.:
`
`"a?- re of‘a r" ”u ’
`
`I." :-
`
`-diting
`
`m
`
`1
`
`MTX1041
`
`

`

`
`
`
`
`A PUBLICATION OF THE RNA SOCIETY
`
`REVIEWS EDITOR
`
`Thomas R. Cech
`Howard Hughes Medical institute
`
`Eric Westhof
`CNRS, Strasbourg
`
`Marvin Wickens
`University of Wisconsin, Madison
`
`
`
`ASSOCIATE EDITORS
`
`Christine Guthrie
`University of California. San Francisco
`
`Reinhard Liihrmann
`t‘fitL’trPifltlcltrllISil-Iiife for Biophysical Chemistry, Gfittingen
`
`Daniel Kolakofsky
`University of Geneva
`
`Rob Singer
`Albert Einstein School ofMea'icine
`
`loan A. Steitz
`Yale University
`Robert Zimmermann
`University of Massachusetts
`
`EDITORIAL BOARD
`
`John N. Abelson
`California institute of Technology
`
`Sidney Altman
`Yale University
`Manuel Ares
`University of California, Santa Cruz
`Brenda L. Bass
`University of Utah
`
`Susan Berget
`Baylor College of Medicine
`
`Douglas L. Black
`University of Califiirnia, Los Angeles
`Thomas Blumenthal
`University of Colorado
`
`Richard Brimacombe
`ll'lnx-Planckslnstitnte, Berlin
`
`David A. Brow
`University of l'Visconsin, Madison
`
`lames E. Dahlberg/I di a [50"
`University of Wisconsin,
`
`Gideon Dreyfuss
`University ofPennsylvania
`Fritz Eckstein
`Max-Planckelnstitnte, Gettingen
`
`Carol Fierke
`University of Michigan
`Witold Fili owicz
`Friedrich Miesc er Institute
`
`Raymund F. Gesteland
`University of Utah
`
`Kathleen B. Hall
`Washington University
`Matthias W. Hentze
`EMBL, Heidelberg
`
`Daniel Herschlag
`Stanford University
`
`Allan lacobson
`University of Massachusetts
`Walter Keller
`University of Basel
`
`Adrian R. Krainer
`Cold Spring Harbor Laboratory
`
`Angela Kramer
`Université tie Geneva
`
`Alan M. Lambowitz
`University of Texas at Austin
`
`David MJ. Lilley
`University of Dundee
`
`Thomas Maniatis
`Ha rvartl' University
`
`lames Manley
`Columbia University
`
`L nne E. Maquat
`niversity of Rochester
`
`lain W. Mattaj
`EMBL, Heidelberg
`William McClain
`University of Wisconsin. Madison
`Dino Moras
`CNRS. Strasbourg
`
`Andrew Newman
`M'RC Laboratory of Molecular Biology
`
`Harry F. Noller
`University of California. Santa Cruz
`Norman R. Pace
`University of Colorado
`
`Roy Parker
`University of Arizona
`
`Philip S. Perlman
`University of Texas Southwestern
`
`Anna Marie Pyle
`Columbia University
`
`Michael Rosbash
`Brandeis University
`
`Philli A. Sharp
`Massnc inserts institute of Technology
`
`Nahum Sonenberg
`McGill University
`
`Nancy Standart
`Cambridge University
`
`David Tollervey
`University of Edinburgh
`
`Olke C. Uhlenbeck
`North western University
`
`Alan M. Weiner
`University of lit/astrington
`
`Sandra L. Wolin
`Yale University
`
`James R. Williamson
`The Scripps Research Institute
`
`Sarah A. Woodson
`Johns Hopkins University
`
`PRODUCTION ASSISTANT
`PRODUCTION MANAGER
`EDITORIAL ASSISTANT
`Ann Marie Micenmacher
`Mary Mulligan
`Linda Sussman
`Case Western Reserve University
`Cold Spring Harbor Laboratory Press
`Cold Spring Harbor Laboratory Press
`'——————“—*
`
`Editorial Office: RNA, Center for RNA Molecular Biology, Room W1 13, School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH
`441064973, USA. Telephone: 21666671852; Fax: 216-368-2010,- Email: rnaiournal®cwru.edu.
`Publishing and Advertising Offices: Cold Spring Harbor Laboratory Press,
`1 Bungtown Road, Cold Spring Harbor, New York 11724-2203. For advertising rates and data,
`contact Marcie Siconolfi, Advertising Manager, at 5l6-422—4010 (telephone) or 516—422-4092 (fax).
`Instructions for Authors: instructions for authors are published in each issue of RNA and are available on the World Wide Web (httpJ/wwwmajournalprg).
`Books for Review: Publications should be sent to Timothy Nilsen, Center for RNA Molecular Biology, Room W113, School of Medicine, Case Western Reserve University,
`Cleveland, OH 441064973, USA. Readers are encouraged to draw to his attention publications that may be of interest to other readers of RNA.
`Subscriptions: Published monthly. Subscribers have a choice of “onlihe only” or "print + online” subscriptions for this journal. Institutions: Online only: $660; Print +
`Online: US. $760, Canada and Mexico $816, R.O.W. $840. Personal rate (must be paid by check, credit card, or money order): Onllne only: $210; Print + Online: U.S.
`$260, Canada and Mexico $316, R.O.W. $340. Contact Kathleen Cirone, Subscription Manager, Fulfillment Department, 500 Sunnyside Boulevard, Woodbury, New
`York 1179772924. Telephone: Continental US, and Canada 1—800-843-4368; all other locations 5164224100. Fax: 516-422-4097. Claims for missing issues must be
`received within four months of issue date.
`
`Member Subscriptions: Members ot the RNA Society automatically receive RNA as part of their annual membership dues.
`The RNA Society: Membership information and application forms may be obtained from: The RNA Society, 9650 Rockville Pike, Bethesda, MD 208143998, USA.
`Telephone: 301530-7120: Fax: 301-530—7049,- Eimail: rna@faseb.org.
`
`All rights reserved. No part nithis publication may be reproduced, in any form or by any means, electronic, photocopying or otherwise, wilhout permission in writing from Cold Spring Harbor Laboratory
`Press, except when permission is oblalned through a bona fide copyright clearinghouse, such as the Copyright Clearance Center (USA) or the Copyright Licensing Agency (UK). The CCC ItemeFee Code
`for this publication is 1355-3382/01 $12.50. Specific written permission may be obtained for all other copying. Photocopying for Classroom Use: Permission to reproduce parts of lhls publication for
`course anthologies may he obtained directly from Cold Spring Harbor Laboratory Pre55 or Ihrough duly authorized services such as the Academic Permissions Service of the CCC, 222 Rosewood Drive,
`Danvers, MA 01923 (Telephone 978775078400) and the Copyright Permissions Service of the National Association of College Stores, or through any photoduplication service that properly secures
`permission irom Cold Spring Harbor Laboratory Press or the CCC,
`
`Periodicals postage paid at Woodbury, NY, and additional mailing oilices. Forwarding and Return Postage Guaranteed: Address Correction Requested, Postmaster: Send address changes in the USA
`and Canada to: RNA, Cold Spring Harbor Laboratory Press, Journals Fulfillment Dept., 500 Sunnyside Blvd, Woodbury, NY 11797-2924.
`Copyright © 2004 The RNA Society
`
`2
`
`

`

`
`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`
`METHOD
`
`
`A general method for rapid and
`nondenaturing purification of RNAs
`
`
`
`
`
`JEFFREY s. KIEFT1'3 and ROBERT T. spinner3
`lDepartment oi Biochen'iistry and Molecular Genetics, University of Colorado Health Sciences Center, Denver, Colorado 80262, USA
`3Department oi Chemistry and Biochemistry, University of Colorado, Boulder, Boulder, Colorado 80309, USA
`
`ABSTRACT
`
`A key bottleneck in RNA structural studies is preparing milligram quantities of RNA, and current techniques have changed little
`in over a decade. To address this, we have developed an affinity tag-based purification method of RNA oligonucleotides. The
`tag is attached to the 3'-end of almost any desired RNA sequence, allowing for the rapid and specific removal of the RNA of
`interest directly from in vitro transcription reactions using an affinity column to which a specific RNA-binding protein has been
`attached. Following a wash, the RNA of interest is eluted by the addition of imidazole to the column, activating a mutant HBV
`ribozyme incorporated into the tag. The affinity column can then be rapidly regenerated using conditions that release the
`protein—RNA tag interaction without denaturing the protein. To demonstrate that this method rapidly generates high-quality
`RNA, we have transcribed, purified, and generated diffraction-quality crystals of a mutant form of the Tetrahymena thermophiia
`P4—P6 domain in a 48-h time period.
`
`Keywords: RNA purification; affinity tag; X-ray crystallography; NMR spectroscopy; structural genoniics
`
`INTRODUCTION
`
`Discoveries of RNA interference (RNAi), small regulatory
`RNAs, and cis—acting RNA control elements highlight the
`central role RNA plays in gene expression. Furthermore, in
`the biotechnology sector RNA remains a focus for thera
`peutic design, including a new generation ofantibiotics that
`bind the ribosomal RNA, and antiviral agents that target
`human immunodeficiency virus (HIV) and hepatitis C vie
`rus (HCV) RNAs. To understand and to therapeutically
`these diverse RNAS, we require a much deeper
`knowledge of RNA structure. Of particular importance are
`new tools to aid in the synthesis and purification of large
`quantities of RNA, as this remains a significant bottleneck
`in many structural and biophysical studies (Doudna 2000).
`The most common means of synthesizing RNA is by T7
`
`
`
`3These authors contributed equally to this work.
`Reprint requests to: Jeffrey S. Kieft, Department of Biochemistry and
`Molecular Genetics. University of Colorado Health Sciences Center, Dene
`ver, CO 80262, USA; camail: 7icffrcy.kieft@uclisc.cdu; fax: (303) SIS-82H;
`or Robert T. Batey, Department of Chemistry and Biochemistry, University
`of Colorado, Boulder, Boulder. CO 80309, USA: eemail: Robert.Batey@
`coloradoedu; fax: (303) 735—1347.
`Abbreviations: HBV. hepatitis delta virus; SRP, signal recognition par
`ticle; RAV, RNA affinity vector; HCV, hepatitis C virus;
`lRES, internal
`
`RNA polymerase-catalyzed in vitro run—offtranscription of
`a DNA template (Milligan et al. 1987; Doudna 1997). Al~
`though T7 RNA polymerase tends to add extra nucleotides
`to the 3’—end of the desired RNA (Milligan et a]. 1987;
`Draper et al. 1988; Pleiss et al. 1998), this problem has been
`largely overcome through the use of cis-acting ribozymes at
`the 5’~ and 3’—ends ofthe RNA of interest (Price et al. 1995;
`Ferre-D’Amare and Doudna 1996) or through the use of
`synthesized, partially 2'-O—methyl—modified DNA tem—
`plates (Kao et a1. 1999). The transcription product RNAs
`are purified by preparative denaturing polyactylamide gel
`electrophoresis, eluted from the gel matrix, concentrated,
`and refolded. Using this denaturing method, synthesis and
`purification of structural quantities of a single RNA sample
`(10—20 mg) typically requires >1 wk and thus is not well
`suited to high throughput. For many RNAs, significant time
`is Spent optimizing refolding conditions to minimize un—
`productive conformations. Some well-known RNAs, such
`as Escherichia coli tRNAPh", cannot be refolded into a con-
`
`formationally homogeneous and active population (Uhlen-
`beck 1995). In some cases, this is overcome by a native purie
`fication technique, usually involving a combination of anion
`exchange and gel filtration chromatography. Other RNA pur
`rification procedures have been developed,
`including those
`based on HPLC (Anderson et al. 1996; Shields et al. 1999).
`
`3
`
`

`

`pletely generalized for the production of any desired RNA
`(Fig. 1). This technique is rapid, allows for parallel purifi-
`cation of multiple RNA samples, can be used with any size
`or sequence of RNA, and applies to both small (<1 mL) and
`large—scale (<10 mL) transcription reactions. The affinity
`tag contains two elements: a variant of the hepatitis delta
`virus (HEN) ribozyme that is activated by imidazole and a
`hairpin loop from a thermostable SRP RNA that forms a
`high-affinity and kinetically stable complex with the Titer-
`motoga maritimn th-M domain protein. The tag is incor-
`porated on the 3’—end of the target RNA during transcrip—
`tion. The target RNArtag chimera is retained on an affinity
`column to which the partner protein has been attached,
`whereas incomplete abortive transcripts, nucleotides, DNA
`template, and other reaction components pass through. The
`target RNA is eluted by adding imidazole, which activates
`the ribozyme and liberates the RNA of interest. To demon—
`strate the utility of this procedure, we purified a mutant
`version of the PAL—P6 domain of the Tetitiitymenn titermoe
`piiiin group I intron and readily obtained diffraction-quality
`crystals.
`
`RESULTS
`
`Design of the affinity tag and matrix
`
`We designed a two—domain affinity tag based on a hepatitis
`delta virus (HBV) ribozyme domain that is activated by
`imidazole and a well-characterized RNAiprotein interacw
`tion (Fig. 1). The l-IBV ribozyme cleaves at its 5’-end and
`has no sequence requirements upstream of its cleavage site.
`For this use, the HSV sequence contains a C75U imitation
`that inactivates the ribozyme during the transcription reac-
`tion, but allows for the affinity tag’s removal during the
`purification protocol (Perrotta et al. 1999; Nishikawa et al.
`2002). This mutant ribozyme is therefore analogous to the
`
`1. linearized transcription vector
`promoter
`DNA gene
`
`5- man—ass 3-
`
`2.
`
`in vitro transcription
`
`5' -_EE 3'
`
`3. affinity purification
`5'
`
`
`Column
`
`
`4.
`
`imidazole cleavage and elution
`
`
`5-H
`5. column regeneration
`
`
`5' stcrsui BE] 4. @ Column/
`
`/
`
`FIGURE 1. The general scheme for the native purification of the
`desired sequence (RNA X) using a two~domain affinity tag.
`
`intein to effect simultaneous affinity purification and tag
`removal (Chong et al. 1998). The second tag domain con—
`sists of tandem stem—loop motifs from the T. maritime SRP
`RNA that specifically and tightly binds the SRP protein, th,
`which has been chosen for several reasons. First, this bind-
`ing interaction is both thermodynamically robust and ki—
`netically inert on the time scales of the purification proce-
`dure. The placement of two protein—binding sites in the tag
`enhances the ability of the RNA to remain bound to an
`affinity column while keeping the tag portion of the RNA
`transcript a reasonable length. Second, the interaction of
`this RNA with its cognate protein is highly dependent 011
`both pH and metal ion concentration (Batey and Doudna
`2002); therefore, the binding can be modulated with these
`two parameters. These two domains have been incorpo—
`rated into a high—copy plasmid vector (Fig. ZA—C) that ale
`lows for placement of the tag immediately downstream
`from any RNA sequence of interest.
`To create a chromatographic affinity matrix capable of
`specifically binding the above affinity tag, we coupled the T.
`nmritinm SRP th M-domain protein (referred to as
`TmaM) to an Affigel—IO matrix. This activated chromato~
`graphic media contains N~hydroxysuccinamide ester—linked
`agarose, allowing covalent coupling of proteins through ly-
`sine residues. Previously, this resin has been used to covar
`lently couple the M82 coat protein to create affinity beads
`for specific RNAS (Barclwell and Wickens 1990). For this
`application, we have chosen TmuM because unlike many
`other RNA-binding proteins,
`the protein‘s RNA—binding
`surface lacks lysine residues. The proteiniRNA complex is
`also readily disrupted under nondenaturing conditions, ale
`lowing gentle regeneration of the affinity matrix. TmuM can
`be expressed in E. coii and purified in large quantities (~70
`mgiL culture) with a straightforward purification protocol
`(Fig. 3), and ~15 mg of protein can be coupled to 1. mL of
`resin (corresponding to l pmole of potential RNAebinding
`sites per milliliter of resin) using established methods
`(Prickett et al. 1989; Bardwell and \Nickens 1990).
`
`Demonstration of the purification scheme
`
`To test the purification scheme, we constructed a plasmid
`containing a 49-nt sequence from the plautia stali intestinal
`virus (PSTV) RNA (Sasaki and Nakashima 1999; pRAV4;
`Fig. 2A). We performed a small (100 pL) 27h transcription,
`radioactively labeling the RNA during the reaction. The
`transcription reaction was diluted with ioading buffer,
`loaded directly onto M-domain affinity matrix, and washed
`(see Materials and Methods for buffer components). The
`product RNA was liberated from the column by adding
`imidazole-containing buffer,
`incubated for 2 h, and col,
`lected by draining the column. Fractions (one column vol-
`ume each) were desalted and analyzed on a denaturing
`polyacrylamide gel ( Fig. 4).
`
`www.rnaiournal.org
`
`4
`
`

`

`Kieft and Haley
`
`RNA gene
`T7 Eromoter
`ECORI
`GCCAGTGAATTCTAATACGACTCACTATAGGGTCGCTCAAACATTACCTGGTGTTGAGC
`
`C
`
`Hfiv ribozme
`w
`BbsI
`GAAAAGAATCTCGAAGACAAGGGCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGCCTGG
`
`Xbal
`GCAACATGCTTCGGCATGGTGAATGGGACCTCTAGACTGTGCATCGGGTCAGGACTGAA
`
`GAAA
`3:8
`e-t
`G:G
`A I C
`COA
`U-G
`
`dual SR9 stem lDOEB
`AGGTAGCAGCCCTGGGCAGTTTTTTGAAGTGCATCGGGTCAGGACCTTCGGGTAGCAGC
`
`T7 terminator
`BaJnHI
`CCTGGGCAGGATCCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTT
`
`8‘8
`0 G- C
`U
`dual SRP Ac_G
`G-G
`UOG
`
`u
`
`u c
`u fC—
`C—G
`I
`3-3
`GIG
`A I C
`CIA
`U-G
`
`u
`
`8'8
`CIG'_ C
`
`AC_G
`Goo
`U-G
`
`u
`
`HindIIi
`TTGAAGCTTGGC
`
`RNA gene
`T7 promoter
`ECDRI
`GCCAGTGAATTCTAATACGACTCACTATAGGGTCGCTCAAACATTAAGTGGTGTTGTGC
`
`HSV ribozxge
`* NgoMIV/NCDI
`BbsI
`GAAAAGAATCTCGAAGACAAGCCGGCCATGGTCCCAGCCTCCTCGCTGGCGGCCGGTGG
`
`Xba I
`CAACATGCTTCGGCATGGTGAATGGGACCTCTAGACTGTGCATCGGGTCAGGACTGAAA
`
`dual SRP stem 10025
`GGTAGCAGCCCTGGGCAGTTTTTTCCTGTGCATCGGGTCAGGACCTTCGGGTAGCAGCC
`
`5.
`
`T7 terminator
`BamHI
`CTGGGCAGGATCCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT
`
`HindIII
`TGAAGCTTGGC
`
`.
`
`3-3
`c—G BamHl
`HA
`'
`3-..
`
`8-3
`C—G
`I
`3-3
`A-Uh-U—U/
`”C
`\ch—u T‘C Xbal
`\
`c
`._
`Nol
`«GTE—E
`c—G
`A/
`E‘E
`Cl-G
`A—U
`C-G\
`NgoMIvG-C C—G
`A
`s-s G—c
`A
`—
`G—C
`G H5V(C75U)
`8:3 u
`u
`abs.
`CTCGAAGACAA
`G (a
`CC
`g
`cu (LEI
`CAAC-GA-U
`U—A
`C—G
`G—C
`u
`G
`u e
`
`(A) Sequence of the cloning region and affinity tag in pRAVtt (RAV : RNA Affinity Vector). The asterisk denotes the location of the
`FIGURE 2.
`boundary between the RNA of interest and the HBV ribozyine. All unique restriction sites have been denoted in boldface in the vector sequence,
`and the various Functional regions ofthe vector have been labeled. (B) Sequence ofthe cloning region and tag of pRAVIJE. (C) Secondary structure
`of the RNA affinity tag; the sequence is that of pRAVlZ. The location of the C75U mutation is boxed.
`
`Comparison of the raw transcription reaction with the
`wash fractions reveals almost quantitative uptake of the
`tagged RNA, and virtually no leaking of tagged RNA from
`the affinity column. Upon addition of imidazole, the RNA
`sequence of interest is released. This RNA is virtually the
`only species liberated from the column (along with minor
`contaminants, as seen on Fig. 4), as the uncleaved product
`and cleaved tag are retained on the column until
`treated
`with the regeneration buffer. Transcription and purification
`of the RNA shown in Figure 4 required <5 h.
`
`Crystallization of affinity—purified T. thermophila
`P4—P6 domain
`
`To demonstrate that this method generates high-quality
`RNA, we purified the AC209 mutant of the T. thertrtophilrt
`group 1 intron Pit—P6 domain using our affinity tag and
`crystallized it. This RNA readily crystallizes under a broad
`range of conditions. These crystals diffract synchrotron X-
`ray radiation to 2.2 A resolution (Iuneau et al. 2001). We
`purified Pit—Po domain RNA from a 10-1111. transcription
`reaction and then concurrently concentrated the RNA and
`exchanged the buffer in a centrifugal filter device; at no
`
`well as in condition #5 of a commercially available sparse
`matrix screening kit (Scott et al. 1995). These crystals dif-
`fract
`to ~2.8 A resolution using a rotating anode home
`X—ray source (Nor : 2.1 for the 2.93e2.80-A resolution bin;
`Fig. SB). The space group is P212121 with unit cell dimen-
`sions ofa : 75.4 A, b : 125.8 A, and c : 145.5 A, values very
`
`MW
`
`1
`
`2 3 4
`
`5
`
`6
`
`,
`
`93*
`64“
`
`50"
`
`36—
`
`22—
`16-“
`
`—— -..
`t.
`
`:2 :5
`
`..
`
`'
`
`'
`
`HisE-TmaM
`- U.
`'.' TmaM
`
`FIGURE 3. Purification ofthe T. .‘mtl‘itimn th M domain (TmaM) as
`analyzed by a 15% SDSAPAGE gel. (Lane 1) Cells prior to induction
`with 1 mM IPTG; (lane 2) cells after induction with 1 mM lPTG; (lane
`3) supernatant fraction of the cell lysate; (lane 4) fraction of protein
`eluted from the Ni2 ' affinity column; (lane 5) protein following cleaw
`
`5
`
`

`

`
`1l‘l2TIL-"[14I‘lfil’l‘Il'l21'l3Fl4l'l5l'l1l‘12I'13H4II5l
`
`T
`
`
`
`FIGURE 4. Test purification of RNA transcribed from the linearized
`pRAV4 vector. The RNA was body—labeled using [o-ilPlGTP during
`transcription. An aliquot ofthe raw transcription reaction is shown on
`the left, and wash."elution/regeneration fractions are shown. The pure
`product RNA is indicated.
`
`Close to those reported (Juneau et al. 2001). Furthermore,
`the mosaicity of these crystals is 0.45“ on the home source,
`which is as good, if not better, than crystals of the same
`RNA purified using traditional techniques (E. Podell, pers.
`comm.).
`
`The ability of the affinityepurified RNA to readily crys-
`tallize demonstrates several points. First, the time period
`between the initiation of the in vitro transcription reaction
`and the first observation of single crystals was 48 it. Thus,
`the rapid purification did not interfere with the ability of
`the RNA to crystallize. Second, the lack of a reannealingr
`step did not yield significant quantities of RNA trapped in
`a non-native conformation. The RNA folded correctly dur-
`ing the transcription reaction, and subsequent purification
`and concentration prior to crystallization did not change
`this. Third, despite the fact that well over 50% of the total
`transcribed RNA was discarded during the purification as
`
`transcription are comparable with traditional gel purificae
`tion. In fact, preparative polyacrylamide gel electrophoresis
`routinely results in ~50% loss of target RNA ( R.T. Batey and
`LS. Kieft, unpubl.).
`
`DISCUSSION
`
`In this work, we describe a nondenaturing method using an
`imidazoleeactivated HEW ribozyme coupled to a specific
`protein—RNA complex to rapidly purify RNA of sufficient
`quality to crystallize. Although this technique is capable of
`generating RNA faster and more cheaply than current
`methods, we designed the system with sufficient flexibility
`for a diverse set of needs. The pRAV plasmids are com-
`pletely modular with unique restriction sites defining each
`segment of the tag (Fig. 2A). Thus, besides cloning RNAs of
`interest, end users can easily make design changes that suit
`their particular applications.
`
`Sequence requirements in the RNA of interest
`
`The major advantage of this system is the tremendous flexe
`ibility to purify almost any RNA of interest. There are,
`however, a few RNA sequence design considerations when
`using this technique. There is the standard requirement for
`T7 RNA polymerase initiation with 3 guanine residue. This
`is circumvented in two ways. First, the use of a 5’7liammer-
`head ribozyme (Vida infra) completely eliminates this 1-e_
`quirement. Second, the aiternative P25 class T7 promoter
`uses an adenosine residue at the 5'—end (Huang et al. 2000).
`Another design requirement lies at the 3 '—end of the RNA of
`
` t‘
`
`2.87 it
`
`A
`
`(A) Crystals of the T. thermophila AC209P4—P6 domain RNA that was transcribed and purified using the affinity-tag protocol. (B)
`FIGURE 5.
`Diffraction pattern of crystals showing ciear peaks extending to at least 2.87 A resolution.
`
`www.rnaiournal.org
`
`6
`
`

`

`Kieft and Batey
`
`interest, at its boundary with the HEN ribozyme. Although
`the HBV ribozyme has no sequence requirements in the
`substrate strand, it appears to require at least one unpaired
`nucleotide at the 3'—end of the substrate for efficient cleav—
`
`age. Thus, the design of RNAs in which the 3'eend is come
`pletely involved in secondary structure will lead to con-
`structs with greatly reduced cleavage rates.
`
`The use of other affinity interactions
`
`In theory, any affinity tag could be used with this protocol,
`including commercially available matrices. We explored
`two other affinity tags:
`a
`lS—nt poly(A)
`tag that binds
`polyth) resin and a three-tandem repeat Sephadex G~100
`aptamer (Srisawat and Engelke 2001; Srisawat et at. 2001).
`Both contained the HBV C75U rihozyme 5' of the affinity
`tag. The poly(A) tag bound poorly to the column, with
`unacceptably high amounts of the transcribed material
`passing through the matrix (data not shown). The Sephadex
`aptamer tag slowly released from the column during the
`wash and elution steps,
`leading to contamination of the
`target RNA with precursor and tag (data not shown). Fu—
`ture isolation of aptamers with more favorable affinities and
`
`interaction kinetics may lead to new tags, but currently the
`use of highly specific RNA—protein interactions, such as the
`one described here, seems most appropriate. The come
`monly used UIA and M82 coat protein—RNA interactions
`could be used in place ofthe TmaM—RNA interaction, with
`the appropriate RNA element placed between the Xbal and
`BamHI sites (Fig. 2B). This capability further generalizes the
`method to RNAS whose purification is incompatible with
`the TmaMeSRP RNA interaction (e.g., SRP RNAs).
`
`Processing at the 5'-end
`
`A common method in RNA transcription is to use a ham-
`merhead ribozyme at the 5'-end of the transcript. This prof
`vides several distinct benefits: chemically homogeneity at
`the 5’-terminus of the desired product, the use of a strong
`initiation sequence at the 5'-end of the transcript, and the
`lack of sequence requirements at the 5'-end of the product
`RNA. To simplify the development of a working affinity tag,
`we did not include this feature in our system. However, this
`method should accommodate a S’Ahammerhead ribozyme.
`As long as the number of base pairs between the hammer
`head and the product RNA is kept to a minimum (3—4 hp),
`the cleaved hannnerhead ribozyme product should dissoci—
`ate from the product during transcription and subsequently
`be lost during the wash. Because both the transcription and
`wash buffers contain magnesium, the hammerhead ribo-
`zyme should completely cleave prior to the imidazole incu-
`bation step.
`
`Other small-molecuIe-activated ribozymes
`
`is that imidazole can facilitate the general base-catalyzed
`hydrolysis of the RNA backbone during prolonged incuba—
`tions (8712 h) at 37°C. At 4°C, the imidazole—induced cleave
`age rates are too slow to be useful (data not shown). There—
`fore, it may be desirable to use ribozymes activated by other
`small molecule compounds (Soukup and Breaker 1999). An
`example of this is the theophyllineeactivated ribozyme de—
`veloped by Soukup and coworkers in which the activity of
`the rihozyme is allosterically controlled through an aptamer
`(Kel't‘sburg and Soukup 2002). New ribozymes capable of
`using other small molecules with shorter incubation times,
`or that cleave efficiently at lower temperatures, will further
`increase the speed and utility of this technique. In our ex—
`perience, however, relatively short incubation times (274 h
`at 20°C—37°C) do not cause significant amounts of damage
`to the RNA.
`
`Conclusions
`
`We present a rapid method for the purification of any given
`RNA sequence under native conditions. Using this tech—
`nique,
`the P4—P6 domain of the T.
`thermopliil'a group I
`intron was purified to a sufficient level of homogeneity such
`that we were able to achieve diffractionequality crystals.
`This protocol takes advantage of the use of a removable
`affinity tag and a reusable affinity matrix, similar to the
`systems routinely used in protein purification. \Ne believe
`that this method represents a major advance in the ability to
`purify large quantities of RNA for structural biology and
`should also be applicable to a broad range of biochemical
`applications.
`
`MATERIALS AND METHODS
`
`Expression and purification of T. maritime; M
`domain protein
`
`A domain of the T. maritinm Ffli protein (TmnM) corresponding
`to amino acids 295—4123 was cloned from genomic DNA (ATCC
`43589) and inserted between the Ncol and BamHI sites ol'pETlSh
`(Novagen) using standard cloning techniques (Sambrook and
`Russell 2001). Expression of the Tmal’vl domain was performed by
`transforming the E. coli strain RosettatDE3)/pLysS (Nov-agen)
`with anmML}. These cells were grown in LB medium in eight
`750—mL cultures at 37°C to an absorhance (600 inn) of 0.7—0.8,
`and expression was induced by the addition of 1 mM IPTG. The
`cultures were allowed to continue to grow for an additional 475 h
`prior to harvesting by centrifugation. The cell pellets were imme—
`diately resuspended in 23 mL Lysis Buffer {300 mM NaCl, 50 inlvl
`Tris—HG] at pll 8.0). Cell lysis was performed by three rounds of
`freezef'thaw in which the cells were frozen in liquid nitrogen and
`thawed to room temperature. The viscosity of the lysatc was re?
`duced by the addition of20 units of DNasc per liter of cell growth
`
`7
`
`

`

`purification.
`TinaM domain was initially purified by passing the clarified
`lysate through a gravity column containing 20 mL of Ni2 ‘ -NTA
`affinity resin (QlAGEN). Following extensive washing with 300
`mL of Wash Buffer (50 mM NallZPOJ, 300 mM NaCl, 20 mM
`imidazole at pH 8.0), the protein was eluted with Elution Buffet
`(50 mM NaHZPOd, 300 mM NaCl, 250 mM imidazole at pH 8.0).
`Fractions containing the protein were pooled and cleaved with a
`1:100 ratio (by mass) of TEV proteasezTan domain overnight at
`room temperature (Lucast et al. 2001). it should be noted that the
`removal of the hexahistidine tag by TEV protease is not likely to be
`necessary for the successful application of TmnM in this method-
`ologj
`, but we have not specifically tested this. The protein was
`exchanged into a buffer containing 100 mM NaCl, 10 mM Na-
`MES (pH 6.0) by dialysis in 6—8 kD dialysis membrane and sub
`sequently applied to an SP-Sepharose column. Protein was eluted
`using a 0171.5 M gradient of NaCl over a 300—mL volume; the
`protein eluted around 0.55 M NaCl. Fractions containing the pro-
`tein were pooled and dialyzed into 50 mM K"~1—1EPES (pH 7.5).
`The concentration of the protein was assessed by absorbance at
`280 nm using an extinction coefficient of 1615 M’1 crtfl and a
`molecular weight of 14,975 g/mole. The final yield ofprotein was
`70 mg/L of culture.
`
`Preparation of TmaM4 affinity matrix
`
`Tan4 was covalently coupled to an activated support, AfflgelrIO
`(BioRad), according to the protocol supplied. In this, 25 inL of
`beads was washed with 250 mL of iceecold ddl-l_,O (18 inf) water;
`MillirQ) by vacuum filtration without allowing the beads to com-
`pletely dry out during the procedure. The beads were then added
`to 50 ml. ofa 550 Md protein solution and allowed to incubate for
`2 h at 4°C and for 5 h at room temperature with gentle agitation.
`After coupling, the supernatant containing unreacted protein was
`removed by placing the slurry in a 20 x 25-011 Econoecolumn
`(BioRad). The coupled resin was washed twice with 50-mL ali—
`quots of50 mM K+-HEPF.S (pH 7.5) followed by 50 mL of50 rnM
`Tris—HCl (pH 8.0). To block unreacted N—hydroxysuccinan‘iide
`groups,
`the column was allowed to incubate overnight
`in Tris
`buffer at 4°C. The resin was finally washed and stored in a buffer
`containing 200 mivl NaCl, 10 mM MgC11, 50 mM Tris-HCl (pl-I
`8.0), and 0.1% Na—azide and stored at 4°C. To test whether the
`
`chromatographic media contained residual RNase activity, 200 pL
`of resin was incubated for 48 h with an RNA at 25°C and the
`
`integrity of the RNA was assayed on a denaturing polyacrylamide
`gel. No significant degradation of the RNA was observed, indicat—
`ing that the protein preparation was ofsufficient quality to yield a
`chromatographic resin devoid of contaminants that would inter-
`fere with the purification protocol.
`
`Construction of the RNA affinity tag vector
`
`Standard PCR and cloning strategies were used to Create a DNA
`insert that contains a T7 RNA polymerase promoter, a 419m insert
`(nucleotides 615776195) of the plautia stali intestinal virus IRES
`RNA, the C75U mutant genomic HSV t‘ibozyme, two T. maritime
`SRP RNA stein—loops, and a '1‘7 terminator (Fig. 2A). This plas~
`mid, referred to as pRAV4 (RAV for RNA Affinity Vector), was
`
`optimization and modification. pRAV4 was subsequently changed
`to include three Watson-Crick base pairs to the second SRP steme
`loop to stabilize the terminal helix and NgoMlV and Ncol restrio
`tion sites within the HBV ribozy‘me (Walker et al. 2003) to facili~
`tate cloning (Fig. 20) and is referred to as pRAVIZ.
`
`in vitro transcription of RNA
`
`RNA was transcribed in vitro from linearized plasmid DNA or
`directly from PCR products using established protocols (Doudna
`1997). For reactions from plasmid DNA, the plasmid was linear-
`ized with BamHI and used in in vitro transcription reactions at a
`final concentration of 75 ug/mL. for reactions from PCR prod
`ucts, the reactions were prepared using the QIAGEN PCR clean—
`up l<it. Reactions consisted of 30 mM Tris—HCl (pH 8.0), 10 mM
`DTT, 0.1% Triton X—100, 0.1 mM spermidine—HCL 8 mM each
`NTP (Sigma; pH adjusted to 8.0), 40 mM MgC12, 50 ttg/mL T7
`RNA polymerase, I unit/ml. inorganic pyrophosphatase (Sigma),
`and template DNA at 75 ttg/mL. Reactions were incubated for 1.5
`to 2 h (or as indicated in the figures) at 37°C.
`
`Insertion of the AC209 variant of the T. thermophila
`group I intron P4—P6 domain into the affinity vector
`
`A gene corresponding to the (A209)P4—P6 domain was cloned
`using a nested PCR strategy. The gene was amplified with two
`inner primers
`(S'eprimer, TAATACGACTCAC'l'ATAGGAATT
`GCGGGAAAGGGGT; 3'—primer, CGGGCGGAAGACGCGCCCT
`GAACTGCATCCATATCA) and two outer primers (S’rprimer,
`GCGCGCGAA'ITCTAATACGACTCACTATAG; 3'~primer, CCG
`CGGGCGGAAGACGCCCCC). The resulting product was restric—
`tio