’
`
`After chain extension with a labeled nucleotide, here
`indicated by underlining, the oligonucleotides will have
`the following structure:
`
`S'abc. .
`
`. Imnopqrst._.. xyz3"
`
`3’ABC. .. LMNOPQRST... XYZS'
`
`This structure can then be separated to form two probes
`labeled at their 3’-ends: S’abc .
`.
`. Imnopgqrst .. . xyz3’
`and 5‘ZYX ... TSRQPONML... CBA3’.
`The probe may be labeled with a radioisotope (e.g.
`3H,32P, 35S, or 125]), a ligand(e.g. biotin), a hapten (e.g.
`
`65
`
`5,316,908
`
`4
`dinitrophenol, fluorescein), or an enzyme(e.g. alkaline
`phosphatase, 8-galactosidase, horseradish peroxidase,
`microperoxidase), or any othersuitable labeling method
`knownto or discovered by the art. The choice oflabel-
`ing method will generally depend on the chosen
`method for detecting the experimental sample for
`which the marker kit is serving as a molecular weight
`standard.
`A DNAmarkerkit of the present invention also in-
`clude a means for making a probe, instead of just a
`means for added labeled nucleotides, e.g. with DNA
`polymerase, or another labeled entity, e.g. 32PO4 and
`kinase. This means may be a means for making an RNA
`probe. The meansfor making a probe mayinclude being
`probe sequences under contro! of a promoter (i.e. a
`means-DNA). Thekit could also include an RNApoly-
`merase capableofinitiating transcription from the pro-
`moter and transcribing probe sequences of the means-
`DNA. Examples of such means-DNAs and RNA
`polymerases are well known in the art. For instance,
`DNAsequences downstream from SP6 promoters are
`commonly transcribed in vitro by SP6 RNA polymer-
`ase and sequences downstream from T7 promoters are
`commonlytranscribed in vitro by T7 RNA polymerase.
`In an actual gel electrophoresis, the bands may not be
`spaced exactly as shown in FIG. 1 due to well known
`phenomenaconcerning mobility of very large and very
`small fragments, sample loading effects, and inhomoge-
`neities in the gel. With the use of the present invention,
`these effects can be detected more readily. Indeed, due
`to the way that DNA fragments run in 1.0% agarose
`gels, the largest (e.g. above 10 kbp) target fragments of
`the exemplified kits will appear more evenly spaced
`than as illustrated in FIG. 1.
`The DNA marker fragments should be hybridized
`with the probe, with the fragments which bind probe
`molecules being the fragments detected. Whenthetotal
`DNAofthese ladder kits is inspected by non-specific,
`sequence-independentstaining, e.g. with ethidium bro-
`mide, the ladder DNA may appearas a ‘“‘smear” due to
`the multitude of fragments.
`Although specific restriction endonucleases are re-
`cited in the Examples and the Claims,it will be recog-
`nized that isoschizomers,
`i.e. enzymes that have the
`same recognition sequence butcut in a different fashion,
`can be substituted and the sameresult will be achieved.
`
`EXAMPLES
`
`Example 1: Common Materials and Methods
`E. coli bacteriophage A (lambda) DNA (clind 1,
`ts857, Sam 7) was the source ofall target DNAs.
`The probe DNAforeither of the ladders exemplified
`herein may consist of any DNA from between nucleo-
`tides 33,783 and 34,212 of that A DNA. Oligonucleo-
`tides were synthesized using standard phosphoramidite
`chemistry well knownto theart.
`To make a restriction digest, A DNA was digested
`with one or two restriction endonucleases. The en-
`zymes used for individual digests are indicated in Tables
`2 and 3. Digestions were performed under standard
`conditions, generally according to the instructions of
`the enzyme’s manufacturer. Restriction digests were
`pooled after digestion.
`
`Example 2: First Marker Kit
`
`the target DNA consisted of
`ladder,
`In the first
`pooled equal amounts of 31 different restriction digests
`
`20
`
`50
`
`55
`
`4
`
`

`

`5
`of phage A DNA.The probe DNA wasa 26-base oligo-
`nucleotide having a sequence of
`S'GCGACATTGCTCCGTGTATTCACTCG}'
`
`5,316,908
`
`which is complementary to nucleotides 34,000 to 34,025
`of the standard A DNA map. This oligonucleotide was
`labeled at its 5'-end by T4 polynucleotide kinase and
`[y-°2P]-ATP (BRLcat. no. 8060SA, Life Technologies,
`Inc., Gaithersburg, Md.). Hybridization. of 32P-labeled
`probe DNAto a Southern blot of the target DNAre-
`vealed bands of the expected pattern (FIG. 1). The
`restriction endonuclease digestions used, the sizes of the
`fragments generated thereby, the A sequence coordi-
`nates thereof, and the measures of the size differences
`between adjacent bandsare listed in Table 2.
`
`Example 3: Second Marker Kit
`This first kit was improved in three ways. Thefirst
`improvement was to change the probe DNA such that
`(a) it could easily be labeled with DNA polymerase as
`well as polynucleotide kinase, and (b) it would remain
`hybridized to the Southern blot even when washed at
`high temperature (65° C.) and low salt concentration
`(0.015M NaCl). This was achieved by utilizing two
`70-base, synthetic oligonucleotides that were comple-
`mentary to opposite strands of A DNA,and also com-
`plementary to one another for 15 bases at their 3’-ter-
`‘mini. The two oligonucleotides were as follows:
`
`20
`
`25
`
`6
`and measuresof the size differences between adjacent
`bandsare listed in Table 3.
`Although the foregoing refers to particular preferred
`embodiments,
`it will be understood that the present
`invention is not so limited. It will occur to those of
`ordinary skill in the art that various modifications may
`be made to the disclosed embodiments and that such
`modifications are intended to be within the scope of the
`present invention, which is defined by the following
`Claims.
`
`TABLE1
`
`
`
`Examples of Relationships between the Measure of the Difference
`in Size and Sizes of Fragments.
` M U L
`
`0.0
`1,000
`1,000
`0.025
`1,059
`1,000
`0.05
`1,122
`1,000
`0.075
`1,188
`1,000
`0.1
`1,259
`1,000
`0.15
`1,413
`1,000
`0.2
`1,585
`1,000
`0.3
`1,995
`1,000
`0.5
`3,162
`1,000
`0.7
`5,012
`1,000
`1.0
`10,000
`1,000
`M=
`logio(U) - logio(L) = Measure of the difference in size.
`U=S
`ize in bp of the upper band in a comparison.
`L. = Size in bp of the lower band in a comparison, held constant at 1,000 bp.
`
`TABLE2
`
`SAGGCCACTATCAGGCAGCTTTGTTIGTTCTGTTITACCAAGTTCTCTGGCAATCATTGCCGTICGTICGTATT3'
`
`S‘AGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGC3'
`
`The underlined segments are complementary to each
`other. Thefirst oligonucleotide is encoded by sequences
`from coordinates 34,078 (5'-end) to 34,147 (3’-end) and
`the second oligonucleotide is encoded by sequences
`from 34,133 (3’-end) to 34,202 (5’-end) on the standard A
`map. These oligonucleotides were mixed together with
`each other and the Klenow fragment of E. coli DNA
`polymerase I and four deoxynucleotide triphosphates,
`one of which was a-32P-labelled. The polymerase ex-
`tended each oligonucleotide using the other as a tem-
`plate and produced two a-32P-labelled, complementary
`oligonucleotides. This new probe hybridizes to the
`same target fragments as the previous probe. A mixture
`of the new 70-mers waslabeled with the large fragment
`of E. coli DNA polymeraseI and hybridized to a South-
`ern blot of the target DNA.
`The second improvement was to change the target
`DNAto give a more linear spacing on the Southern
`blot.
`The third improvement wasto increase the amounts,
`i.e. relative copy numberor the dosage, of the target
`DNA for the largest and smallest bands. Large DNA
`fragments blot inefficiently. As is well knownin theart,
`small fragments are retained on membranespoorly dur-
`ing hybridization. Therefore,
`the signal
`from large
`DNAfragments and small DNA fragments tends to be
`less than the signal from bandsin the middle range. This
`improvement compensated for that effect.
`Hybridization of 32P-labeled probe DNAto a South-
`ern blot of the target DNA revealed bands of the ex-
`pected pattern (FIG. 1). The restriction endonuclease
`digestions and dosage used, the sizes of the fragments
`generated thereby, the A sequence coordinatesthereof,
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`DNA Analysis Marker Ladder Target DNA Fragments. First Kit
`Lambda Coordinates
`Left
`Right
`Diff.
`Size
`Enzyme(s)
`24,508
`48,502
`0.204
`23,994 +
`Xba I*
`33,498
`48,502
`0.127
`15,004
`Xho I
`24,508
`35,711
`0.075
`11,203
`Xba I/Bgl Il*
`27,479
`36,895
`0.056
`9,416
`Hind III
`31,619
`39,890
`0.047
`8,271
`Sma I
`31,747
`39,168
`0,061
`7,421
`EcoR I
`32,562
`39,004
`0.041
`6,442
`Ava II
`28,859
`34,720
`0.034
`5,861
`Hae IT
`33,589
`39,004
`0.060
`5,415
`EcoR V/Ava I
`33,498
`38,214
`0.067
`4,716
`Ava I
`32,329
`36,374
`0.026
`4,045
`Bgl 1/BstE II*
`32,562
`36,374
`0.025
`3,812
`Ava II/BstE I
`32,705
`36,304
`0.065
`3,599
`Dra I*
`31,619
`34,720
`0.033
`3,101
`Sma I/Hae II
`33,498
`36,374
`0.036
`2,876
`Xho I/BstE II
`33,158
`35,808
`0.037
`2,650
`Neil
`33,680
`36,113
`0.026
`2,433
`Nde I
`33,157
`35,450
`0.056
`2,293
`MspI*
`33,246
`35,261
`0.035
`2,015
`Hinc II
`33,589
`35,450
`0.023
`1,861
`EcoR V/Msp I
`33,498
`35,261
`0.051
`1,763
`Xho I/Hinc II*
`32,868
`34,436
`0.040
`1,568
`Rsa I
`33,572
`35,003
`0.028
`1,431
`Ssp I
`33,157
`34,499
`0.057
`1,342
`Msp I/BamHI*
`33,323
`34,499
`0.024
`1,176
`Sau3A I
`33,585
`34,697
`0.087
`1,112
`Cla I*
`33,589
`34,499
`0.033
`910
`EcoR V/BamH 1
`33,783
`34,627
`0.064
`844
`Hinf 1*
`33,589
`34,319
`0.048
`730
`EcoR V/Cvn I*
`33,783
`34,436
`0.094
`653
`Hinf 1/Rsa I
`33,686
`34,232
`_-
`526
`Nsi I
`in size between the band and the band immediately
`Diff. = The difference, M.
`below,calculated by the formula, M = logio(U)- logio(L), where U and L are the
`lengths in bp of the upper and lower, respectively, of the two bands being compared.
`*indicates enzyme combinations used in the first ladder but not used in the second
`ladder.
`
`5
`
`

`

`5,316,908
`
`7
`TABLE3
`
`DNAAnalysis Marker Ladder Target
`DNA Fragments, Second Kit
`Lambda Coordinates
`
`8
`7. Asystem as in claim 6, wherein adjacent target
`fragmentpairs differ in size by no more than a measure
`of about 0.075.
`8. A system as in claim 1, wherein adjacent target
`fragment pairs differ in size by at least a measure of
`about 0.025.
`9. A system as in claim 6, wherein adjacent target
`fragment pairs differ in size by at least a measure of
`about 0.025 and by no more than a measure of about
`0.075.
`10. A system as in claim 1, wherein the largest target
`fragment
`is at
`least 10-fold longer than the smallest
`target fragment.
`11. A system as in claim 10, wherein the largest target
`fragment
`is at
`least 14-fold longer than the smallest
`target fragment.
`12. A system as in claim 11, wherein thelargest target
`fragment is at
`least 17-fold longer than the smallest
`target fragment.
`13. A system as in claim 1, wherein the target frag-
`ments are derived from bacteriophageA.
`14. A system as in claim 13, wherein the target frag-
`ments may be detected with a probe having sequence
`present in or a sequence complementary to a sequence
`presentin nucleotides 33,783 to 34,212 of bacteriophage
`r.
`
`Dose
`Right
`Left
`Diff.
`Size
`Enzyme(s)
`3
`48,502
`25,881
`0.178
`22,621
`Sst I*
`3
`48,502
`33,498
`0.100
`15,004
`Xho I
`3
`44,248
`32,329
`0.102
`11,919
`NecoI/Bgl I*
`3
`36,895
`27,479
`0.056
`9,416
`Hind Ii
`3
`39,890
`31,619
`0.047
`8,271
`Sma I
`3
`39,168
`31,747
`0.061
`7,421
`EcoR I
`3
`39,004
`32,562
`0.041
`6,442
`Ava IE
`1
`34,720
`28,859
`0.034
`5,861
`Hae Il
`1
`39,004
`33,589
`0.060
`5,415
`EcoR V/AvaII
`1
`38,214
`33,498
`0.037
`4,716
`Aval
`1
`36,895
`32,562
`0.056
`4,333
`Ava II/Hind III*
`1
`36,374
`32,562
`3,812. 0.050
`Ava II/BstE
`1
`36,895
`33,498
`3,397
`0.040
`Xho [/Hind H*
`1
`34,720
`31,619
`3,101
`0.033
`Sma 1/Hae H
`1
`36,374
`33,498
`2,876
`0.036
`Xho I/BstE II
`1
`35,808
`33,158
`2,650
`0.037
`Nei I
`1
`36,113
`33,680
`2,433
`0.041
`NdeI
`1
`35,711
`33,498
`2,213
`0.041
`Xho I/Bgl Il*
`1
`35,261
`33,246
`2,015
`0.035
`Hine I]
`]
`35,450
`33,589
`1,861
`0.047
`EcoR V/Msp I
`1
`35,261
`33,589
`1,672
`0.028
`EcoR V/HincII*
`1
`34,436
`32,868
`1,568
`0.040
`Rsa I
`1
`35,003
`33,572
`1,431
`0.046
`Ssp I
`1
`34,436
`33,149
`1,287
`0.039
`Tha I/Rsa I*
`1
`34,499
`33,323
`1,176
`0.073
`Sau3A I
`15. A system as in claim 14, wherein the target frag-
`1
`34,719
`33,726
`993
`0.038
`Cfo I*
`ments include at Jeast 10 fragments are chosen from a
`1
`34,499
`33,589
`910
`0.065
`EcoR V/BamH I
`3
`34,319
`33,535
`784
`0.079
`Dde I*
`group of DNA fragments having sizes and ends of
`30
`3
`34,436
`33,783
`653
`0,094
`Hinf I/Rsa I
`11,203 bp Xba I/BglII, 9,416 bp Hind III, 8,271 bp Sma
`
`Nsi I 3OOeeneryeeDeereUeSee526 _ 33,686 34,212
`
`
`
`
`I, 7,421 bp EcoR I, 6,442 bp AvaII, 5,861 bp Hae II,
`Diff. = The difference, M.
`in size between the band and the band immediately
`5,415 bp EcoR V/AvaII, 4,716 bp AvaI, 4,333 bp Ava
`below, caculated by the formula M = logio(U) - logio(L), where U and L are the
`If/Hind HI, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
`jengthsin bp of the upper and lower, respectively, of the two bands being compared.
`“indicates enzyme combinations used in the second ladder but not used in thefirst
`ladder.
`II/BstE I, 3,599 bp Dra I, 3,397 bp Xho I/Hind III,
`3,101 bp Sma I/HaeII, 2,876 bp Xho I/BstE II, 2,650
`Dose refers to the relative amounts ofeach restriction digest.
`bp NeiI, 2,433 bp Nde I, 2,293 bp MspI, 2,213 bp Xho
`1/Bgl] I, 2,015 bp Hinc H, 1,861 bp EcoR V/MspI,
`_1,763 bp Xho I/Hinc HU, 1,672 bp EcoR V/Hinc II,
`1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamHI,
`1,287 bp Tha I/RsaI, 1,176 bp Sau3A I, 1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamHI, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/Cvn I, and 653 bp Hinf
`I/RsaI.
`16. A system as in claim 15, wherein the target frag-
`mentsinclude atleast 15 fragments and are chosen from
`a group of DNA fragments having sizes and ends of
`11,203 bp Xba I/Bg]H, 9,416 bp Hind III, 8,271 bp Sma
`I, 7,421 bp EcoR I, 6,442 bp AvaII, 5,861 bp HaeII,
`5,415 bp EcoR V/AvaII, 4,716 bp Ava I, 4,333 bp Ava
`Il/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
`II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III,
`3,101 bp Sma I/HaeII, 2,876 bp Xho I/BstE II, 2,650
`bp NciI, 2,433 bp Nde I, 2,293 bp MspI, 2,213 bp Xho
`1/Bgi Il, 2,015 bp Hinc II, 1,861 bp EcoR V/MspI,
`1,763 bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc II,
`1,568 bp Rsa IJ, 1,431 bp Ssp I, 1,342 bp Msp I/BamHI,
`1,287 bp Tha I/RsaI, 1,176 bp Sau3AI, 1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamHI, 844 bp Hinf I,
`784 bp DdeI, 730 bp EcoR V/CvnI, and 653 bp Hinf
`T/Rsa 1.
`17. A system as in claim 16, wherein the target frag-
`ments comprise at least 20 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 11,203 bp Xba I/Bgl II, 9,416 bp Hind Il, 8,271 bp
`SmaI, 7,421 bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae
`Il, 5,415 bp EcoR V/AvaI, 4,716 bp AvaI, 4,333 bp
`Ava II/Hind II, 4,045 bp Bgl 1/BstE II, 3,812 bp Ava
`H/BstE Il, 3,599 bp Dra I, 3,397 bp Xho IIHind III,
`
`5
`
`10
`
`15
`
`20
`
`25
`
`35
`
`45
`
`Whatis claimedis:
`1. A DNA marker system comprisingat least 5 DNA
`restriction endonuclease digests pooled together and a
`single nucleic acid probe, wherein
`(1) a DNArestriction endonucleasedigest is a collec-
`tion of DNA fragments resulting from digestion of
`a DNAbyoneor morerestriction endonucleases,
`(2) each restriction digest is obtained from the same
`DNA molecule;
`(3) each restriction digest contains a first DNA frag-
`ment complementary to said probe,
`(4)eachrestriction digest containsat least one second
`DNAfragment not complementaryto said probe,
`(35) the region of complementarity betweensaid probe
`and the first DNA fragment of each digest is a
`double stranded segmentof the first fragment, and
`(6) wherein when said DNA restriction digests are
`separated by electrophoresis and annealed to said
`probe, a detectably labeled DNA markerladderis
`obtained.
`2. A system as in claim 1, comprising at least 10 DNA
`restriction endonuclease digests pooled together.
`3. A system asin claim 2, comprising at least 15 DNA
`restriction endonuclease digests pooled together.
`4. A system as in claim 3, comprising at least 20 DNA
`restriction endonuclease digests pooled together.
`5. A system as in claim 4, comprising at least 25 DNA
`restriction endonuclease digests pooled together.
`6. A system as in claim 1, wherein adjacent target
`fragmentpairs differ in size by no more than a measure
`of about 0.1.
`
`60
`
`6
`
`

`

`9
`3,101 bp Sma IIHaeII, 2,876 bp Xho IIBstE HH, 2,650 bp
`NciI, 2,433 bp Nde I, 2,293 bp Msp I, 2,213 bp Xho
`1/Bgl Il, 2,015 bp Hinc II, 1,861 bp EcoR V/MspI,
`1,763 bp Xho I/Hinc H, 1,672 bp EcoR V/Hinc II,
`-1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamH I,
`1,287 bp Tha I/RsaI, 1,176 bp Sau3A I, 1,112 bp ClaI,
`993 bp Cfo I, 910 bp EcoR V/BamHI, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/CvnI, and 653 bp Hinf
`V/Rsa I.
`18. A system as in claim 17, wherein the target frag-
`ments comprise at least 25 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 11,203 bp Xba 1/Bg]II, 9,416 bp Hind III, 8,271 bp
`SmaI, 7,421 bp EcoRI, 6,442 bp AvaII, 5,861 bp Hae
`Il, 5,415 bp EcoR V/AvaII, 4,716 bp Ava I, 4,333 bp
`Ava II/Hind III, 4,045 bp Bgl I/BstE H, 3,812 bp Ava
`Il/BstE I, 3,599 bp Dra I, 3,397 bp Xho I/Hind II],
`3,101 bp Sma I/Hae I, 2,876 bp Xho I/BstE II,2,650
`bp NciI, 2,433 bp Nde I, 2,293 bp MspI, 2,213 bp Xho
`1/Bgl I, 2,015 bp Hinc II, 1,861 bp EcoR V/MspI,
`1,763 bp Xho I/Hinc I, 1,672 bp EcoR V/Hinc I,
`1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamHI,
`1,287 bp Tha I/RsaI, 1,176 bp Sau3A I,1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamHI, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/CvnI, and 653 bp Hinf
`T/RsaI.
`19. A system as in claim 17, wherein the target frag-
`ments comprise at least 25 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 9,416 bp Hind III, 8,271 bp SmaI, 7,421 bp EcoR I,
`6,442 bp AvaII, 5,861 bp HaeII, 5,415 bp EcoR V/Ava
`II, 4,716 bp AvaI, 4,333 bp Ava II/Hind III, 3,812 bp
`Ava II/BstE II, 3,397 bp Xho I/Hind III, 3,101 bp Sma
`1/HaeII, 2,876 bp Xho I/BstE II, 2,650 bp NeiI, 2,433
`bp NdeI, 2,213 bp Xho I/BglII, 2,015 bp HincII, 1,861
`bp EcoR V/MspI, 1,672 bp EcoR V/HincII, 1,568 bp
`Rsa I, 1,431 bp Ssp I, 1,287 bp Tha I/Rsa I, 1,176 bp
`Sau3AI, 993 bp Cfo I, 910 bp EcoR V/BamHI, 784 bp
`DdeI, and 653 bp Hinf I/RsaI.
`20. A system as in claim 19, wherein the target frag-
`ments havesizes and ends of 22,621 bp Sst I, 15,004 bp
`XhoI, 11,919 bp Nco I/Bgl!I, 9,416 bp Hind III, 8,271
`bp SmaI, 7,421 bp EcoR I, 6,442 bp Ava H, 5,861 bp
`HaeII, 5,415 bp EcoR V/AvaII, 4,716 bp AvaI, 4,333
`bp Ava II/Hind III, 3,812 bp Ava I/BstE HI, 3,397 bp
`Xho J/Hind III, 3,101 bp Sma I/HaeII, 2,876 bp Xho
`I/BstE II,2,650 bp NeiI, 2,433 bp Nde I, 2,213 bp Xho
`1/Bg! II, 2,015 bp Hinc IJ, 1,861 bp EcoR V/Msp I,
`1,672 bp EcoR V/HincII, 1,568 bp Rsa I, 1,431 bp Ssp
`I, 1,287 bp Tha I/RsaI, 1,176 bp Sau3A I, 993 bp Cfo I,
`910 bp EcoR V/BamHI, 784 bp DdeI, 653 bp Hinf
`T/RsaI, and 526 bp Nsi I.
`21. A system as in claim 1, wherein relative quantities
`of each fragmentis such that in a Southern blot hybridi-
`zation observed band intensities are uniform within a
`factor of 2.
`
`10
`22. A DNA markerkit comprising
`(a) a DNA marker system comprising at least 5 DNA
`restriction endonuclease digests pooled together,
`wherein
`is a
`(1) a DNArestriction endonuclease digest
`collection of DNA fragments resulting from
`digestion of a DNA by one or more restriction
`‘endonucleases,
`(2) eachrestriction digest is obtained from the same
`DNA molecule;
`(3) each restriction digest contains a first DNA
`fragment complementary to a probe,
`least one
`(4) each restriction digest contains at
`second DNA fragment not complementary to
`said probe,
`(5) the region of complementarity between said
`probeand the first DNA fragment of each digest
`is a double stranded segment ofthe first frag-
`ment, and
`(b) a first probe nucleic acid which is complementary
`to said first target DNA fragments;
`wherein when said DNArestriction digests are sepa-
`rated by electrophoresis and annealed to said probe, a
`detectably labeled DNA marker ladderis obtained.
`23. A kit as in claim 22, further comprising a second
`probe nucleic acid complementary to target DNAfrag-
`ments, wherein the first probe and the second probeare
`DNA,are complementary to each otherat their 3'-ends,
`and are not complementary to each other at their 5’-
`ends.
`24. A kit as in claim 22, wherein the sequence of the
`first probe is present in or is complementary to a se-
`quencepresentin nucleotides 33,783 to 34,212 of bacte-
`riophage A.
`25. A kit as in claim 22, further comprising an enzyme
`capable of labeling the probe.
`26. A kit as in claim 25, further comprising an enzyme
`capable of radioactively labeling the probe.
`27. A kit as in claim 25, wherein the enzyme isa DNA
`polymerase.
`28. A kit as in claim 27, wherein the enzymeis the
`Klenow fragment of E. coli DNA polymeraseI.
`29. A kit as in claim 25, wherein the enzymeis poly-
`nucleotide kinase.
`30. A DNA marker kit comprising the DNA marker
`system of claim 1 and a means for making a probe.
`31. A kit as in claim 30, wherein the means for making
`a probe is a means for making an RNA probe.
`32. A kit as in claim 31, wherein the means for making
`a probe comprises
`(a) a means-DNA, wherein the means-DNA com-
`prises probe sequences under control of a pro-
`moter, and
`(b) an RNA polymerase capable of initiating tran-
`scription from the promoterand transcribing probe
`sequences of the means-DNA.
`*
`*
`*
`*
`*
`
`5,316,908
`
`tn
`
`_ 5
`
`20
`
`45
`
`50
`
`55
`
`65
`
`7
`
`