`
`•
`
`27
`
`with the biotinylated anti-Tac, thus decreasing fluorescence
`more.
`
`Biological properties of the humanized antibody
`For optimal use in treatment of human disease, the
`humanized antibody should be able to destroy T-cells in the
`body that ~xpress th~ IL-2 receptor. One mechanism by which
`antibodies may destroy target cells is antibody-dependent
`cell-mediated r.ytotoxicity, abbreviated AOCC (F~ndamental
`Immunology, Paul, w., Ed., Raven Press, New York (1984), at
`pg. 681), in which the antibody forms a bridge between the
`target cell and an effector cell such as a macrophage that
`can lyse the target. To determine whether the humanized
`antibody and the original mouse anti-Tac antibody can mediate
`ADCC, a chromium release assay was performed by standard
`methods. Specifically, human leukemia HUT-102 cells, which
`express the IL-2 receptor, ~ere incubated with 51 cr to allow
`them to absorb this radionuclide. The H'JT-102 cells were
`then incubated with an excess of either anti-Tac or humanized
`anti-Tac antibojy. The HUT-102 cells were next incubated for
`4 hrs with either a 30:1 or 100:1 ratio of effector cells,
`which were normal purified human peripheral blood mononuclea~
`cells that had been activated by incubation for about 20 hrs
`with human recombinant IL-2. Release of 51cr, which i~dicated
`lysis of the target HUT-102 cells, was measured and the
`background subtracted (Table 1). The results sho~ that at
`either ratio of effector cells, anti-Tac did not lysa a
`significant number of the target cells (less than 5%), while
`the humanized antibody did (more than 20%). Hence, the
`humanized antibody is likely to be more efficacious than the
`original mouse antibody in treating T-cell leukemia or other
`T-cell mediated diseases.
`
`'
`
`-
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`BIOEPIS EX. 1002
`Page 3501
`
`
`
`•
`
`•
`
`28
`
`TABLE 1
`
`Percent 51 cr release after ADCC
`
`u.f.ector:
`30:1
`
`Target ratio
`100:l
`
`Antibody
`Anti-Tac
`Humanized
`anti-Tac
`
`4.\
`24%
`
`< 1%
`23%
`
`..
`
`-
`
`'
`
`'
`
`BIOEPIS EX. 1002
`Page 3502
`
`
`
`•
`
`29
`
`From the foregoing, it will be appreciated that ~ne
`human-like i:ro.munoglobulins of the present invention offer
`numerous advantages of other human IL-2 receptor-specific
`a~tibodies.
`In comparison to anti-Tac mouse monoclonal
`antibodies, the present human-like il!lIIlunoglobulin can be more
`~ccnomically produced and contain substantially less foreign
`amino acid sequences. This reduc£d likelihood of
`antigenicity after injection into a human patient represents
`a significant therapeutic improvement.
`Although the present invention has been described
`in some detail by way of illustration and example fo~
`purposes of clarity and understanding, it will be apparenc
`that certain changes and modifications may be practiced
`within the scope of the appended claims.
`
`•
`
`5
`
`I
`
`t
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`BIOEPIS EX. 1002
`Page 3503
`
`
`
`•
`
`•
`
`30
`
`-
`
`WE CLAIM:
`
`A composition comprising a substantially pure
`1.
`human-like im.rnunoglobulin specifically reactive with p55 Tac
`protein.
`
`A composition according to Claim 1, wherein
`2.
`the immunoglobulin comprises two pairs of light/heavy chain
`dimers, wherein each chain comprises a variable region -and a
`constant region.
`
`A compositio~ according to Claim 2, wherein a
`3.
`variable region of at le~st one chain comprises at least
`about 75 amino acids from a human immunoglobulin variable
`region framework.
`
`A composition comprising a substantially pure
`4.
`human-like im.munoglobulin capable of inhibiting binding of
`human interleukin-2 (IL-2) to a human IL-2 receptor.
`
`A composition according to Claims 1 or 4,
`5.
`wherein the immunoglobulin exhibits a binding affinity to
`8
`• ,
`human IL-2 receptor of about 10 M or stronger.
`
`a
`
`A composition according to Claims 1 or 4,
`6.
`wherein the immunoglobulin comprises complementarity
`determining regions from one im.munoglobulin and framework
`regions from at least one different immunoglobulin.
`
`A recombinant inununoglobulin composition
`7.
`comprising a human-like framework and one or more foreign
`complementarity determining regioris not naturally associated
`with the framework, wherein said immunoglobulin is capable of
`binding to a human interleukin-2 receptor.
`
`'
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`-:/ · -.?· YMA,f.!~-'·fftk8,. HS?.€bA :,,':?JA:::R .C.M£4-¥44f-i.,f )k4t#·!1f&!.!.:W.4,\S?,,-1~~~f_-.:?9A/#t,;~ **~~:f.4§.:1¥M'W¥F'-%f.:¥- :1
`·~.-
`
`•
`
`BIOEPIS EX. 1002
`Page 3504
`
`
`
`•
`
`·"'
`
`•
`
`31
`
`A composition according to ..:laim 7, ·.hc:·ein
`8.
`one or more of the foreign CDR's are substantially homologous
`to a COR from an immunoglcbulin reactive with human p55 Tac
`protein.
`
`'
`
`•
`
`5
`
`A composition according to Claim 7, wherein
`9.
`all of the foreign CDR's are located on heavy chains of the
`i.mmunoglobulin.
`
`10. A composition according to Claim 7, wherein
`the immunoglobulin is an IgG1 immunoglobulin isotype.
`
`10
`
`11. A composition according to Claim 7, wherein
`the mature light and heavy variable region protein sequences
`are substantially homologous to the sequences in Figures 3
`and 4 •
`
`12. A human-like immunoglobulin having two pairs
`of light chain/heavy chain dimers and capable of specifically
`reacting with an epitope on a human interleukin-2 receptor
`with an affinity of at least about 108 M·', said light and
`heavy chains comprising complementarity detenniuing regions
`(CDR's) and human-like framework regions, wherein the CDR's
`are from different immunoglobulin molecules than the
`framework regions.
`
`13. An immJnoglobulin according to Claim 12, which
`binds to an ~pitope located on a p55 Tac protein.
`
`14. An im.rnunoglobulin according to Claim 12, which
`is capable of blocking the binding of interleukin-2 (IL-2) to
`human IL-2 receptors.
`
`15. An immunoglobulin according to Claim 12,
`wherein the human-like framework regions comprise amino acids
`sequences from at least two human immunoglob!llins •
`
`15
`
`20
`
`25
`
`30
`
`35
`
`. ~~-,.:~~- :~~~~-.-·:·-::·.:.< ::._-,f;f?t~~ ~;i::{~_ 1:2/- -~~
`-~~ .. --
`
`BIOEPIS EX. 1002
`Page 3505
`
`
`
`16: An immunoglobulin according to Claim 12,
`wherein the COR's are from a mouse immunoglobulin.
`
`32
`
`17. A humanized immunoglobulin capable of binding
`to human interleukin-2 receptors, said immunoglobulin
`comprising one or more complementarity determining regions
`(CDR's) from anti-Tac antibody in a human-like framework.
`
`18. A humanized inununoglobulin according to Claim
`17, wherein the human framework is substantially homologous
`to an Eu immunoglobulin frame.erk.
`
`19. A humanized immunoglobulin according to Claim
`17, having a mature heavy chain variable sequence as shown in
`Figure 3, a~_:
`.:: mature light chain sequence as shc.. .. 'n in
`Figure 4.
`
`20. A humanized i:mmunoglobulin according to Claim
`17 which is capable of blocking the binding ot IL-2 to
`interleukin-2 receptors on human T-cells.
`
`21. A method of treating T-cell mediated dis0rders
`in a human patient, said method comprising administering to
`said patient a therapeutically effective dose of an
`immunoglobulin according to Claims 1, 5, 12, or 17.
`
`22. An immunoglobulin according to Claims 1, 5,
`12, or 17 which was produced in a myeloma or hybridoma cell.
`
`23. A human-like immunoglobulin heavy chain
`comprising a human-like heavy chain framework region and a
`hypervariable region which is substantially identical to a
`monoclonal antibody heavy chain hypervariable region secreted
`by the cell line designated ~.T.C.C. Accession No. CRL 9688.
`
`1
`
`I
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`.-· . .; .:-.:
`
`BIOEPIS EX. 1002
`Page 3506
`
`
`
`•
`
`33
`
`24. A human-like inununoglobulir._ 1.igrt cl1-'in
`comprising a human light chain framework region and a
`hypervariable region which is substantially identical to a
`monoclonal antibody light chain hypervariable region secreted
`by the cell line designated A.T.C.C. Accession No. CRL 9688.
`
`25. A polynucleotide molecule comprising a first
`sequence coding for human-like immunoglobulin framework
`regions and a second sequence coding for one or more mouse
`imrnunoglobulin complementarity determining regions, wherein
`upon expression said polynucleotide encodes an immunoglobulin
`specifically reactive with p55 Tac protein and capable of
`blocking the binding of interleukin-2 (IL-2) to the IL-2
`receptor on human T-cells.
`
`26. A cell line transfected with a polynucleotide
`of Claim 25.
`
`.-.-.
`
`- 5
`
`
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`'
`
`_ _.;._
`
`I
`
`BIOEPIS EX. 1002
`Page 3507
`
`
`
`--
`I
`
`I
`
`-
`
`s
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`•
`
`·. ,Mr:Ll:J.t.::l.l·-2 RECEPTQR-s:>ECIFIC HUMAN IMMUNOGLOBULINS
`
`34
`
`ABSTRACT OF THE DISCLOSURE
`Human-like immunoglobulins specifically reactive
`with human IL-2 receptors are prepared employing recombinant
`DNA technology for use in ,~ . treatment of T-cell mediated
`disorders.
`
`~~ ..... :: ... ---:.~:,-:/~ •. ,~· ... ·.i~:;'. ': ·-~:
`
`: :'; ....... :~""'';.· .::"'--~ • ~ •• - : ........ -:-. • ... ;<-:-~. ·: . ~ ... ~.:. ·l:.-- .:~: ·'.·- ......... .
`....
`
`._,;.,;, .
`
`BIOEPIS EX. 1002
`Page 3508
`
`
`
`01'..ARATION AND POWER OF ATIORNEY. ,., ,v,un, """-'"' ,.v.
`
`A,• below n,mcd inventor, 1 hereby decl.ire th11:
`Mv re,idenct, po\t office •d.Jreu .nd citizrnship .re .i\ suted below next to my n,me; I believe I •m the oriJlin~i. fir_;t ,nd .olt ir:•en(cid:173)
`tor (if -..1-. one n,me i, liued below) or ,n oricinil, fint ,nd 1oint inventor (if plur.1 inventor\ .rt n,mcd below) of the wb;~CI m~ttcr
`,imed .ind for which• pucnt is \Ought on the invention entitled:
`whict
`NC"JEL IL-2 RECEPTOR-SPECIFIC HUMAN IMMUNOGLOBULINS
`the ,~ifiution of which CXl is .itUched hereto or O wu filed o n - - - - -
`No. __________ _
`,nd wu .mended on - - - - - - - - -
`
`________ n Applic.tion Seriil
`
`- - - - - - - - - (if .ippliuble).
`
`I ~ve reviewed ,nd undersund the contenu of the ,bove identified \occific.tion, including the d•ims, H ,mended by •nv ,mcndmcnt
`referred to •bove. I ,cknowlcdge the duty to disclo\e inform.lion wh1cn 1\ mite<i•I to the .. ,min,t1on of this ,oolic•tion in .ictord- ·
`~cc with Title 37, Code of Feder.ii Regulittons, 11.56(,). I cl,im foreign priority bene'iu under Tille 35, United Sutc\ Code, 1119
`of ,ny foreign ,pplicition(\) for puent or inventor's cemfic.ate listed below •nd h••e ,1,0 identified below •ny foreign ,pplicllion
`for pucnt or foventor'\ ccrufiutc h,ving • filing d.i.te before th.it of the ipplic.tion on which priority 1\ cl,,med:
`
`1
`
`Pri« F orcisn ._pplication(s)
`
`COUNTRY
`
`APPLICATION NUMBER
`
`D"'TEOF FILING
`
`PRIORITY CL/.tM,O
`UNDER JS U.S.C. 119
`Yes -- No __
`YtS -- No __
`I diim the benefit under Tille 3S, United Si.us Code, 1120 of any United St.ite\ aoolic,1ion(s) li,1cd below ,nd, insofar u the
`subject 1Nttef of uch of the claims of this ,oolic.tion is not di\doscd in the prior United S1.1us •ooliution in the minner provided
`by the fint p.1rigrioh of Title 35, United Stues Code, It 12, I .cknowltdge the duty to disclose m,1eri,I information ,s defined in
`Title 37, Code of F edcnl Regul.tions, § 1.56(,) which occurred between the filing due of the prior arolic.iion ind the nauonal or
`PCT intcrnuionil filing date of this ,ppliution:
`
`"'PPl!CATION SERl"'l NO.
`
`O"'TE OF FILING
`
`STATUS
`0 Patented D Pending OAb,ndoned
`D P,tenteci C Pending 0 Ab,ndoned
`
`POWER OF ATIORNEY: As a named inventor, I hereby appoint the foHo....;ng attorney(\) and/or agent(\} who ue putners ind
`u\0Ci1tu in the firm of Towni,cnd 6"d Towni,cnd to pr01,Ccu1c this applic,tion and transact all bus,ncu in the Puent and Tridemuk
`\Hlliarn M. Smith, Reg. No. 30,223
`Officcconncmdthcrcw,th.
`Steven w. Parmelee, Reg. No. 3L,~9Q
`James M. Heslin, Reg. No. 29,541
`
`SE"O t.ORRESPO,.,Of..NCE 10:
`William M. Smith
`TOWNSE.NO and TOWNSEND
`S1c;urt Street Tower. One, MHkct Plu,
`S•n Funci,co. CA 9410S
`
`l fUt~;"""E 1:..,-, "'•"'•
`INVENTOR &ueen
`• I R(SIOlNCE 'C•ty
`~I cmzENS>Hf' ! Palo Al t.o
`- .
`'
`I
`I POST OfF!CE !6"" Olf-<• A00'9U
`•ooaus 11300 Oak Cr_eek Dr.
`t FULL Jrr,fAM[
`•i.,.,ut -...!",1•
`, .. v?.~l')~ ! Selick
`I
`-~OE"'i°iC••y
`o,
`5
`.
`•
`"'f1uzc .... s><1•.' 3e.i.!ll0nt _
`P'OSl Of'ft<:f. j"•J•U OH•<• AG.lf"HI
`... ooitts~ 11673 Sunnyslope Ave.
`l flit~;<"'~'-·""·"'·
`I INVEN!Oll !
`.... I R[SlfCNCE I'''•
`I ,osT OfF'IC~ ;Pou 0th<• Ado, ...
`~. CITIZf..NSHIP I
`1 ... ooaus I
`
`r-~~N;;•
`1S•••• o• Fo•••1" Counuy
`· California
`r"· Palo Alto
`
`1 • ............
`Harold
`lsu,, °' Fa<e,,,. c°""""
`California
`1C•ty
`. Belmont
`
`1'"" .......
`i St••• o• FO<••'I" C°"""Y
`
`tC1ty
`
`I
`
`Q1R(CT lEL(PHON( C"'LlS TO
`(""°'"'~ rrq,urot,on nu'"'3tr. o"a trt~(th01tt """""~ J
`William M. Smith, Reg. 30,223
`0 HIS) 543-9600 or Ci1 (415) 326-2400
`M,oo, .. N•'"• Of' '"'tt~•
`L •
`
`Cou,.uy Of CtUl9ft'U'HO
`
`f9D11C30~
`
`I ~l<t• a, Co..nt•y
`
`USA
`
`California
`M,oo .. ""'•""• o, 1,01,.1
`Edwin
`Co1.1nU\f of CJu,.,.,,,uo
`USA
`I SUI• o• Cou•Hy
`f Z•o ~ooa
`q11002
`California
`{
`r-•oo•• '"•m•,,. '"'"•'
`
`'Country ot Ctt~l•ll'llll''HD
`
`.
`I St••• o• C'>unUy
`
`I Zlo Coo•
`
`I funher dccbrc !hit •II sulcmcnts made hcerein of my own knowledge uc true •nd th•t ,II 1utemcn11 m•dc on info,mnion •nd
`bchcf ue bcheved to bc true; •nd further th•t thc\C U~tcmcnts were m1de with the knowledge th•t willful bli,c ,utcmcnu and the
`hkc \0. m•d• l<t pun,\h .. blc by fine or imprisonment, M both, under section lOOi of Titlr 18 of the United Sutu Code, ind thn
`1u<h ..,,llful hlsc ,utcmcnu may jeopuditc the v•lidity of the •ophu1ion or 1ny D•tent i\wing thereon
`S•l""•l-.a•• o• '""••"'°' 10 l
`S•'"•tt.,,• ot ''""•,HOt 202
`,. -
`,,
`/ : L. ~ ~I'.'.'. & 8
`
`=»••
`
`..
`
`-
`
`01~1? llJ
`I u ... 12. / 2 g/ Ji
`
`S1•n•tu•• or 1"•et"IOI' 203
`
`u.,.
`
`T&T 1•• tt2 1!;7t
`
`-~·= ·,, , : .::- ;/·:
`
`:; ·- r,_,,1 .'.:;--~->. ,_ ·. ··"" :.-,,_ .,'.J~f;,,-;,.,~\l·}?/S,{:;·(;;,: ".'.a·-:·.,:,·-.~:.:·:~-~.:';:-/,~:;:~.~-~~ .. -::?·
`..
`
`BIOEPIS EX. 1002
`Page 3509
`
`
`
`,...,~y. I.JOC~ i . . ----J -
`
`VEP.1:'l~D '!TATEMENT (DECLARATION) CLAIMING SMALL ENTITY STATUS
`·.37 CFR 1.9(!) and l.27;c) l - SMALL BUSINESS CONCERN
`
`,\pph,·a~ or Paten~: Cary L. Queen and Harold Edwin Selick
`s .. nal. :O.o. ·
`Filinit Date: December 28. 1988
`Pat .. nt :-.o.:
`Issued: ___________________ _
`ror: ~OVEL IL-2 RECE?TOR-Si?ECI i='iC HUMAN T MMUNOGLOBULINS
`
`I ht'rt'hy dedare that I am
`
`l
`
`thP ownPr of the small busineM concern identiried helow:
`an oCCicial of the small busme55 concern empowned to act o:, behalf of the com:ern 1dent1Cied h'!low:
`
`I
`I
`l XI
`~:\.\IE OF co:-:cERN ?rote in Design Labs I Inc .• a Delaware Corporation
`ADO RESS OF C01'CERN_3.._1_3_1 _._P ... o~r ... r~e-r_Q~t-'-· Y~e---------------------(cid:173)
`ja lo Alto California 94304
`
`I h .. why dt•,:lare that the above identified small busineS& concern qua Ii fit's as a small bu~mps., con.-ern as dPf1ned in 13
`Cr'R 121.3-18. and reproduced in Ji CFR 1.9\dl. for purposes of payin" reduced fpes under senion 4lial and ih1 of
`T1tlP 35. l 'nitPd States Code. in that the number of employees of the concern. including thoSt> of 11..S affiliates. does not
`,·:ot,·t'..d 500 pt'rsons. For purposes of this statement. ( l) the number of employees of the busineS& concern 1s the avl'ra2e
`uwr tht' previous fiscal year of the concern of the penons employed on a full-time. part-time or tern porary has1s dunnii
`,.,u-h of the pay pE>riods of the riscal year. and('.!) concerns are a!filiatPs of ear.h othPr when t'1ther. d1rP<:tly or indirt"<:tly,
`.,,,,. ,·onn·rn c:ontrols or has the power to control the other. or a th1rd party or parties controls or has the powt'r to
`.-nntrol both.
`
`[ ho>rt>hy dPl'iarP that ri11ht.s undPr contract or law have be,en conveyed to and rPmain with the small hu~tness concern
`-
`II,-2 BECFPTGB-S2FCIFIC HPMA
`1 1dt'nt1fi,.d above with regard to the invention, entitled NQYEI
`I
`IMMUNOGLOBULINS _______________________________ by inventor1s1
`Ca:-v L. Queen and Harold ::'d·.in Se lick
`d.-scnh..d in
`I XI
`l
`I
`l
`I
`
`the application filed herewith
`applic:ation senal no. _______________ • filed ______________ _
`patPnt no.
`issued ________________ _
`
`If tht' m:hts held hy the above ide:'ltlfied small business l·oncem are not exclusive, each ind1v1dual. concern or or2an1-
`.:at1on hav1n1(r:2hts to the invention 1s listed below• and no ni;hts to the invention are ht'ld by any l)c"rson. other than
`tht' invrntor. who could not qualify as a small business concern under 37 CFR 1.91d) or by any l'oncern which would
`not qualify as a small business concern under 3i CFR 1.91d) or a nonprofit organization undl'r 3i CFR l.91e1.
`·:\OTE: Separate verified statement.s are required from each named person. concern or or~anization having rights to
`tht' inwnuon avemn2 to their status as small entities. (31 CFR 1.27)
`:,. . .\~If. ____________ _ __ __ __ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ _ _ _
`AU DRESS __________ __ ___ __ _ __ __ __ _
`l
`I l'.'\Dl VIOL; .>.L
`I S'.\lALL BlJSI.SESS CONCER.S
`
`:SO:-.PROFIT ORGA:-.;IZATIO:-S
`
`~.Ulf. _______________________________ _
`ADDRESS ___________ ___ __ __ _ ___ _ ___ _ _ __ _ _ __ _ _ __ _ _
`I
`I l'.'\Dl\"1Dl'.,\L
`
`S'.\lALL BL'St:-:ESS co:-:cER~
`
`:-.:O:--PHOFIT ORGA:-.:lZA TIO:--
`
`t a,·knowled2e the duty to r:.ie, in this application or patent. notification of any chanise in status rl;ul:inl! in loss of
`.. nntlPm,.nt to small entity status pnor to payinlit, or at the time of paying, thP earliest of the issue f<?e or any
`maint .. nance fee due after the datR on which status as a small Pntity is no lon~er appropr:at<'. 1.17 CFR l.2.~1h1 I
`
`I h .. n>hy declare that all sr.atements made herein of my own knowledge are true and tr.at all statements made on
`mformat,on and belief are oelieved to be true: and further that thesl' statements were mad .. with the knowiecii;:e that
`w11lful false statement.s and the like so made are punishable by fine or imprisonment, or both. •Jnder sed1on 1001 oi
`T:tlP 18 of thf' Cnited States Code, and that such willful false statements may jeopardize the validity of the appilca:1on.
`any patPnt ISSUin(! thereon, or any patent to which this verified statement is directed.
`
`:,;,>.:'-IE OF PEI-SQ:-; SIG:S:ISG_r.......,2..,•...,• >'"_.,e,..n.._c,...,,e'-'J....,.a,_v..._.,,K,.,o"""'r.._n.._ _____________________ _
`TITLE () F PE RSOS OTHER "'."HA:-; O\l.SER~P,_r=-=e-=s-=i._,d::.;e~n:.c..:t ___ _____ _____ ___ _ _ _
`AUD R £SS OF PERSON SIG r--1 :SG-..;31...':..• a8..L1_;::P.1,.Q.uCL..:.. .. .t:O::..l'":.._.1.D.1...r.__:.i...1,LJ/ e~_.::;P..t:.a1..J1..L.01-;::l.J.l.J7_ou..,~:...C.,;a:i...J.1-=.;.0.J..CJ..J..D:...'L.. "'"-0;.;..:::.4_.,..,Q~4--
`
`.-., .,., .. '····.-.. ~ .. r·.-, · .. "' ... i ... ' ·.
`
`). :. :::·/":··
`~
`
`·.": :- -~ ... - .
`
`-
`"
`. ··'!i~; ..... , . .
`:.-
`,:~-_,., .• .:.:·.· ... : ... · .. :·.·-::·'.;_~=:.;.::.-
`
`~ .. -,, •
`.,_
`- •
`··· .• ·-~ ....... .:. ._:.~~-.tr···.
`
`- .
`-: ·-
`
`BIOEPIS EX. 1002
`Page 3510
`
`
`
`•
`
`•
`
`FIGURE 1
`
`Dl/?.90971
`
`L Q Q
`Q V Q
`I
`I
`I
`I
`I
`Q V Q L V Q
`
`s G A E
`L A K
`I
`I
`I
`1
`1
`s G A E V
`K K
`
`p G A
`I
`1
`s
`p G
`
`s V K M
`i
`I
`1
`s
`V K V
`
`I
`
`N
`
`V
`
`T E
`
`y
`
`p
`
`F
`I
`F
`
`I
`
`T
`
`y
`
`I
`
`s C K A s G
`s
`y R M H w V K Q R
`y T
`I
`I
`I
`I
`I
`I
`I
`I
`I
`1
`s R
`s C K A s G G T
`s A
`I w V R Q A
`* -------------
`*
`L E w
`s T G
`p
`y
`I
`G
`I
`I
`l
`I
`I
`I
`I
`I
`L E w M G G
`p M F G
`y
`p N
`I
`-------------------------------
`*
`L T A D K s s
`s
`F K D K A T
`N Q
`K
`A
`T
`I
`I
`I
`I
`I
`I
`I
`I
`I
`. I
`s T N T A
`F Q G R V T
`A Q K
`A D E
`T
`----------------
`*
`*
`s
`s
`I
`I
`s
`s
`
`p G Q G
`I
`I
`I
`I
`p G Q G
`
`M Q
`I
`M E
`
`L
`I
`L
`
`T
`
`L
`I
`L R
`
`y
`I
`y
`
`y
`
`y
`I
`
`'[
`
`'[
`
`C A R G
`I
`I
`I
`I
`F C A G G
`*
`*
`
`F
`
`s A V
`E D
`l
`I
`l
`s E
`D T A
`
`F
`*
`
`~-:.:~
`
`-:- ·-:~.-;··
`; .. :,.:~
`~-~?t-~
`
`ic~··.,,.
`
`~:.::
`
`·-:~ -~~:
`...... .,
`
`1
`
`1
`
`21
`
`21
`
`41
`
`41
`
`61
`
`61
`
`81
`
`81
`
`100
`
`101
`
`V
`
`y
`
`I
`
`F D
`
`p
`
`G G
`I
`s
`G
`----------------
`
`y w G Q G T
`I
`'{ N G G
`*
`*
`*
`
`T
`
`L
`
`L
`
`V
`
`T
`I
`T
`
`V
`I
`V
`
`s
`I
`s
`
`s
`I
`s
`
`E
`*
`
`E
`
`·.· -:·::-· ·. ~. ~,,-,.> ._: :\.-:j·iY -~':·,trt:t}?~)"(;'! ... ,.ai_, ''.!P:. ;,:-~···'{r~:;~,/~:-,,t.~//~'.°-0;-:t;',:>:·~.-:/·~7"!',:,:''?i:-- :~_=~·-·,:--~,.~·::t~~~},;.'!f}?i
`
`.· ·...
`
`.:
`
`BIOEPIS EX. 1002
`Page 3511
`
`
`
`•
`
`•
`
`FIGURE 2
`FIGURE 2
`
`07 /?.9097:j
`
`V
`
`L T Q s
`SIS
`TIT
`LH
`Quito
`I
`I
`I
`s
`Q M T Q
`
`VQ
`
`p A
`PEP
`I
`p
`
`I M s A s
`p G
`E K V T
`AS
`I
`I
`I
`I
`l
`I
`s T
`s A s V G D R V T
`
`L
`
`s
`s
`s
`s A
`y M H w F Q Q K
`I
`C
`531.5
`Alisa"
`sR
`0‘0
`CiC
`0‘0
`Kliun.
`I
`I
`I
`I
`I
`I
`I
`I
`I
`N T w L A w y
`s Q s
`I
`.Q Q
`C R A
`K
`-------------------------------
`L w
`s G V
`y T
`s N
`p K
`L A
`Klvn
`Pip
`LIL
`I
`I
`I
`I
`l
`I
`I
`I
`I
`s
`s G V
`s
`p K L
`y K A
`L
`-------------------
`s R M
`s
`s
`I
`s
`
`s
`
`T
`
`y
`
`F
`
`I
`
`L M
`*
`s G
`I
`I
`s G
`
`T
`I
`T
`
`E
`
`F
`
`I
`I
`I
`
`L T
`I
`I
`L T
`
`T
`
`p A
`I
`p
`
`p
`I
`p
`
`s
`*
`
`A
`
`p
`
`E
`
`Q
`
`s
`
`L
`
`
`
`"
`
`·r~.
`
`Q
`
`QD
`
`D
`
`I
`I
`I
`
`I
`7.11
`I
`I
`
`T
`Talia:
`I
`'!'
`
`TK
`
`R
`RlIR
`I
`R
`
`F
`Flat?
`l
`F
`
`s
`
`G T
`GlsG
`I
`G K A
`
`s G
`l
`I
`s G
`
`s G
`I
`G
`
`I
`*
`
`1
`
`1
`
`21
`21
`
`21
`21
`
`40
`40
`
`41
`41
`
`60
`60
`
`61
`61
`
`80
`80
`
`81
`61
`
`E D
`l
`D D
`
`A
`
`F
`
`T
`A
`I
`I
`A T
`
`y
`I
`y
`
`y
`I
`y
`
`R
`
`s
`
`T
`
`y
`
`p ·L T
`
`C H Q
`I
`l
`s D s K M
`y N
`() Q
`C
`-------------------------
`
`s
`F G
`I
`I
`. G Q
`
`100
`100
`
`101
`101
`
`G
`I
`I
`G
`
`6.16
`
`T
`TI!T
`!
`T
`
`L
`
`K
`I
`I
`
`E
`L K
`”AtiK
`I
`I
`K V - V K
`
`BIOEPIS EX. 1002
`
`Page 3512
`
`BIOEPIS EX. 1002
`Page 3512
`
`
`
`
`•
`
`FIGURE J
`
`•
`
`Dl/?.9097.1
`
`60
`50
`40
`JO
`20
`lu
`TCTAGATGGGrlTGGAGCTGGATCTTTCTCTTCCTCCTGTCAGGTACCGCG~GCGTGCACT
`X G W S W
`I
`F ~ F L L S G T A G V H
`
`120
`110
`100
`90
`70
`80
`CTCl,GGTCCAGCTTGTCCAG·rcTGGGGC'fGAAt.::TCAAGAAACCTGGCTCGAGCGTGAAGG
`S Q V Q
`L V Q
`S G A E V K K P G S
`S V K
`
`180
`· 170
`160
`150
`140
`130
`~CTCC7GC;.AGGCTTCTGGCTACACCTTTACTAGCTACAGGATGCACTGGGTAAGGCAGG
`V S C K A S G Y T F T S Y R M H W V ~ Q
`
`240
`210
`190
`230
`220
`200
`CCCCTGGACAGGGTCTGGAATGGATTGGATATATTAATCCGTCG~CTGGGTATACTGAAT
`? G Q G L E W
`I G Y
`I N P S
`? G Y T E
`A
`
`JOO
`290
`280
`260
`250
`270
`ACAATCAGAAGTTCAAGGACAAGGCAACAATTACTGCAGACGAATCCACCAATACAGCC~
`Y N Q K F K D K A T
`I T A D E S T N T A
`
`."'
`
`360
`350
`340
`330
`320
`310
`ACATGGAACTGAGCAGCCTGAGATCTGAGGACACCGC~GTCTATTACTGTGCAAGAGGGG
`Y M E L S S L R S E D T A V Y Y C A R G
`
`~10
`410
`400
`290
`380
`J70
`GGGGGCTCT~TGACTACTGGGGCCAAGGAACCCTGGTCACAGTCTCCTCAGGTGAGTCCT
`G G V F D Y W G Q G T L V T V S S
`
`430
`TAAAACCTCTAGA
`
`BIOEPIS EX. 1002
`Page 3513
`
`
`
`•
`
`•
`
`FIGwRE 4
`
`60
`SO
`40
`JO
`20
`1~
`~CTAGATGGAGACCGA7ACCCTCCTGCTATGGGTCCTCCTGCTATGGGTCCCAGGATCAA
`~ E T D T L L L W V L L L W V P G S
`
`120
`110
`100
`90
`80
`70
`CCGGAGATATTCAGATGACCCAGTCTCCATCTACCCTCTCTGCTAGCGTCGGGGATAGGG
`T G D
`I Q M T Q S P S T L S A S V G D R
`
`130
`170
`-
`160
`150
`140
`~JO
`TCACC~TrtACCTGCTCTGCCAGCTCAAGTATAAGTTACATGCACTGGTACCAGCAGAAGC
`7 T
`-
`T C S A S S S
`I
`S Y M H W Y Q Q K
`
`240
`230
`220
`210
`200
`190
`CAGGCAAAGCTCCC~.AGCTTCTAATTTATACCACATCCAACCTGGCTTCTGGAGTCCC:G
`P G K A
`P K L L
`I Y T T S N L A S G V P
`
`JOO
`290
`280
`270
`260
`250
`CTCGCTTCAGTGGCAGTGGATCTGGGACCGAGTTCACCCTCACAATCAGCTCTCTGCAGC
`A R F S G S G S G T E F T L T
`I S S L Q
`
`,
`
`360
`350
`340
`330
`320
`310
`CAGATGATTTCGCCACTTATTACTGCCATCAAAGGAGTACTTACCCACTCACGTTCGGTC
`P D D F A T Y Y C H Q R S T Y P L T F G
`
`400
`390
`)80
`370
`AGGGGACCA.AGGTGGAGGTCAAACGTAAGTACACTTTTCTAGA
`Q G T K V E V K
`
`BIOEPIS EX. 1002
`Page 3514
`
`
`
`•
`
`FIGURE 5
`
`• n1/·~909,1
`
`A
`
`·!
`
`HES12 AGCTTCTAGATGGGATGGAGCTGGATCTTTCTCTTCCTCCTGTCAGGTACCGCGGGCGTG
`CACTCTCAGGTCCAGCTTGTCCAGTCTGGGGCTGAAGTCAAGAAACCTGGCTCGAGCGTG
`AAGGTC
`
`HES13 CCCAGTCGA~GGATTAATATATCCAATCCATTCCAGACCCTGTCCAGGGGCCTGCCTTAC
`CCAGTGCATCCTGTAGCTAGTAAAGGTGTAGCCAGAAGCCTTGCAGGAGACCTTCACGCT
`CGAGCCAGG
`
`HES14 TATATTAATCCGTCGACT~GGTATACTGAATACAATCAGAAGTTCAAGGACAAGGCAACA
`ATTACTGCAGACGAATCCACCAATACAGCCTACATGGAACTGAGCAGCCTGAGATCTGAG
`GACA
`
`HES15 ATATCGTCTAGAGGTTTTAAGGACTCACCTGAGGAGACTGTGACCAGGGTTCCTTGGCCC
`CAGTAGTCAAAGACCCCCCCCCCTCTTGCACAGTAATAGACTGCGGTGTCCTCAGATCTC
`AGGCTGCT
`
`a
`
`HES12
`-------------------~
`-------------------~
`+-------------------
`~------------------
`HES1)
`P.ESlS
`
`HES14
`
`BIOEPIS EX. 1002
`Page 3515
`
`
`
`,._.~
`e
`r.. o
`n
`" ""
`r nc
`e
`...
`
`A
`
`B
`
`•
`
`FIGURE 6
`
`•
`
`JFD1
`
`CAAATCTAGATGGAGAC~GATACCCTCCTGCTATGGGTCCTCCTGCTATGGGTCCCAGGA
`TCAACCGGAGATATTCAGATGACCCAGTCTCCATCTACCCTCTCTGCTAGCGTCGGGGAT
`
`JFD2
`
`ATAAATTAGA/<.GCTTGGGAGCTTTGCCTGCCTTCTGCTGGTACCl~TGCATGTAACTTA~
`ACTTGAGCTGGCAGAGCAGGTTATGGTGACCCTATCCCCGACGCTAGCAGAGAG
`
`JFD3
`
`GCTCCCAAGCTTCTAATTTATACCACATCCAACCTGGCTTCTGGAGTCCCTGCTCGCTTC
`AGTGGCAGTGGATCTGGGACCGAGTTCACCCTCACAATCAGCTCTCTGCAGCCAGATGAT
`TTC
`
`JFD4
`
`TATATCTAGAAA..~GTGTACTTACGTTTGACCTCCACCTTGGTCCCCTGACCGAACGTGAG
`TGGGTA.AGTACTCCTT7GATGGCAGTAATAAGTGGCGAAATCATCTGGCTGCAGAGAGC7
`GA
`
`JFDl
`JFD3
`-------------------~
`--------------------.:,
`~-------------------
`~------------------
`!
`JFD2
`Hind III
`
`Jfr,..;
`
`BIOEPIS EX. 1002
`Page 3516
`
`
`
`FIGURE 7
`
`itl/29097.J
`
`Eco RI
`
`lg Pronoter
`
`p8R322
`
`Xbo · t
`
`Pvu
`
`I I
`
`Hind Ill
`
`Hyg
`
`Bon HI
`
`........
`
`BIOEPIS EX. 1002
`Page 3517
`
`
`
`.•
`
`•
`
`r.~
`.,
`,, ,,
`ri n
`"
`"
`..
`r-: P.o
`o
`' "
`"
`
`•
`
`•
`
`FIGURE 8
`
`p8R322
`
`lg Pronoter
`
`Xba
`
`Xbo
`
`VJ
`
`C ~
`
`Pvu
`
`I I
`
`SV40
`
`Ban HI
`
`I I I
`
`Gpt
`
`;, -~ ,-.-·\ ·;:'/!!;~'.~.'· ,,.'-'' --~. ~----~-;..-_ .· ·1t(-~;:,:(';·· >,.!', ·:·
`.. :·.~· -·
`
`•.··
`
`BIOEPIS EX. 1002
`Page 3518
`
`
`
`•
`
`•
`
`HUT-lu2
`
`FIGURE 9
`
`B
`
`1000
`
`~7/29097:J
`
`HUT-102
`
`•.
`
`' ..
`
`ua 2
`F"L 1
`
`10 l
`
`10 l
`
`Humanized anti-Tac
`
`Anti-Tac
`
`'
`
`1000
`
`Jurkat
`
`~
`i
`
`; __
`\
`
`l
`'
`
`J
`
`D
`
`1000
`
`'
`
`Jurkat
`
`i ~
`
`•0
`0
`t0
`
`10 l
`
`10 3
`
`ua 2
`J:"L l
`Anti-Tac
`
`0
`10°
`
`ua 1
`
`Humanized anti-Tac
`
`BIOEPIS EX. 1002
`Page 3519
`
`
`
`. . ......
`
`. ..
`
`r "•
`
`-
`
`•
`
`FIGURE 10
`
`•
`
`A
`
`B
`
`Ong anti-Tac
`10 ng
`20 ng
`40 ng
`
`Ong anti-Tac
`20 ng anti-Ta::
`20 ng humanized anti-Tac
`
`~.
`
`,,. "' ... ; · .. ~ ~~ -~ · ... ~ "'_·.~-: .. ~.:.·.·:;~ .. :~.~~~-~-.~.::_-·.::... --:_~~~~~.:. __ .:.,_-~-~~.:~_·
`, ..
`· .... :~ ·•· .. -.
`
`.
`
`BIOEPIS EX. 1002
`Page 3520
`
`
`
`~ .. :. -
`
`~'
`
`JWT&t
`
`·strz
`
`PCT/US 89 /05 8 5;
`
`Sl;PIAL
`
`"U'"IIVI ·-of 191517
`
`,.
`SE,UAl.. NUMBER
`J7/:!1=1,252
`
`ij1;310252
`
`PATENT DATE
`
`PATENT
`NUMBER
`
`Fil.ING CATE Cl.ASS
`J2/1;/~~
`4 3 5
`
`SUBCLASS
`
`GROUP ART UNIT
`135
`
`EXAMINER
`
`"'
`~ CART L. QUEEN, PALC ALTO, CA; HAROLD E. SELICK, e~L~ONT, CA.
`5
`J
`0.
`0.
`,t
`
`*·*-C.ONJ l.N.U I NG, 0 AT A•'*••'****••••••••*'*'*'*'*
`T~IS APPLN
`VER[FIED
`IS AC[~ OF
`
`17/290,975 12/28/S!
`
`REC'D 2 8 0£C 1989
`WIPO PCT
`
`••FOREIGN/PCT APPLICATIONS•••****'*'**'**
`\J::~IFIE()
`
`, I
`
`PRIORiT'·/ DOC u fVl t: r·~-r I
`
`nr ===,
`
`STATE OR SHEE7S
`COUNTRY ORwGS.
`
`••••• S~ALL
`
`:NTITY •••••
`
`;'QTAL
`INOEP.
`CLAIMS Cl.AIMS
`
`Fil.ING.FEE
`REC£1V£0
`
`~7"";"QA.N(V·S
`COCKE;' NO.
`
`1J
`
`23
`
`3 ~
`
`279.CG
`
`1H239
`
`£.,,n·uner t tn,!1~11 - CA
`
`Faf'eiqn orto,uv ct~imea
`
`Ov .. Ono
`:JS USC 119 conamon, met o.,.u Ono
`
`AS
`FILED
`
`"' "' Ill a:
`0 <
`
`0
`
`Verlff..C and Ac!cnowl,ed'qed
`WillP~ ."'4. 5M[TH
`TCwNS~~o ANO TOWNSEND
`STEUART 3T~:£T TCW:R
`OliE "1AiH:=T PLAZA
`SA~ FRANCISCO, CA Q41u5
`
`DESIGNING
`
`IMPRQV~O HU~ANIZED IMMUNOGLO~ULI~S
`
`This is ~o cer~·f
`v.
`t!'lat:
`·
`-
`... i
`annexed heret:~
`is a true coo
`"
`.
`Uni-ed Stat .Y Lrom Che records oF -~
`-
`es Patent
`-
`d
`'-'IE
`of. the application asan .T~ademark Office
`which is identi·"· d
`originally filed
`-le above.
`
`By autho~ity of th
`CO~.MISSIO~p p~;ENTS AND
`
`y/~"ycu:,iJtP-
`
`certifying Officer
`
`TRADEMARKS
`
`BIOEPIS EX. 1002
`Page 3521
`
`
`
`·i ··r
`.
`
`~
`
`. -
`
`?AT::~T APPUCXiIO~ SC:RI:\L SO. 01/310252
`
`C.S. DE?.;R~::~;7 0: CO~!::RCE
`?ATE~T A,\'!) T~E~A.R., OrrlCE
`
`•
`
`PT0-1556
`(5/8 7)
`
`BIOEPIS EX. 1002
`Page 3522
`
`
`
`/ ... \
`('-1/ ..
`n, ,'1~ ()')r?
`'-•.J.i}:.,.,)...._
`.I
`11823-9
`
`DESIGNING IMPROVED HU1'f.ANIZED IMMUNOGI,,pBULINS
`
`CROSS-REFERENCE TO R~I.ATED APPL~CATION
`This is a continuation-in-part ~pplication of
`commonly assigned patent application U.S.S.N. 290,975, filed
`December 28, 1988, which is incorporated herein by reference.
`
`Field of the Invention
`The ~resent invention relates generally to the
`combination of recombinant DNA and monoclonal antibody
`technologies fer developing novel therapeutic agents ~~d,
`raore particularly, to the production of ~on-immunogenic
`antibodies having strong affinity for a predetermined
`antigen.
`
`Backcround of the Inv~ntion
`The advent of monoclonal antibody technology in tha
`mid 1970's heralded a new age of medicine. For the firs~
`time, researchers and clinicians had access to essentially
`unliraited quantities of uniform antibodies capable of !:inding
`to a predete~ined antigenic sit.<= and having various
`immunological effector functions. These proteins, knc• .. m as
`"monoclonal antibodies" were thought to hold great promise
`in ,~ , the removal of harmful cells in vivo.
`Indeed, the
`clinical value of monoclonal antibodies seemed liraitless for
`thi.~ use alone.
`Unfortunately, the development of appropriate
`therapeutic products based on these proteins has been
`severely hampered by a number of drawbacks inherent i~
`monoclonal antibcdy production. For example, most monoclonal
`antibodies are mouse derived, and thus do not fix hu:n.an
`complement well. They also lack other important
`imrnunoglobulin functional characteristics when used in
`humans.
`
`Perhaps most importantly, non-human nonoclonal
`antibodies contain substantfal stretches of amino acid
`sequences. that will be irrunu:.1ogenic when injected into a hu:n.an
`
`,...
`
`5
`
`10
`
`15
`
`2 ()
`
`25
`
`3J
`
`35
`
`.
`
`\
`l I
`l
`
`BIOEPIS EX. 1002
`Page 3523
`
`
`
`,
`
`••
`
`. .·,
`
`2
`
`patient. Numerous studies have shown that after injection of
`a foreign antibody, the immune response mounted by a patient
`can be quite strong, essentially eliminating the antibody's
`therapeutic utility after an initial treatment. Moreover, as
`increasing numbers of different mouse or other antigenic (to
`humans) monoclonal antibodies can be expected to developed to
`treat various diseases, after the first or second treatments
`with any non-human antibodies, subsequent treatments, even
`for unrelated therapies, can be ineffective or even dangerous
`in themselves.
`While the production of so called "chimeric
`antibodies" (~ , mouse variable regions joined to human
`constant regions) has proven somewhat successful, a
`significant irnrnunogenicity problem remains. Moreover,
`efforts to immortalize human B-cells or generate humin
`hybridomas capable of producing human irnmunoglobulins agai~st
`a desired antigen have been generally unsuccessful,
`particularly with many important human antigens. Most
`recently, recor.~inant DNA technology has been utilized to
`produce immunoglobulir1s which have human framework regions
`combined with complementarity determining regions {CDR's)
`from a donor mouse or rat immunoglobulin {.§.§.g, ~ , EPO
`Publication No. 0239400, which is incorporated herein by
`reference). These new proteins are called "humanized
`immunoglobulins" and the process by which the donor
`immunoglobulin is converted into a human-like irnmunoglobulin
`by combining its CDR's with a human framework is called
`"humanization". Humanized antibodies are important because
`they bind to the same antigen as ;:he original anti:bodi't,!S,
`::::ut
`are less immunogenic when injected into humans.
`However, a major problem with present humanization
`procedure$ has been a loss of affinity for the antigen,
`usually by at least 2 to 3-fold (Tones et al., Nature,
`2£1:522-525 (1986)) and in some instances as much as 10-fold
`or more, especially when the antigen is a protein (Verhoeyen
`et al., Science, 239:1534-1536 (1988)). Loss of any affinity
`is, of course, highly undesirable. At the least, it means
`that more of the humanized antibody will have to be injected
`
`5
`
`10
`
`·,15
`
`20
`
`25
`
`30
`
`35
`
`.
`
`. ... --~·-..... :"?. f\!'!4.£:J: ·-·~¥, .... Ji__. 4.¥.. .. Li..
`
`BIOEPIS EX. 1002
`Page 3524
`
`
`
`-~ -
`
`3
`
`into the patient, at higher cost and greater risk of adverse
`effects. Even more critically, an antibody ',o/ith reduced
`affinity may have poorer biological functions, such as
`complement lysis, antibody-dependent cellular cytotoxicity,
`or virus neutralization. For example, the loss of affinity
`in the partially humanized antibody HuVHCAMP may have caused
`it to' lose all ability to mediate complement lysis (see,
`Riechmann et al., Sature, 332:323-327 (1988}; Table 1).
`Thus, there is a need for improved means for
`producing humanized antibodies specifically reactive ',o/ith
`strong affinity to a predetermined antigen. These humanized
`immunoglobulins should r