MTX1057
`ModernaTX, Inc. v. CureVac AG
`IPR2017-02194
`
`1
`
`

`

`US. Patent
`
`May 31,1994
`
`'
`
`5,316,908
`
`‘ FIRST KIT
`
`SIZE POSITION
`
`
`
`SECOND KIT
`
`SIZE POSITION
`
`23994
`
`22621
`
`15004 —— 15004 —--
`
`-
`
`11203
`
`11919
`
`9416
`
`-——-
`
`9416 ——"'"'"
`
`8271 ——
`
`7421
`
`--———-
`
`6442 -—-
`
`8271
`
`7421
`
`6442
`
`5415
`
`--——
`
`5415
`
`--—--
`
`4715 —--—
`
`4045
`
`3812 —-—-
`3599 -"'"""
`3101 ——
`2876 —-——
`2650 —-
`2433 —____
`2293
`-———
`
`4716
`
`4333
`
`-———
`
`-———
`
`3812 ——-—
`3397 ——
`3101 —-———
`2876 ——-—
`2650 —-——
`2433
`..__...
`2213
`..__...
`
`2015 ——
`
`2015 ——-—-
`
`1753 ——
`
`1672 __...
`
`1431 ——
`1342 ——
`
`1431 —-—
`1287 —-—
`
`1112 _—
`
`910 ——
`
`910
`
`-—-—
`
`730 ——
`
`653
`
`-———-
`
`653 —-——
`
`784 _
`
`525 ..__
`
`526
`
`..'.__
`
`FIG.1
`
`2
`
`

`

`1
`
`5,316,908
`
`SIZE MARKERS FOR ELECTROPHORETIC
`ANALYSIS OF DNA
`
`FIELD OF THE INVENTION
`
`The present invention is in the field of molecular
`biology and specifically relates to the technique of gel
`electrophoresis of nucleic acid fragments.
`BACKGROUND OF THE INVENTION
`
`A number of mixtures of nucleic acid fragments are
`commercially available that can be used as markers for
`determining the sizes of nucleic acid molecules of exper-
`imental interest. For example, Collaborative Research,
`Inc.
`(Lexington, Mass.) has sold a marker ladder
`(“Quilt-Kit Size Markers”, cat. no. 30013) that is a mix-
`ture of 12 bacteriophage it (lambda) fragments. They
`are visualized by hybridization with two 32P-labeled
`12-nucleotide synthetic oligonucleotides, complemen-
`tary to the left and right bacteriophage cos sites.
`A large number of other DNA marker fragments are
`available from numerous suppliers. In every case, ex-
`cept the Collaborative markers, these marker fragments
`are restriction digests of several bacteriophage or plas—
`mid DNAS. Every DNA fragment in the digests can
`then be visualized by hybridization to the same bacte-
`riophage or plasmid DNAS.
`Other DNA marker ladders often use collections of
`
`fragments that have a quasi-random size distribution.
`For example, the quasi-random size distribution may be
`made by a digest of a DNA, often A DNA, by a single
`restriction enzyme. Alternatively, the fragments may
`vary linearly with molecular weight, i.e. adjacent bands
`may differ by about 1000 base pairs (e.g. “1 Kb DNA
`Ladder”, cat. no. 56lSSA, BRL, Gaithersburg, Md.)
`Bands in these linear ladders are not evenly spaced after
`electrophoresis, they are “compressed” in the “upper”,
`higher molecular weight region of a gel. However some
`ladders have been constructed and sold that are loga-
`rithmically spaced (“GenePrint TM ", cat. no. DGl9l l,
`Promega, Madison, Wis.).
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUMMARY OF THE INVENTION
`The drawback of conventional marker ladders is that
`
`45
`
`the signal generated by each fragment is proportional to
`its length. As a result, levels of signal that allow visual-
`ization of small fragments (e.g. 500 base pairs (bp)) give
`too much signal in large fragments (e.g. 20 kbp) for
`optimal resolution. This drawback is overcome in the
`marker ladder of the present invention.
`The invention consists of a “target DNA” and a
`“probe DNA”. Target DNA is constructed by pooling
`several restriction endonuclease digests of a single
`DNA of known sequence. Each restriction endonucle-
`ase digest generates a number of DNA fragments, one
`of which contains a specific sequence “S”. The restric-
`tion endonucleases and the sequence “S" are chosen so
`that the set of DNA fragments containing the same
`sequence “S” would give approximately a logarithmic
`distribution of lengths. In other words, when electro-
`phoresed through a gel where nucleic acid fragments
`migrate as a logarithmic function of molecular weight,
`the marker fragments will be approximately evenly
`spaced and will leave no molecular weight range with—
`out a marker. When the pooled, digested DNA is elec-
`trophoresed in a gel matrix, a ladder of fragments is
`
`50
`
`55
`
`65
`
`2
`generated containing sequence “S”, with approximately
`equal spacing between them.
`The probe DNA is complementary to sequence “S”,
`and therefore can be bound specifically to sequence “S”
`by nucleic acid hybridization. When the probe DNA is
`labeled (for example, with radioactive phosphorus, bio-
`tin, or alkaline phosphatase) it allows visualization of
`the DNA fragments containing sequence “S”.
`The present
`invention preferably utilizes internal
`labeling sites,
`thus allowing both ends of the DNA
`fragment
`to be altered by restriction endonuclease
`cleavage. Therefore, a greater variety of DNA frag-
`ment sizes can be generated.
`The present invention is expected to be useful to
`research laboratories employing DNA or RNA analysis
`techniques and it is especially useful to laboratories and
`law enforcement agencies using DNA analysis to iden-
`tify individuals.
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`FIG. 1 is a schematic, scale drawing of the how the
`first and second molecular marker kits would migrate
`on an electrophoretic gel. The positions were calculated
`by assuming that relative mobilities are a linear function
`of the logarithm of the length of the fragment in base
`pairs (bp). The length of each band in bp is indicated to
`the left of the band.
`
`DETAILED DESCRIPTION OF THE
`INVENTION
`
`The present invention is a DNA size marker system,
`preferably a DNA marker ladder, having pooled DNA
`restriction endonuclease digests. By the term “DNA
`marker ladder” is meant DNA fragments of varying
`sizes containing the sequence “5” that when electro-
`phoresed through a gel matrix migrate with approxi-
`mately equal spacing between them. “Equal spacing”
`may refer either to the physical location on a gel after
`electrophoresis (e.g. bands about 0.5 cm. apart) or to the
`size being marked (e.g. bands differing in size by 1,000
`bp). Each restriction digest contains at least one DNA
`fragment having an “S" sequence complementary to a
`probe and one or more other DNA fragments not com-
`plementary to the probe. The same probe is thus used
`for all restriction digests. The region of complementar-
`ity between the probe and the first DNA fragment of
`each digest is a double-stranded segment of the first
`fragment.
`The number of restriction digests pooled is at least 5,
`preferably at least 10, more preferably at least 15, yet
`more preferably at least 20, and most preferably at least
`25. In the present invention, the largest target fragment
`is at least lO-fold, preferably 14-fold, and most prefera~
`bly 17-fold, longer than the smallest target fragment.
`In some embodiments, target fragments most similar
`in size differ in length by defined amounts. As defined
`herein, the “measure”, M, of the difference in size is
`herein calculated by the formula M=log10(U)—-
`log10(L), where U and L are the respective lengths in bp
`of the upper and lower of the two adjacent bands being
`compared. This equation is equivalent to 10”=U/L. As
`a means of illustration, Table 1 shows the relationship
`between M, U, and L, (U and L are in hp) with the latter
`being held constant at 1,000 bp. Note that if U and L are
`both changed by the same factor or multiple, M remains
`constant. For example, bands of 1,059 bp and 1,000 bp
`and bands of 530 bp and 500 bp both differ in size by
`measures of 0.025.
`
`3
`
`

`

`3
`Preferably, target fragment pairs most similar in size
`differ in size by no more than a measure of about 0.1
`(e.g. bands of 1,259 bp and 1,000 bp), and, most prefera-
`bly, by no more than a measure of about 0.075 (e.g.
`bands of 1,188 bp and 1,000 bp). In other words, bands
`that after gel electrophoresis and Southern blotting
`would be adjacent to each other differ in size by no
`more than a measure of about 0.1. As exemplified
`herein, the target fragment pairs most similar in size
`differ in size by at least a measure of about 0.025 (e.g.
`bands of 1,059 bp and 1,000 bp).
`Preferably, the target fragments all anneal to a single
`probe sequence or its complement. More than one mo-
`lecular species may be in the probe, provided that each
`digest contains at least one fragment that can anneal to
`a probe molecule and at least one fragment that cannot
`anneal to a probe molecule. Although not meant to be
`limiting, as exemplified herein, the target fragments are
`derived from bacteriophage A. As also exemplified
`herein, the target fragments may be detected with a
`probe having sequence present in or a sequence comple-
`mentary to a sequence present in nucleotides 33,783 to
`34,212 of bacteriophage A.
`The present invention may further be included in a kit
`having,
`in addition to the target fragments, a probe
`nucleic acid complementary to target DNA fragments.
`As exemplified herein,
`the sequence of the probe is
`present in or is complementary to a sequence present in
`nucleotides 33,783 to 34,212 of bacteriophage A.
`The kit may further include an enzyme capable of
`radioactively labeling the probe, e.g. polynucleotide
`kinase or the Klenow fragment of E. coli DNA poly-
`merase I.
`
`Preferably, the target DNA is constructed from a
`single bacteriophage or plasmid. The target DNA pref-
`erably consists of at least 10 restriction endonuclease
`digests of that target DNA. Each restriction digest of
`the target DNA creates one fragment complementary
`to the probe DNA, and the lengths of these fragments
`may be distributed in a logarithmic array.
`Preferably, the probe DNA is supplied as a pair of
`synthetic oligonucleotides. Each of the probe oligonu-
`cleotides is preferably at least 20 nucleotides in length
`and are complementary to each other for 15 to 30 base
`pairs at their 3’-ends. These oligonucleotides can then
`be labeled by incorporation of labeled nucleotides in a
`chain extension reaction, with each oligonucleotidc
`serving as a primer and using the other as a template in
`the chain extension reaction. As an illustration, in the
`following arrangement the upper and lower case letters
`are complements of each other:
`
`S'abc. .
`
`. lmnopq3’
`3'OPQRST. .
`
`. XYZS’
`
`After chain extension with a labeled nucleotide, here
`indicated by underlining, the oligonucleotides will have
`the following structure:
`
`5’abc. .
`
`. lmnopqrst. .
`
`. xyzB’
`
`3'ABC. .
`
`. LMNOPQRST. .
`
`. XYZS'
`
`This structure can then be separated to form two probes
`labeled at their 3'-ends: 5’abc .
`.
`. lmnopqrst .
`.
`. xyz3’
`and 5'ZYX .
`.
`. TSRQPONML .
`.
`. CBA3’.
`The probe may be labeled with a radioisotope (e.g.
`3H, 32F, 35S, or 1251), a ligand (e.g. biotin), a hapten (e.g.
`
`65
`
`5,316,908
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`40
`
`45
`
`50
`
`55
`
`4
`dinitrophenol, fluorescein), or an enzyme (e.g. alkaline
`phosphatase, B-galactosidase, horseradish peroxidase,
`microperoxidase), or any other suitable labeling method
`known to or discovered by the art. The choice of label-
`ing method will generally depend on the chosen
`method for detecting the experimental sample for
`which the marker kit is serving as a molecular weight
`standard.
`A DNA marker kit of the present invention also in-
`clude a means for making a probe, instead of just a
`means for added labeled nucleotides, e.g. with DNA
`polymerase, or another labeled entity, e.g. 32P04 and
`kinase. This means may be a means for making an RNA
`probe. The means for making a probe may include being
`probe sequences under control of a promoter (i.e. a
`means-DNA). The kit could also include an RNA poly-
`merase capable of initiating transcription from the pro-
`moter and transcribing probe sequences of the means-
`DNA. Examples of such means-DNAS and RNA
`polymerases are well known in the art. For instance,
`DNA sequences downstream from SP6 promoters are
`commonly transcribed in vitro by SP6 RNA polymer-
`ase and sequences downstream from T7 promoters are
`commonly transcribed in vitro by T7 RNA polymerase.
`In an actual gel electrophoresis, the bands may not be
`spaced exactly as shown in FIG. 1 due to well known
`phenomena concerning mobility of very large and very
`small fragments, sample loading effects, and inhomoge-
`neities in the gel. With the use of the present invention,
`these effects can be detected more readily. Indeed, due
`to the way that DNA fragments run in 1.0% agarose
`gels, the largest (e.g. above 10 kbp) target fragments of
`the exemplified kits will appear more evenly spaced
`than as illustrated in FIG. 1.
`The DNA marker fragments should be hybridized
`with the probe, with the fragments which bind probe
`molecules being the fragments detected. When the total
`DNA of these ladder kits is inspected by non-specific,
`sequence-independent staining, e.g. with ethidium bro-
`mide, the ladder DNA may appear as a “smear” due to
`the multitude of fragments.
`Although specific restriction endonucleases are re-
`cited in the Examples and the Claims, it will be recog-
`nized that isoschizomers,
`i.e. enzymes that have the
`same recognition sequence but cut in a different fashion,
`can be substituted and the same result will be achieved.
`
`EXAMPLES
`
`Example 1: Common Materials and Methods
`
`E. coli bacteriophage )t (lambda) DNA (clind 1,
`ts857, Sam 7) was the source of all target DNAs.
`The probe DNA for either of the ladders exemplified
`herein may consist of any DNA from between nucleo-
`tides 33,783 and 34,212 of that A DNA. Oligonucleo-
`tides were synthesized using standard phosphoramidite
`chemistry well known to the art.
`To make a restriction digest, A DNA was digested
`with one or two restriction endonucleases. The en-
`zymes used for individual digests are indicated in Tables
`2 and 3. Digestions were performed under standard
`conditions, generally according to the instructions of
`the enzyme’s manufacturer. Restriction digests were
`pooled after digestion.
`
`Example 2: First Marker Kit
`
`the target DNA consisted of
`ladder,
`In the first
`pooled equal amounts of 31 different restriction digests
`
`4
`
`

`

`5
`of phage A DNA. The probe DNA was a 26-base oligo-
`nucleotide having a sequence of
`5'GCGACATTGCTCCGTGTATI‘CACTCG3'
`
`which is complementary to nucleotides 34,000 to 34,025
`of the standard A DNA map. This oligonucleotide was
`labeled at its 5'-end by T4 polynucleotide kinase and
`[7.32P]-ATP (BRL cat. no. 80605A, Life Technologies,
`Inc., Gaithersburg, Md.). Hybridization of 32P-labeled
`probe DNA to a Southern blot of the target DNA re-
`vealed bands of the expected pattern (FIG. 1). The
`restriction endonuclease digestions used, the sizes of the
`fragments generated thereby, the A sequence coordi-
`nates thereof, and the measures of the size differences
`between adjacent bands are listed in Table 2.
`
`Example 3: Second Marker Kit
`
`This first kit was improved in three ways. The first
`improvement was to change the probe DNA such that
`(a) it could easily be labeled with DNA polymerase as
`well as polynucleotide kinase, and (b) it would remain
`hybridized to the Southern blot even when washed at
`high temperature (65° C.) and low salt concentration
`(0.015M NaCl). This was achieved by utilizing two
`70-base, synthetic oligonucleotides that were comple-
`mentary to opposite strands of A DNA, and also com-
`plementary to one another for 15 bases at their 3’-ter-
`mini. The two oligonucleotides were as follows:
`
`5,316,908
`
`6
`and measures of the size differences between adjacent
`bands are listed in Table 3.
`
`Although the foregoing refers to particular preferred
`embodiments,
`it will be understood that the present
`invention is not so limited. It will occur to those of
`ordinary skill in the art that various modifications may
`be made to the disclosed embodiments and that such
`
`modifications are intended to be within the scope of the
`present invention, which is defined by the following
`Claims.
`
`TABLE 1
`
`
`
`Examples of Relationships between the Measure of the Difference
`in Size and Sizes of Framents.
` M U L
`
`0.0
`1,000
`1,000
`0.025
`1,059
`1,000
`0.05
`1,122
`1,000
`0.075
`1,188
`1,000
`0.1
`1,259
`1,000
`0.15
`1,413
`1,000
`0.2
`1,585
`1,000
`0.3
`1,995
`1,000
`0.5
`3,162
`1,000
`0.7
`5,012
`1,000
`
`1.0 1,000 10,000
`
`M =
`logMU) - logloa.) = Measure of the difference in size.
`U = S
`ize in bp of the upper band in a comparison.
`L 2 Size in bp of the lower band in a comparison. held constant at 1,000 bp.
`
`10
`
`15
`
`20
`
`25
`
`TABLE 2
`
`S’AGGCCACTATCAGGCAGCI I lG'lTGTTCTGI 1 1ACCAAGTTCTCTGGCAATCAT'TGCCGTCGTTCGTA'1'1‘3'
`
`S'AGCCTGAAGAAATG 1 I 1 CCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGC3‘
`
`The underlined segments are complementary to each
`other. The first oligonucleotide is encoded by sequences
`from coordinates 34,078 (5’-end) to 34,147 (3’-end) and
`the second oligonucleotide is encoded by sequences
`from 34,133 (3'-end) to 34,202 (5'-end) on the standard A
`map. These oligonucleotides were mixed together with
`each other and the Klenow fragment of E. coli DNA
`polymerase I and four deoxynucleotide triphosphates,
`one of which was a-32P—labelled. The polymerase ex-
`tended each oligonucleotide using the other as a tem-
`plate and produced two a-32P-labelled, complementary
`oligonucleotides. This new probe hybridizes to the
`same target fragments as the previous probe. A mixture
`of the new 70-mers was labeled with the large fragment
`of E. coli DNA polymerase I and hybridized to a South-
`ern blot of the target DNA.
`The second improvement was to change the target
`DNA to give a more linear spacing on the Southern
`blot.
`The third improvement was to increase the amounts,
`i.e. relative copy number or the dosage, of the target
`DNA for the largest and smallest bands. Large DNA
`fragments blot inefficiently. As is well known in the art,
`small fragments are retained on membranes poorly dur~
`ing hybridization. Therefore,
`the signal
`from large
`DNA fragments and small DNA fragments tends to be
`less than the signal from bands in the middle range. This
`improvement compensated for that effect.
`Hybridization of 32P-labeled probe DNA to a South-
`ern blot of the target DNA revealed bands of the ex-
`pected pattern (FIG. 1). The restriction endonuclease
`digestions and dosage used, the sizes of the fragments
`generated thereby, the A sequence coordinates thereof,
`
`45
`
`50
`
`55
`
`65
`
`DNA Analvsis Marker Ladder Target DNA Fragments. First Kit
`Lambda Coordinates
`Left.
`Right
`Diff,
`Size
`Enzyme(s)
`24,508
`48,502
`0.204
`23,994 '
`Xba 1’
`33,498
`48,502
`0.127
`15,004
`Xho 1
`24,508
`35,711
`0.075
`11,203
`Xba I/Bgl 11‘
`27,479
`36,895
`0.056
`9,416
`Hind 111
`31,619
`39,890
`0.047
`8,271
`Sma 1
`31.747
`39,168
`0.061
`7,421
`ECOR 1
`32,562
`39,004
`0.041
`6,442
`Ava 11
`28,859
`34,720
`0.034
`5,861
`Hae 11
`33,589
`39,004
`0.060
`5,415
`ECOR V/Ava 11
`33,498
`38,214
`0.067
`4,716
`Ava I
`32,329
`36,374
`0.026
`4,045
`Bgl I/BStE 11‘
`32,562
`36,374
`0.025
`3,812
`Ava II/BStE 11
`32,705
`36,304
`0.065
`3,599
`Dfa 1‘
`31,619
`34,720
`0.033
`3,101
`Sma l/Hae 11
`33,498
`36,374
`0.036
`2,876
`X110 I/BStE 11
`33,158
`35,808
`0.037
`2,650
`Nci 1
`33,680
`36,113
`0.026
`2,433
`Nde 1
`33,157
`35,450
`0.056
`2,293
`Msp 1’
`33,246
`35,261
`0.035
`2,015
`Him: 11
`33.589
`35,450
`0.023
`1,861
`ECOR V/Msp I
`33,498
`35,261
`0.051
`1,763
`Xho I/Hinc 11’
`32,868
`34,436
`0.040
`1,568
`Rsa I
`33,572
`35,003
`0.028
`1,431
`Ssp I
`33,157
`34,499
`0.057
`1,342
`Msp I/BamH 1‘
`33,323
`34,499
`0.024
`1,176
`Sau3A 1
`33,585
`34,697
`0.087
`1,112
`C18 1‘
`33,589
`34,499
`0.033
`910
`ECOR V/BamH 1
`33,783
`34,627
`0.064
`844
`1'1in 1‘
`33,589
`34,319
`0.048
`730
`ECOR V/Cvn 1’
`33,783
`34,436
`0.094
`653
`Hinf I/Rsa I
`
`Nsi 1 34,212 526 — 33,686
`
`
`
`Diff. = The difference. M.
`in size between the band and the band immediately
`below. calculated by the formula, M = loglo(U) - logML), where U and L are the
`lengths in bp ofthe upper and lower. respectively. ofthe two bands being compared.
`'indicates enzyme combinations used in the first ladder but not used in the second
`ladder.
`
`5
`
`

`

`5,316,908
`
`8
`
`7
`TABLE 3
`-——__.____.__________
`
`DNA Analysis Marker Ladder Target
`DNA Fragments. Second Kit
`Lambda Coordinates
`—___.__—____________
`Enzyme(s)
`Size
`Diff.
`Left
`Right
`Dose
`Sst I‘
`22,621
`0.178
`25,881
`48,502
`3
`Xho 1
`15,004
`0.100
`33,498
`48,502
`3
`Nco I/Bgl 1'
`11,919
`0.102
`32,329
`44,248
`3
`Hind 111
`9,416
`0.056
`27,479
`36,895
`3
`Sma I
`8,271
`0.047
`31,619
`39,890
`3
`EcoR 1
`7,421
`0.061
`31,747
`39,168
`3
`Ava 11
`6,442
`0.041
`32,562
`39,004
`3
`Hae II
`5,861
`0.034
`28,859
`34,720
`1
`EcoR V/Ava 11
`5,415
`0.060
`33,589
`39,004
`1
`Ava I
`4,716
`0.037
`33,498
`38,214
`1
`Ava Il/Hind 111‘
`4,333
`0.056
`32,562
`36,895
`1
`Ava II/BstE 11
`3,812 . 0.050
`32,562
`36,374
`1
`Xho I/Hind 111‘
`3,397
`0.040
`33,498
`36,895
`1
`Sma I/Hae 11
`3,101
`0.033
`31,619
`34,720
`1
`X110 I/BstE 11
`2,876
`0.036
`33,498
`36,374
`1
`Nci I
`2,650
`0.037
`33,158
`35,808
`1
`Nde I
`2,433
`0.041
`33,680
`36,113
`1
`Xho I/Bgl II‘
`2,213
`0.041
`33,498
`35,711
`1
`Hinc 11
`2,015
`0.035
`33,246
`35,261
`1
`EcoR V/Msp 1
`1,861
`0.047
`33,589
`35,450
`1
`Beck V/Hinc 11‘
`1,672
`0.028
`33,589
`35,261
`1
`Rsa I
`1,568
`0.040
`32,868
`34,436
`1
`Ssp I
`1,431
`0.046
`33,572
`35,003
`1
`Tha l/Rsa 1‘
`1,287
`0.039
`33,149
`34,436
`1
`Sau3A I
`1,176
`0.073
`33,323
`34,499
`1
`Cfo 1‘
`993
`0.038
`33,726
`34,719
`1
`EcoR V/Baml-I 1
`910
`0.065
`33,589
`34,499
`1
`Dde 1‘
`784
`0.079
`33,535
`34,319
`3
`Hinf l/Rsa I
`653
`0.094
`33,783
`34,436
`3
`
`Nsi I 3 526 — 33.686 34,212
`
`
`
`
`Diff. = The difference. M.
`in size between the band and the band immediately
`below, caculated by the formula M = logm(U) - logML), where U and L are the
`lengths in by ofthe upper and lower, respectively, of the two bands being compared.
`‘indicates enzyme combinations used in the second ladder but not used in the first
`ladder.
`Dose refers to the relative amounts of each restriction digest.
`
`What is claimed is:
`
`1. A DNA marker system comprising at least 5 DNA
`restriction endonuclease digests pooled together and a
`single nucleic acid probe, wherein
`(1) a DNA restriction endonuclease digest is a collec-
`tion of DNA fragments resulting from digestion of
`a DNA by one or more restriction endonucleases,
`(2) each restriction digest is obtained from the same
`DNA molecule;
`(3) each restriction digest contains a first DNA frag-
`ment complementary to said probe,
`(4) each restriction digest contains at least one second
`DNA fragment not complementary to said probe,
`(5) the region of complementarity between said probe
`and the first DNA fragment of each digest is a
`double stranded segment of the first fragment, and
`(6) wherein when said DNA restriction digests are
`separated by electrophoresis and annealed to said
`probe, a detectably labeled DNA marker ladder is
`obtained.
`
`2. A system as in claim 1, comprising at least 10 DNA
`restriction endonuclease digests pooled together.
`3. A system as in claim 2, comprising at least 15 DNA
`restriction endonuclease digests pooled together.
`4. A system as in claim 3, comprising at least 20 DNA
`restriction endonuclease digests pooled together.
`5. A system as in claim 4, comprising at least 25 DNA
`restriction endonuclease digests pooled together.
`6. A system as in claim 1, wherein adjacent target
`fragment pairs differ in size by no more than a measure
`of about 0.1.
`
`7. A, system as in claim 6, wherein adjacent target
`fragment pairs differ in size by no more than a measure
`of about 0.075.
`
`5
`
`8. A system as in claim 1, wherein adjacent target
`fragment pairs differ in size by at least a measure of
`about 0.025.
`
`9. A system as in claim 6, wherein adjacent target
`fragment pairs differ in size by at least a measure of
`about 0.025 and by no more than a measure of about
`0.075.
`
`10. A system as in claim 1, wherein the largest target
`fragment
`is at
`least
`lO-fold longer than the smallest
`target fragment.
`11. A system as in claim 10, wherein the largest target
`fragment
`is at
`least 14-fold longer than the smallest
`target fragment.
`12. A system as in claim 11, wherein the largest target
`fragment is at
`least 17-fold longer than the smallest
`target fragment.
`13. A system as in claim 1, wherein the target frag-
`ments are derived from bacteriophage A.
`14. A system as in claim 13, wherein the target frag-
`ments may be detected with a probe having sequence
`present in or a sequence complementary to a sequence
`present in nucleotides 33,783 to 34,212 of bacteriophage
`7t.
`
`10
`
`15
`
`20
`
`25
`
`35
`
`30
`
`15. A system as in claim 14, wherein the target frag-
`ments include at least 10 fragments are chosen from a
`group of DNA fragments having sizes and ends of
`11,203 bp Xba I/Bgl II, 9,416 bp Hind 111, 8,271 bp Sma
`I, 7,421 bp EcoR I, 6,442 bp Ava 11, 5,861 bp Hae II,
`5,415 bp EcoR V/Ava II, 4,716 bp Ava I, 4,333 bp Ava
`II/I-Iind 111, 4,045 bp Bgl I/BstE 11, 3,812 bp Ava
`II/BstE 11, 3,599 bp Dra I, 3,397 bp Xho I/Hind 111,
`3,101 bp Sma I/Hae 11, 2,876 bp Xho I/BstE 11, 2,650
`bp Nci I, 2,433 bp Nde I, 2,293 bp Msp I, 2,213 bp Xho
`I/Bgl 11, 2,015 bp Hinc II, 1,861 bp EcoR V/Msp I,
`.. 1,763 bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc 11,
`1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamH I,
`40 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/Cvn I, and 653 bp Hinf
`I/Rsa I.
`
`45
`
`50
`
`55
`
`16. A system as in claim 15, wherein the target frag—
`ments include at least 15 fragments and are chosen from
`a group of DNA fragments having sizes and ends of
`11,203 bp Xba I/Bgl II, 9,416 bp Hind III, 8,271 bp Sma
`I, 7,421 bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae 11,
`5,415 bp EcoR V/Ava II, 4,716 bp Ava I, 4,333 bp Ava
`II/I-Iind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
`II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III,
`3,101 bp Sma I/I-Iae II, 2,876 bp Xho I/BstE 11, 2,650
`bp Nci I, 2,433 bp Nde I, 2,293 bp Msp I, 2,213 bp Xho
`I/Bgl II, 2,015 bp Hinc 11, 1,861 bp EcoR V/Msp I,
`1,763 bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc 11,
`1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamH I,
`1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamI—I I, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/Cvn I, and 653 bp Hinf
`I/Rsa I.
`
`17. A system as in claim 16, wherein the target frag-
`ments comprise at least 20 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 11,203 bp Xba I/Bgl II, 9,416 bp Hind 111, 8,271 bp
`Sma I, 7,421 bp EcoR I, 6,442 bp Ava II, 5,861 bp Hae
`11, 5,415 bp EcoR V/Ava 11, 4,716 bp Ava I, 4,333 bp
`Ava II/Hind III, 4,045 bp Bgl I/BstE II, 3,812 bp Ava
`II/BstE 11, 3,599 bp Dra I, 3,397 bp Xho IlHind III,
`
`6
`
`

`

`5,316,908
`
`10
`
`9
`3,101 bp Sma III-Iae 11, 2,876 bp Xho IIBstE II, 2,650 bp
`Nci I, 2,433 bp Nde I, 2,293 bp Msp I, 2,213 bp Xho
`I/Bgl II, 2,015 bp Hinc 11, 1,861 bp EcoR V/Msp I,
`1,763 bp Xho I/Hinc II, 1,672 bp EcoR V/Hinc 11,
`.1,568 bp Rsa I, 1,431 bp Ssp I, 1,342 bp Msp I/BamH I,
`1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 1,112 bp Cla I,
`993 bp Cfo I, 910 bp EcoR V/BamH I, 844 bp Hinf I,
`784 bp Dde I, 730 bp EcoR V/Cvn I, and 653 bp Hinf
`I/Rsa I.
`
`22. A DNA marker kit comprising
`(a) a DNA marker system comprising at least 5 DNA
`restriction endonuclease digests pooled together,
`wherein
`
`is a
`(l) a DNA restriction endonuclease digest
`collection of DNA fragments resulting from
`digestion of a DNA by one or more restriction
`'endonucleases,
`(2) each restriction digest is obtained from the same
`DNA molecule;
`(3) each restriction digest contains a first DNA
`fragment complementary to a probe,
`least one
`(4) each restriction digest contains at
`second DNA fragment not complementary to
`said probe,
`(5) the region of complementarity between said
`probe and the first DNA fragment of each digest
`is a double stranded segment of the first frag-
`ment, and
`(b) a first probe nucleic acid which is complementary
`to said first target DNA fragments;
`wherein when said DNA restriction digests are sepa-
`rated by electrophoresis and annealed to said probe, a
`detectably labeled DNA marker ladder is obtained.
`23. A kit as in claim 22, further comprising a second
`probe nucleic acid complementary to target DNA frag-
`ments, wherein the first probe and the second probe are
`DNA, are complementary to each other at their 3'-ends,
`and are not complementary to each other at their 5'-
`ends.
`24. A kit as in claim 22, wherein the sequence of the
`first probe is present in or is complementary to a se—
`quence present in nucleotides 33,783 to 34,212 of bacte-
`riophage )t.
`25. A kit as in claim 22, further comprising an enzyme
`capable of labeling the probe.
`26. A kit as in claim 25, further comprising an enzyme
`capable of radioactively labeling the probe.
`27. A kit as in claim 25, wherein the enzyme is a DNA
`polymerase.
`28. A kit as in claim 27, wherein the enzyme is the
`Klenow fragment of E. calf DNA polymerase I.
`29. A kit as in claim 25, wherein the enzyme is poly-
`nucleotide kinase.
`30. A DNA marker kit comprising the DNA marker
`system of claim 1 and a means for making a probe.
`31. A kit as in claim 30, wherein the means for making
`a probe is a means for making an RNA probe.
`32. A kit as in claim 31, wherein the means for making
`a probe comprises
`(a) a means--,DNA wherein the means-DNA com-
`prises probe sequences under control of a pro—
`moter, and
`(b) an RNA polymerase capable of initiating tran-
`scription from the promoter and transcribing probe
`sequences of the means-DNA.
`*
`t
`t
`t
`t
`
`15
`
`20
`
`25
`
`18. A system as in claim 17, wherein the target frag- 10
`ments comprise at least 25 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 11,203 bp Xba I/Bgl 11, 9,416 bp Hind III, 8,271 bp
`Sma I, 7,421 bp EcoR I, 6,442 bp Ava 11, 5,861 bp Hae
`II, 5,415 bp EcoR V/Ava 11, 4,716 bp Ava I, 4,333 bp
`Ava II/Hind 111, 4,045 bp Bgl I/BstE 11, 3,812 bp Ava
`II/BstE II, 3,599 bp Dra I, 3,397 bp Xho I/Hind III,
`3,101 bp Sma I/Hae 11, 2,876 bp Xho I/BstE 11, 2,650
`bp Nci I, 2,433 bp Nde I, 2,293 bp Msp I, 2,213 bp Xho
`I/Bgl II, 2,015 bp Hinc 11, 1,861 bp EcoR V/Msp I,
`1,763 bp Xho I/Hinc II,1,672 bp EcoR V/Hinc II,
`1, 568 bp Rsa I 1,431 bp Ssp I 1, 342 bp Msp I/BamH I
`1,287 bp Tha I/Rsa I 1,176 bp Sau3A I 1,112 bp Cla I
`993 bp Cfo 1,910 bp EcoR V/BamH 1,844 bp Hian,
`784 bp Dde I, 730 bp EcoR V/Cvn I, and 653 bp Hinf
`I/Rsa I.
`19. A system as in claim 17, wherein the target frag-
`ments comprise at least 25 fragments and are chosen
`from a group of DNA fragments having sizes and ends
`of 9,416 bp Hind 111, 8,271 bp Sma I, 7,421 bp EcoR I,
`6,442 bp Ava 11, 5,861 bp Hae 11, 5,415 bp EcoR V/Ava
`11, 4,716 bp Ava I, 4,333 bp Ava II/l-lind III, 3,812 bp
`Ava II/BstE II, 3,397 bp Xho I/Hind III, 3,101 bp Sma
`I/Hae II, 2,876 bp Xho I/BstE 11, 2,650 bp Nci I, 2,433
`bp Nde I, 2,213 bp Xho I/Bgl 11, 2,015 bp Hinc 11, 1,861
`bp EcoR V/Msp I, 1,672 bp EcoR V/Hinc 11, 1,568 bp
`Rsa I, 1,431 bp Ssp I, 1,287 bp Tha I/Rsa I, 1,176 bp
`Sau3A I, 993 bp Cfo I, 910 bp EcoR V/BamH I, 784 bp
`Dde I, and 653 bp Hinf I/Rsa I.
`20. A system as in claim 19, wherein the target frag-
`ments have sizes and ends of 22,621 bp Sst 1, 15,004 bp
`Xho I, 11,919 bp Nco I/Bgl I, 9,416 bp Hind III, 8,271
`bp Sma I, 7,421 bp EcoR I, 6,442 bp Ava II, 5,861 bp
`Hae II, 5,415 bp EcoR V/Ava II, 4,716 bp Ava I, 4,333
`bp Ava II/Hind 111, 3,812 bp Ava II/BstE 11, 3,397 bp
`Xho I/Hind III, 3,101 bp Sma I/I-Iae 11, 2,876 bp Xho
`I/BstE II, 2,650 bp Nci I, 2,433 bp Nde I, 2,213 bp Xho
`I/Bgl 11, 2,015 bp Hinc 11, 1,861 bp EcoR V/Msp I,
`1,672 bp EcoR V/Hinc 11, 1,568 bp Rsa I, 1,431 bp Ssp
`I, 1,287 bp Tha I/Rsa I, 1,176 bp Sau3A I, 993 bp Cfo I,
`910 bp EcoR V/BamH I, 784 bp Dde I, 653 bp Hinf
`I/Rsa I, and 526 bp Nsi I.
`21. A system as in claim 1, wherein relative quantities
`of each fragment is such that in a Southern blot hybridi-
`zation observed band intensities are uniform within a
`factor of 2.
`
`30
`
`35
`
`45
`
`50
`
`55
`
`'65
`
`7
`
`