`
`WORLD INTELLECTUAL PROPERTY ORGANIZATION
`International Bureau
`
`INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
`
`. (SlJiiternational Patent Classification 4 :
`A:61'K 39/395, C12N 15/00
`C:12P 21/00
`
`A2
`
`(11) International Publication Number:
`
`WO 89/01783
`
`(43) International Publication Date:
`
`9 March 1989 (09.03.89)
`
`, (ti)International Application Number:
`
`PCT/GB88f00731
`
`(22):1ittemational Filing Date: 5 September 1988 (05.09.88)
`
`(74) Agent: MERCER, Christopher, Paul; Carpmaels &
`Ransford, 43 Bloomsbury Square, London WC1A
`2RA(GB).
`
`...
`
`~a:t~;Priority Application Number:
`
`8720833
`
`· (32) Priority Date:
`
`4 September 1987 (04.09.87)
`
`(33) Priority Country:
`
`GB
`
`(81) Designated States: AT (European patent), AU, BE (Eu(cid:173)
`ropean patent), CH (European patent), DE (Euro(cid:173)
`pean patent), DK, FI, FR (European patent), GB
`(European patent), HU, IT (European patent), JP,
`KR, LU (European patent), NL (European patent),
`NO, RO, SE (European patent), SU, US.
`
`(Vl~lApplieant (for all designated States except US): CELL(cid:173)
`TECH LIMITED [GB/GB]; 216 Bath Road, Slough,
`Berkshire SL1 4EN (GB).
`
`(l72) Inventors; and
`· (~Inventors/Applicants (for US only) : BODMER, Mark,
`William [GB/GB]; 131 Reading Road, Henley-on(cid:173)
`Thames, Oxfordshire RG19 1DJ (GB). ADAIR, John,
`Robert [GB/GB]; 23 George Road, Stokenchurch,
`High Wycombe HP14 3RN (GB). WHITTLE, Nigel,
`Richard [GBJGB]; 5 Leigh Road, Cobham, Surrey
`KT11 2LF (GB).
`
`(S"4)1'.liitle: RECOMBINANT ANTIBODY AND METHOD
`
`($))Abstract
`
`The present invention provides a humanised antibody
`molecule (HAM) having specificity for the TAG-72 antigen
`and having an antigen binding site wherein at least the com(cid:173)
`plementarity determining regions (CDRs) of the variable do(cid:173)
`main· are: derived from the mouse monoclonal antibody B72.3
`(BVZ:Y MAb) and the remaining immunoglobulin-derived
`partS'-oflhe HAM are derived from a human immunoglobulin
`andi a process for its production.
`
`Published
`Without international search report and to be repu(cid:173)
`blished upon receipt of that report.
`
`•
`
`A
`
`50
`30
`10
`GAATTCCCACTGACTCTAACCATGGAATGGAGCTGGGTCTTTCTCTTCTTCCTGTCAGTA
`MetG 1 uTrpSerTrpVa1PheLeuPhePheLeuserva 1
`
`7
`llO
`90
`70
`ACTACAGGTGTCCACTCCCAGGTTCAGCTGCAGCAGTCTGACGCTGAGTTGGTGAAACCT
`ThrThrG1yVa1HisSerG1nVa1G1nLeuG1nG1nSerAspA1aGluLeuVa1LysPro
`
`170
`150
`130
`GGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACCATGCTATT
`GlyAlaSerValLysileSercysLysA1aSerG1yTyrThrPheThrAspHisA1aile
`
`230
`210
`190
`CACTGGGCGAAGCAGAAGCCTGAACAGGGCCTGGAATGGATTGGATATATTTCTCCCGGA
`HisTrpAlaLysGlnLysProG1uG1nGlyLeuGluTrpileGlyTyrileSerProGly
`
`290
`270
`250
`AATGATGATATTAAGTACAATGAGAAGTTCAAGGGCAAGGC~ACACTGACTGCAGACAAA
`AsnAspAspileLysTyrAsnGluLysPheLysGlyLysAlaThrLeuThrAlaAspLys
`
`350
`330
`310
`TCCTCCAGCACTGCCTACATGCAGCTCAACAGCCTGACATCTGAGGATTCTGCAGTGTAT
`SerSerSerThrAlaTyrMetGlnLeuAsnserLeuThrSerGluAspSerAlaValTyr
`
`"
`410
`390
`370
`TTCTGTAAAAGATCGTACTACGGCCACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA
`PheCysLysArgSerTyrTyrGlyHisTrpGlyGlnG1yThrThrLeuThrValSerSer
`
`B
`
`50
`30
`10
`ATCACACACACACACATGAGTGTGCCCACTCAGGTCCTGGGGTTGCTGCTGCTGTGGCTT
`MetSerValPro'l'hrGlnValteuGlyLeuLeuLeuteuTrpLeu
`
`ACAGATGC~1GATG~ACATCCAGATGA~~CAGTCTCCAGCCTCCCT*~gTGTATCTGTG
`ThrAspAlaAr(]cysAspileGlnMetThrGlnSerProAlaSerteuSerValSerVal
`
`170
`150
`130
`GGAGAAACTGTCACCATCACATGTCGAGCAAGTGAGAATATTTACAGTAATTTAGCATGG
`GlyGluThrValThrileThrCysArqAlaSerGluAsnileTyrserAsnteuAlaTrp
`
`230
`210
`190
`TATCAACAGAAACAGGGAAAA TCTCCTCAGCTCCTGGTCTATGCTGCAACAAACTTAGCA
`TyrGlnGlnLysGlnGlyLysSerProGlnLeuLeuValTyrAlaAlaThrAsnLeuAla
`uo
`no
`no
`GATGGTGTGCCATCAAGGTTCAGTGGCAGTGGATCGGGCACACAGTATTCCCTCAAGATC
`AspGlyValProSerArgPheSerGlySerGlySerGlyThrGlnTyrSerLeuLysile
`
`350
`330
`310
`AACAGCCTGCAGTCTGAAGATTTTGGGAGTTATTACTGTCAACATTTTTGGGGTACTCCG
`AsnSerLeuGlnSerGluAspPheGlySerTyrTyrCysGlnHisPheTrpGlyThrPro
`
`,.
`410
`390
`370
`TACACGTTCGGAGGGGGGACCAGGCTGGAAATAAAACGGGCTGATGCTGCACCAACTGTC
`TyrThrPheGlyGlyGlyThrArgLeuGluileLysArgAlaAspAlaAlaProThrVal
`
`BIOEPIS EX. 1182
`Page 1
`
`
`
`-.,.
`
`•
`
`FOR THE PURPOSES OF INFORMATION ONLY
`
`Codes used to identifY States party to the PCT on the front pages ofpamphlets publishing international appli(cid:173)
`cations under the PCT.
`
`AT Austria
`AU Australia
`BB; Barbados
`BE.. Belgium
`Bfi, Bulgaria
`BJ Benin
`BR Brazil
`CF Central African Republic
`CG, Congo
`CH Switzerland
`CM Cameroon
`DE Germany, Federal Republic of
`DK Denmark
`FI
`Finland
`
`France
`FR
`GA Gabon
`GB United Kingdom
`HU Hungary
`IT
`Italy
`Japan
`JP
`KP Democratic People's Republic
`of Korea
`KR Republic of Korea
`U
`Liechtenstein
`LK Sri Lanka
`LU Luxembourg
`M€ Monaco
`MG Madagascar
`
`ML Mali
`MR Mauritania
`MW Malawi
`NL Netherlands
`NO Norway
`RO Romania
`SD Sudan
`SE Sweden
`SN Senegal
`SU Soviet Union
`TD Chad
`TG Togo
`US United States of America
`
`BIOEPIS EX. 1182
`Page 2
`
`
`
`PCTJGB88f00731
`
`RECOMBINANT ANTIBODY AND METHOD'
`The present invention relates to a humanised
`antibody molecule (HAM) having specificity for an,
`antigen present on certain malignant cells and to a
`process for its production using recombinant DNA
`technology.
`In the present application, the term
`"recombinant antibody molecule" (RAM) is used to
`describe an antibody produced by any process
`involving the use of recombinant DNA technology,
`including any analogues of natural immunoglobulins or
`their fragments. The term "humanised antibody
`molecule" (HAM) is used to describe a molecule having
`an antigen binding site derived from an
`immunoglobulin from a non-human species, the
`remaining immunoglobulin-derived parts of the
`molecule being derived from a human immunoglobulin.
`The antigen binding site may comprise either complete
`variable domains fused onto constant domains or only
`the complementarity determining regions grafted onto
`appropriate framework regions in the variable
`domains. The abbreviation "MAb" is used to indicate
`a monoclonal antibody.
`In the description, reference is made to a_
`number of publications by number. The publications
`are listed in numerical order at the end of the
`description.
`Natural immunoglobulins have been known for
`many years, as have the various fragments thereof,
`such as the Fab, (Fab' )2
`and Fe fragments, which
`can be derived by enzymatic cleavage. Natural
`immunoglobulins comprise a generally Y-shaped
`molecule having an antigen-binding site at the end of
`
`BIOEPIS EX. 1182
`Page 3
`
`
`
`W089f01783
`
`PCTJGB88f00731
`
`- 2
`
`each upper arm. The remainder of the structure, and
`particularly the stem of the Y, mediates the effector
`functions associated with immunoglobulins.
`Natural immunoglobulins have been used in
`assay, diagnosis and, to a more limited extent,
`therapy. However, such uses, especially in therapy,
`have been hindered by the polyclonal nature of
`natural immunoglobulins. A significant step towards
`the realisation of the potential of immunoglobulins
`as therapeutic agents was the discovery of monoclonal
`antibodies of defined specificity (1). However, most
`MAbs are produced by fusions of rodent spleen cells
`with rodent myeloma cells. They are therefore
`essentially rodent proteins. There are very few
`reports of the production of human MAbs.
`Since most available MAbs are of rodent origin,
`they are naturally antigenic in humans. Therefore,
`the use of rodent MAbs as therapeutic agents in
`humans is inherently limited by the fact that the
`human subject will mount an immunological response to
`the MAb and will either remove it entirely or at
`least reduce its effectiveness.
`There have therefore been made proposals for
`making non-human MAbs less antigenic in humans. Such
`techniques can be generically termed "humanizing"
`MAbs. These techniques generally involve the use of
`recombinant DNA technology to manipulate DNA
`sequences encoding the polypeptide chains of the
`antibody molecule.
`Some early methods for carrying out such a
`procedure are described in EP-A-0 171 496 (Res. Dev.
`Corp. Japan), EP-A-0 173 494 (Stanford University),
`EP-A-0 194 276 (Celltech Limited) and WO-A-8 702 671
`(Int. Gen. Eng. Inc.). The Celltech application
`discloses a proces~ for preparing an
`
`BIOEPIS EX. 1182
`Page 4
`
`
`
`PCT /GB88f00731
`
`- 3
`
`antibody molecule having the variable domains from a
`mouse MAb and the constant domains from a human
`immunoglobulin.
`It also shows the production of an
`antibody molecule comprising the variable domains of
`the CHl and CL domains of a human
`a mouse MAb 1
`immunoglobulin/ and a non-immunoglobulin-derived
`protein in place of the Fe portion of the human
`immunoglobulin.
`In an alternative approach 1 described in
`the complementarity
`EP-A-87302620.7 (Winter) 1
`determining regions (CDRs) of a mouse MAb have been
`grafted onto the framework regions of the variable
`domains of a human immunoglobulin using site directed
`mutagenesis using long oligonucleotides .
`The earliest work on humanizing MAbs has been
`carried out based on MAbs recognising synthetic
`antigens, such as the NP or NIP antigens. However/
`examples in which a mouse MAb recognising lysozyme
`and a rat MAb recognising an antigen on human T cells
`respectively were humanized are shown by Verhoeyen et
`al. (2) and Reichmann et al. (3)
`.
`It has been widely suggested that
`immunoglobulins, and in particular MAbsr could
`potentially be very useful in the diagnosis and
`treatment of cancer (4 1 5). There has therefore been
`much activity in trying to produce immunoglobulins or
`MAbs directed against tumour-specific antigens. So
`far 1 over one hundred MAbs directed against a variety
`of human carcinomas have been used in various aspects
`of tumour diagnosis or treatment (6).
`There have been a number of papers published
`concerning the production of chimeric monoclonal
`antibodies recognising cell surface antigens. For
`instance, Sahagan et al. (7) disclose a genetically
`enginee~ed murine/human chimeric antibody which
`
`BIOEPIS EX. 1182
`Page 5
`
`
`
`WOfW[fJ1783
`
`PCTJGB88f00731
`
`- 4
`
`retains specificity for a human tumour-associated
`antigen. Also Nishimura et al. (8) disclose a
`recombinant murine/human chimeric monoclonal antibody
`specific for common acute lymphocytic leukemia
`antigen.
`According to the present invention/ there is
`provided a humanised antibody molecule (HAM) having
`specificity for the TAG-72 antigen and having an
`antigen binding site wherein at least the
`complementarity determining regions (CDRs) of the
`variable domain are derived from the mouse monoclonal
`antibody B72.3 (B72.3 MAb) and the remaining
`immunoglobulin-derived parts of the HAM are derived
`from a human immunoglobulin.
`The variable domains of the HAM may comprise
`either the entire variable domains of the B72.3 MAb
`or may comprise the framework regions of a human
`variable domain having grafted thereon the CDRs of
`the B72.3 MAb.
`The B72.3 MAb is a mouse MAb of the type
`IgG1-Kappa raised against a membrane-enriched extract
`of a human liver metastatis of a breast carcinoma
`(9). The B72.3 MAb has been extensively studied in a
`number of laboratories. It has been shown to
`recognise a tumour-associated glycoprotein TAG-72 1 a
`mucin-like molecule with a molecular weight of
`approximately 106
`(10).
`Immunohistochemical
`studies have demonstrated that the B72.3 MAb
`recognises approximately 90% of colorectal
`carcinomas/ 85% of breast carcinomas and 95% of
`ovarian carcinomas. Howeverr it shows no significant
`cross-reactivity with a wide spectrum of normal human
`tissues (11 to 14).
`It has surprisingly been found that humanizing
`the B72.3 MAb does not adversely affect its binding
`
`BIOEPIS EX. 1182
`Page 6
`
`
`
`WCl\89'/~1783
`
`PCT /GBSS/00731
`
`-
`
`5
`
`activity, and this produces a HAM which is extremely
`usefu~ in both therapy and diagnosis of certain
`carcinomas.
`Preferably, the HAM of the present invention
`will be produced by recombinant DNA technology.
`The HAM of the present invention may comprise:
`a complete antibody molecule, having full length
`heavy and light chains; a fragment thereof, such as
`the Fab or (Fab')z
`fragment;
`a light chain or heavy
`chain dimer; or any other molecule with the same
`specificity as the B72.3 antibody.
`Alternatively, the HAM of the present invention
`may have attached to it an effector or reporter
`molecule. For instance, the HAM may have a
`macrocycle, for chelating a heavy metal atom, or a
`toxin, such ai ricin, attac~ed to it by a covalent
`bridging structure. Alternatively, the procedures of
`recombinant DNA technology may be used to produce a
`HAM in which the Fe fragment or CH3 domain of a
`complete antibody molecule has been replaced by an
`enzyme or toxin molecule.
`The remainder of the HAM may be derived from
`any suitable human immunoglobulin. However, it need
`not comprise only protein sequences from the human
`immunoglobulin. For instance, a gene may be
`constructed in which a DNA sequence _encoding part of
`a human immunoglobulin chain is fused to a DNA
`sequence encoding the amino acid sequence of a
`polypeptide effector or reporter molecule.
`According to a second aspect of the present
`invention, there is provided a process for producing
`the HAM of the first aspect of the invention, which
`process comprises:
`(a) producing in an expression vector an operon
`having a DNA sequence which encodes an antibody heavy
`
`.·
`
`BIOEPIS EX. 1182
`Page 7
`
`
`
`W089[01783
`
`PCT[GB88f00731
`
`t
`
`-
`
`6
`
`or light chain wherein at least the CDRs of the
`variable domain are derived from the B72.3 MAb and
`the remaining immunoglobulin-derived parts of the
`antibody chain are derived from a human
`immunoglobulin;
`(b) producing in an expression vector an
`operon having a DNA sequence which encodes a
`complementary antibody light or heavy chain wherein
`at least the CDRs of the variable domain are derived
`from the B72.3 MAb and the remaining
`immunoglobulin-derived parts of the antibody chain
`are derived from a human immunoglobulin;
`(c) transfecting a host cell with the or each
`vectori and
`(d) culturing the transfected cell line to
`pr9duce the HAM.
`The cell line may be transfected with two
`vectors, the first vector containing an operon
`encoding a light chain-derived polypeptide and the
`second vector- containing an operon encodi-ng ~a. heavy
`chain-derived polypeptide. Preferably, the vectors
`are identical except in so far as the coding
`sequences and selectable markers are concerned so as
`to ensure as far as possible that each polypeptide
`chain is equally expressed.
`Alte~natively, a single vector may be used, the
`vector including the sequences encoding both light
`chain- and heavy chain-derived polypeptides.
`The DNA in the coding sequences for the light
`and heavy chains may comprise eDNA or genomic DNA or
`both. However, it is preferred that the DNA sequence
`encoding the heavy or light chain comprises at least
`partially genomic DNA. Most preferably, the heavy or
`light chain encoding sequence comprises a fusion of
`eDNA and genomic DNA.
`
`BIOEPIS EX. 1182
`Page 8
`
`
`
`wo 89/01783
`
`PCT/GB88f00731
`
`- 7
`
`The host cell used to express the HAM of the
`present invention is preferably a eukaryotic cell,
`most preferably a mammalian cell, such as a CHO cell
`or a myeloid cell. It has been found, surprisingly,
`that the use of eDNA/genomic DNA fusions for the
`heavy or light chain coding sequences leads to
`enhanced production of the HAM of the present
`invention in non-myeloid mammalian cells. Thus, an
`important aspect of the invention is the use of such
`fusions in non-myeloid mammalian cells in order to
`express the HAM.
`The present invention also includes cloning and
`expression vectors and transfected cell lines used in
`the process of the invention, therapeutic and
`diagnostic compositions containing the HAM of the
`invention and uses of such compositions in therapy
`and diagnosis.
`The general methods by which the vectors may be
`constructed, transfection methods and culture me~hods
`are well known per se and form no part of the
`invention. Such methods are shown, for instance, in
`references 15 and 16.
`The present invention is now described, by way
`of example only, with reference to the accompanying
`drawings, in which:-
`Figure 1 shows the DNA sequences encoding the
`unprocessed variable regions of the B72.3 MAb
`obtained by sequencing the eDNA clones pBH41 and
`pBL52. Panel A shows the sequence coding for the VH
`region and the predicted amino acid sequence. Panel
`B shows the sequence coding for the VL region and the
`first 21 residues of the CL region, together with the
`predicted amino acid sequence. The points of fusion
`with the human C regions are indicated with arrows.
`
`.-
`
`BIOEPIS EX. 1182
`Page 9
`
`
`
`WO'S!'Jft1783
`
`PCTJGB88f00731
`
`-l
`
`- 8
`
`The putative sites of cleavage of the signal peptide
`are indicated by open triangles. The numbers refer
`to the nucleotides in th_e original eDNA clones;
`Figure 2 is a schematic diagram of the
`construction by site directed mutagenesis,
`restriction and ligation of the chimaeric heavy chain
`gene;
`
`Figure 3 is a schematic diagram of the
`construction by partial restriction and ligation of
`the chimaeric light chain gene;
`(In Figures 2 and 3, coding sequences are shown
`as boxes, dark for the variable regions and light for
`the constant regions. Restriction enzymes are
`abbreviated as follows: EcoRI=E; Bglii=B; Hindiii=H;
`Mboii=M; Hpai=Hp; and Scai=Sc. Dotted lines indicate
`the continuation of the sequence into vector or
`constant region DNA.)
`Figure 4 is a schematic diagram of the hCMV
`expression vector and the four alternative eDNA or
`gene constructs inserted into the EcoRI site. The
`chimaeric heavy chain gene was inserted using a
`BamHI-EcoRI oligonucleotide adapter. Coding
`sequences are represented by boxes, dark for the
`variable regions and light for the constant regions.
`The direction of transcription is indicated with an
`arrow;
`Figure 5 shows an ELISA analysis of COS-cell
`transfectant supernatants. The level of
`antigen-binding capacity in the supernatant of
`COS-cell transfectants was analysed as described
`later. Dilution curves were plotted out against the
`optical density of the colour change. Different
`antibodies were used to recognise mouse or human
`epitopes, and consequently the antigen-binding levels
`for each curve are not strictly comparable. Each
`
`BIOEPIS EX. 1182
`Page 10
`
`
`
`W089/01783
`
`PCT /GB88f00731
`
`- 9
`
`curve represents a co-transfection, as follows:
`A mouse heavy chain, mouse light chain; .A mouse
`heavy chain, chimaeric light chain; CJ chimaeric heavy
`chain, mouse light chain; . . chimaeric heavy chain,
`chimaeric light chain;
`Figure 6 shows SDS-PAGE analysis in a reducing
`gel of immunoprecipitations from the supernatants of
`transfected COS-cells. The DNA used for the
`transfection was as follows: Lane 1, mouse light
`chain alone; Lane 2, mouse light chain, mouse heavy
`chain; Lane 3, mouse light chain, chimaeric heavy
`chain; Lane 4, chimaeric light chain alone; Lane 5,
`chimaeric light chain, mouse heavy chain; and Lane 6,
`chimaeric light chain, chimaeric heavy chain. The
`antibodies used for the immunoprecipitations were:
`Lanes 1-3, rabbit anti"':'mouse F(ab' )z
`; Lanes 4-6,
`rabbit anti-human F(ab' )2
`Figure 7 shows SDS-PAGE analysis of
`immunoprecipitations from the supernatants of
`transfected cos-cells, under non-reducing (lanes
`1-3), and reducing (lanes 4-6) conditions. The DNA
`used for transfection was as follows:
`lanes 1 and 4,
`chimaeric light chain clone; lanes 2 and 5, chimaeric
`light chain, mouse heavy chain; lanes 3 and 6,
`chimaeric light chain, chimaeric heavy chain. The
`antibody used for the immunoprecipitation in each
`case was rabbit anti-human F(ab' )z
`Figure 8 shows SDS-PAGE analysis on a reducing
`gel of immunoprecipitations from the supernatants of
`transfected cos-cells, grown and labelled in the
`absence (lanes 1 and 3), and the presence (lanes 2
`and 4) of tunicamycin. The DNA used for the
`transfections was as follows:
`lanes 1 and 2,
`chimaeric light chain clone; and lanes 3 and 4,
`chimaeric light chain and chimaeric heavy chain. The
`
`BIOEPIS EX. 1182
`Page 11
`
`
`
`W089J01783
`
`PCf/GB88f00731
`
`- 10 -
`
`antibody used for immunoprecipitation in each case
`was rabbit anti-human F(ab')z
`Figure 9 shows reducing and non-reducing
`SDS-PAGE gels of chimeric B72.3 produced by CHO cells;
`Figure 10 shows a two dimensional SDS-PAGE gel
`of chimaeric B72.3 produced by CHO cells;
`Figure 11 shows a time course study of tumour
`labelling using B72.3 antibodies;
`Figure 12 shows the tissue/tumour ratio of the
`B72.3 antibodies; and
`Figure 13 shows the construction of plasmid
`
`TR002
`
`EXAMPLE 1
`
`Molecular cloning and seguencing of the B72.3 heavy
`and light chain cDNAs.
`
`Polyadenylated RNA was isolated from the B72.3
`hybridoma cell line using the guanidinium
`isothiocyanate/caesium chloride method (15). Double
`stranded eDNA was synthesised (17) and a eDNA library
`was constructed in bacteriophage ~ gt 10 vector
`using EcoRI linkers (18). Two screening probes were
`synthesised, complementary to mouse immunoglobulin
`heavy and light chain constant regions. The heavy
`chain probe was a 19 mer complementary to residues
`~ 1 sequence
`115-133 in the CH1 domain of the mouse
`(19). The light chain probe was a 20 mer
`complementary to residues 4658-4677 of the genomic
`mouse CK sequence (20). The probes were
`
`radio-labelled at the 5' terminus with [ C 3 Zp]
`
`ATP
`
`using T4 polynucleotide kinase (Amersham
`International) and used to screen the eDNA library.
`Clones which contained the complete leader,
`variable and constant regions of both the heavy and
`
`BIOEPIS EX. 1182
`Page 12
`
`
`
`WG89'Ltlt783
`
`PCT/GBSS/00731
`
`- 11 -
`
`light chains were isolated. The EcoRI eDNA inserts
`were subcloned into M13mp8 vectors for sequencing
`(21), generating a heavy chain clone, designated
`:
`- pBH41, and a light chain clone, designated pBL52.
`Nucleotide sequence analysis was carried out
`according to the chain termination procedure (22).
`The 980 base pair EcoRI insert in pBL52 was
`fully sequenced (22). The EcoRI insert in pBH41 was
`shown to comprise approximately 1700 base pairs by
`agarose gel electrophoresis. The variable domain and
`the 5' region of the CHl domain were sequenced, as
`was the 3' end of the clone to confirm the presence
`of the correct mouse C, 1 termination sequences. The
`DNA and predicted amino acid sequences for the
`unprocessed variable regions of pBH41 and pBL52 are
`shown in Figure 1. Examination of the derived amino
`acid sequence revealed considerable homology with
`other characterised immunoglobulin genes, and enabled
`the extent of the leader, variable and constant
`domains to be accurately determined.
`In addition,
`MAb B72"3 was confirmed to be an IgG1 K antibody, as
`previously reported (9).
`
`Construction of the Chimaeric Mouse-Human Heavy Chain
`Clone
`
`A genomic clone containing sequences coding for
`the human C 0 4 region was isolated as a Hindi II
`fragment from the cosmid COS Ig8 (23) and then cloned
`via pAT153 into M13tg130 as an EcoRI-BamHI fragment
`to form pJA78. Following DNA sequence analysis, an
`18 mer oligonucleotide was synthesised and site
`specific mutagenesis was performed to convert a C
`residue to an A residue, thereby generating a novel
`Hindiii site at the start of the CH1 exon, to yield
`pJA91.
`
`BIOEPIS EX. 1182
`Page 13
`
`
`
`W089J01783
`
`PCT/GB88f00731
`
`- 12 -
`
`Site directed mutagenesis was performed (24)
`using EcoRI- and Bgli-cut M13mp18 to generate a
`gapped duplex with the relevant phage template. DNA
`was transformed into E. coli HB2154 and resultant
`transformants were propagated on E. coli HB2151
`(Anglian Biotechnology Ltd) as described in the
`protocols provided. All mutations were sequenced
`using the chain termination procedure (22). All
`sequenced fragments were subsequently recloned into
`other vectors in order to exclude the possibility of
`secondary mutations which may have occurred during
`the mutagenesis procedure.
`The VH domain from the B72.3 heavy chain eDNA,
`cloned in M13mp9 as pBH41, was isolated as an
`EcoRI-Bgli fragment and introduced into the
`EcoRI-Hindiii sites of pJA91 in conjunction with a 32
`base pair Bgli-Hindiii adaptor to yield pJA93. The
`product was therefore a chimaeric immunoglobulin
`heavy chain gene containing a variable region derived
`from a mouse eDNA clone fused to a sequence,
`comprising the CHl, H, CH2 and CH3 domains separated
`by introns, derived from a human genomic clone. The
`accuracy of the variable/constant region junction was
`confirmed by nucleotide sequence analysis. A
`schematic diagram of details of the construction is
`given in Figure 2. The Q 4 constant region was
`selected as it possesses a limited repertoire of
`effector functions, but does bind to staphylococcal
`protein A, a potentially useful reagent for
`purification.
`
`Construction of the Chimaeric Mouse-Human Light Chain
`Gene
`
`The mouse light chain eDNA clone, pBL52,
`contains a cutting site for Mboii 18 base pairs
`
`BIOEPIS EX. 1182
`Page 14
`
`
`
`W0¥89{01783.
`
`PCT /GBSS/00731
`
`- 1'3 -
`
`downstream from the junction of the variable and
`constant domains. Due to sequence homology between
`the mouse and human CK genes, an identical cutting
`site exists in the latter gene (25) and use of this
`site provides a method of fusing the mouse variable
`and human constant domains. Partial digestion of the
`EcoRI fragment containing the mouse eDNA clone with
`Mboii generated a 416 base pair EcoRI-Mboii fragment
`with a single residue overhang. A genomic clone,
`comprising an M13-derived vector containing the human
`C-kappa gene on a Psti-Hindiii fragment was digested
`with Foki. A 395 base pair fragment containing the
`majority of C-kappa was cloned into pAT153 using
`EcoRI linkers to form pNW200. Digestion of a 945
`base pair Scai-Hindiii fragment from pNW200 with
`Mboii generated a 374 base pair Mboii-Hindiii
`fragment, which could anneal with and be ligated to
`the 416 base .pair EcoRI-Mboii fragment described
`above. The two fragments were ligated into a pSP64
`vector linearised with EcoRI and Hindiii, and used to
`transform competent E. coli HB101. The
`variable/constant region junction was sequenced in
`order to confirm the correct fusion. The
`construction is outlined schematically in Figure 3.
`
`Construction of Expression Vectors for Transient
`Expression in COS Cells
`
`The heavy and light chain chimaeric genes, as
`well as the mouse heavy and light chain eDNA clones,
`were inserted separately into the unique EcoRI site
`of plasmid pEE6 (27). The light chain encoding
`plasmid was designated EE6.cL.neo. For the chimaeric
`heavy chain, this was accomplished by using an
`oligonucleotide adapter to change the 3' BamHI site
`
`BIOEPIS EX. 1182
`Page 15
`
`
`
`W089J01783
`
`PCT [GB88[00731
`
`- 14 -
`
`to an EcoRI site to give an EcoRI fragment for
`cloning. The heavy chain encoding plasmid was
`designated EE6.cH.gpt. This plasmi_d contains the
`strong promoter/enhancer and tran~criptional control
`element from the human cytomegalovirus (hCMV)
`inserted into a unique Hindiii site upstream of the
`EcoRI site.
`In addition, an SV40 origin of
`replication site is provided by the SV40 early
`promoter which drives a selectable marker gene,
`either a neomycin-resistance gene (nee) for light
`chain genes or a guanine phosphoribosyl transferase
`gene (gpt) for heavy chain genes, inserted into a
`unique BamHI site. The plasmid also contains an
`ampicillin-resistance gene allowing selection and
`propagation in bacterial hosts. The structures of
`the expression vector and immunoglobulin gene inserts
`are shown schematically in Figure 4.
`
`Transfections and ELISA Analysis of Antibody
`Production
`
`The four expression constructs described above
`were used singly or in heavy/light chain gene pairs
`to transfect COS-1 cells {26). The cells were left
`to incubate in DNA-DEAE dextran solution for six
`hours, then shocked for two minutes with 10% DMSO in
`HEPES-buffered saline. The cells were washed and
`incubated in medium containing 10% foetal calf serum
`for 72 hours.
`for 72 hours the
`Following incubation at 37°C
`cell supernatants and lysates were analysed by ELISA
`for heavy and light chain production and binding of
`antigen.
`cells) was removed
`The medium (500 Ml per 10 5
`for ELISA analysis. Cell lysates were prepared by
`
`BIOEPIS EX. 1182
`Page 16
`
`
`
`W0'89/01783
`
`PCT/GBSS/00731
`
`- 15 -
`
`cells in 500 ~1 1% Triton X-100, 0.5%
`lysis of 10s
`deoxycholate, 0.1% SDS, 0.01M sodium phosphate pH
`7.5, 0.1M sodium chloride and 0.001M EDTA. Lysates
`and conditioned medium were centrifuged for 5 minutes
`in an Eppendorf centrifuge to remove nuclei and cell
`debris, and stored at 4°C
`before analysis.
`Microtitre plates were coated with 0.25 ~g per
`well of sheep or goat antibody reactive against
`either human or mouse specific epitopes on the heavy
`or light chains. Supernatants or lysates from
`transfected cos cells were diluted 1:2 or 1:4
`respectively in sample conjugate buffer containing
`O.lM Tris-HCl pH 7.0, O.lM sodium chloride, 0.02%
`Tween 20 and 0.2% casein.
`100 ~1 of each diluted
`sample were added to each well and incubated for 1
`hour at room temperature with gentle agitation.
`Following washing six times with wash buffer
`(phosphate buffered saline containing 0.2% Tween 20 1
`pH 7.2), 100 ~1 of 1:5000 dilution of standard
`horseradish peroxidase - conjugated antibody reactive
`against either human or mouse specific epitopes were
`added per well. The plates were incubated for 1 hour
`at room temperature/ and then washed six times with
`wash buffer. 100 ~1 of substrate buffer containing
`0.1 mg/ml tetramethylbenzidine (TMB), 0.1M sodium
`were added to
`citrate, pH 6.0 and 0.005% H202
`ea~h well to generate a colour change. The reaction
`was terminated after 2-3 minutes by adjusting the
`solution to pH 1.0 with 1.5M sulphuric acid. The
`optical density was determined at 450nm for each well
`by measurement in a Dynatech laboratories MR600
`microplate reader. Standard curves were generated
`using known concentrations of the appropriate human
`or mouse immunoglobulins.
`
`BIOEPIS EX. 1182
`Page 17
`
`
`
`W089/01783:
`
`PCT /GB88f00731
`
`- 16 -
`
`Antigen binding assays were performed in an
`analogous manner. Microtitre plates were coated with
`0~25 ~g per well of purified TAG-72 antigen (6)
`obtained from human patients or from tumour
`xenografts implanted in nude mice (both gifts of J.
`Schlomr NCI). Following washing six times in wash
`buffer, samples from cos-cell transfections were
`added as previously/ and the same subsequent
`procedures carried out, using goat anti-mouse or
`human F(abr)2
`linked to HRP as the second antibody.
`A number of assay systems using different
`capture antibodies were developed and
`cross-correlated to investigate the potential
`products of each transfection.
`In all cases, mouse
`light chain and chimaeric light chain were detected
`in the supernatants and lysates of appropriately
`transfected cells. However heavy chains were only
`detected in the supernatants when co-transfected with
`light chain. A low level of heavy chain was detected
`in the cell lysate in each case, supporting a
`suggestion of inhibition of heavy chain secretion in
`the absence of light chain.
`Assembly assays, which detect the presence of
`associated polypeptide chains, demonstrated the
`formation of multimers containing at least one heavy
`and one light chain when both genes were
`co-transfected. Mouse genes and chimaeric genes
`·appeared equally capable of assembly and formation of
`hybrid molecules.
`Antigen binding analysis (see above)
`demonstrated that the mouse heavy and light chain
`co-transfections generated an antibody molecule
`capable of recognising antigen. Replacement of the
`mouse gene for either chain with the appropriate
`chimaeric gene led to the production of a hybrid
`
`BIOEPIS EX. 1182
`Page 18
`
`
`
`WOD/9'1783
`
`PCTJGB88f00731
`
`- 17 -
`
`molecule with antigen binding specificity in the
`ELISA assays. Finally, transfection of the COS cells
`with both the chimaeric heavy and light chain genes
`generated a complete chimaeric antibody molecule with
`antigen binding specificity. The ELISA data from one
`experiment are presented in Figure 5. These
`experiments demonstrate that 11 humanisation" of the
`antibody molecule does not have a significant effect
`on its antigen recognition capability.
`
`ImmunopreciPitation of Antibody Molecules from
`Biosynthetically Labelled COS-Cell Transfectants
`
`Preliminary experiments suggested that there
`was little expression from the transfected DNA in the
`