Natur e (Lond on , En gland)
`B ~1 l. St acks
`UNIVERS i l.Y OF CAL IFORNI A1
`SAN DIEGO - LI BRARIES
`Received on : 04-0 1-88
`v. 1-
`Nov. 4, 1863-
`
`RESERVE COPY
`
`RETURN TO
`CIRCULATION DESK
`
`·. >zm ..... :t
`-
`::lJO O
`L.<-:tLU
`:::> >m-o
`rnro\Jl
`r :r> c..n o
`1> r
`r-.J
`-r~N
`,_ CDO'
`,
`::lJO
`V'lm-.<m
`>
`n
`Z V'InOO
`n
`c;c
`0 """0
`-.j...,J
`.....
`n m ni.J'I.&:(cid:173)
`> G"lCJ co r;,.
`o ·u N
`-<
`\JJ
`...0
`"' 0
`0' " \JJ co
`
`0
`
`RECOGNITION OF QUEEN.
`
`BIOEPIS EX. 1069
`Page 1
`
`

`

`nature
`
`24 March 1988
`Vol. 332 Issue no. 6162
`
`A retinue of worker honey bees in the court
`of a glass pseudo-queen (in centre of photo)
`treated with a five-component synthetic
`queen mandibular gland blend. The blend
`initiates retinue formation, recognized here
`by the body alignment of the workers, head
`towards the stimulus. See page 354. And
`how bees see the third dimension, page 356.
`
`THIS WEEK
`Serotherapy hope
`By engineering the hypervari(cid:173)
`able regions of a rat antibody
`raised against a human antigen
`into a human antibody seq(cid:173)
`uence, it is possible to produc4
`i an antibody specific for human
`lymphocytes and with poten(cid:173)
`tial
`applications
`in
`sero(cid:173)
`therapy, page 323.
`
`Proteins in stereo
`An improvement in resolution
`means that three-dimensional
`NMR spectroscopy can now
`tackle the structures of macro(cid:173)
`molecules such as a 46-residue
`protein, pages 374 and 303.
`Out of register
`Is the present system for regis-
`
`hke this tube-nosed fruit bat ,
`inadequate? See page 304.
`
`Risk of quakes
`The traditional methods of
`measuring the magnitudes of
`earthquakes are of only limited
`value , so some estimates of
`seismic risk are suspect. New
`more rigorous scales are now
`needed , page 319.
`
`Tin in the air
`in
`Decaying algal material
`naturally reducing environ(cid:173)
`ments like salt marshes may
`volatilize tin as stannane -
`and other metals might be lost
`to atmosphere via similar
`routes, pages 339 and 309.
`Microscopy by force
`This colour molecular-reso(cid:173)
`lution image shows the surface
`of a leucine crystal, as seen by
`the atomic force microscope ,
`now being used on biological
`
`molecules. White spots are
`highspots sensed by the atomic
`force probe, page 332.
`
`A domestic microwave oven
`cooks up
`superconducting
`material, page 311. More on
`the latest cuprate supercon(cid:173)
`ductors, pages 334 and 305.
`And
`thin
`film
`technology,
`page 295 .
`Tree ring dating
`Oak trees from bogs in North(cid:173)
`ern Ireland provide an accur(cid:173)
`ate date for the violent vol(cid:173)
`canic eruption of the Aegean
`island Santorini, page 344.
`
`Author Index
`The Author Index for January
`and February, facing page 380.
`
`Nature" (ISSN 0028-0836) is published weekly on Thursday, except the last week in December,
`ry Macmillan Magazines Ltd (4 Liule Essex Street , London WC2R 3LF). Annual subscription
`or USA and Canada US$250 (institutionaUcorpo rate), US$125 (individual making personal
`~~9~~7 ~0~~n~~~;:~;d~~r~:~~7~,~·:rz~~it~:t~:si~eft~:2 ~~~t;~8ite~xsc\J~J
`Second class postage paid at New York , NY 10012 and additionaf mailing offices. Authorization
`!o photocopy material for internal or personal use, or internal or personal use of specific clients,
`IS granted by Nature to libraries and others registered with the Copyright Clearance Cente r
`!CCC) Transactional R"K'rting Service , provided the base lee ol$1 .00 a copy.r,lus SO. IO a page
`Nlt~~~, diXf2J_~~3~~fs,'~~gso~~tr0~· i:~~;~.~~ts~~~7~d.};~~·c~~~n~s'ct~io~.~~;. 1~5
`~leecker Street, New York , NY 10012. Published in Japan by Nature Japan ~. K., Shin-Mitsuke
`ldg, 36 Ichigaya Tamachi , Shinjuku-ku , Tokyo 162, Japan. © 1988 Macmillan Magazines Ltd .
`
`291-292
`
`293-300
`
`OPINION
`Where the world stands on ozone • Stations in space •
`Living with civil war
`NEWS
`Space station partners • Ozone decline • Foreigners in
`SSC • US social science research • AIDS in France,
`London and USA • Superconductors • Indian space
`science • UK cash windfall • SDI five years old • French
`biology • West German education • Soviet education •
`Natal court ruling • West German graduate colleges •
`Electricity privatisation • UK biotechnology •
`Correspondence
`NEWS AND VIEWS
`Making the geoid respectable again
`Archaeology: Triple Czech burial Paul G Bahn
`An extra dimension to NMR Dagmar Ringe
`Conservation biology: Red books or green lists?
`Jared M Diamond
`Cuprate superconductors: Structure and superstructure
`Colin Greaves & Ted Forgan
`Immunology: Global or directed exocytosis?
`Michail V Sitkovsky & William E Paul
`Superfluidity of 3He films P V E McClintock
`Information processing: Neural populations revealed
`Terrence J Sejnowski
`Natural volatilization oftin Peter Craig
`A R J P Ubbelohde (1907-1988) J M Thomas
`Daedalus: Abstract concrete
`SCIENTIFIC CORRESPONDENCE
`Microwave syntheses for superconducting ceramics
`DR Baghurst,;A M Chippindale & D M P Mingos
`Punctuation in perspective J Maynard Smith
`Solitons and energy transfer in DNA
`K F Haverstock & R B Cundall
`AIDS incubation period in haemophiliacs M Rees
`Wood treatment used in Cremonese instruments
`C Y Barlow, P P Edwards, G R Millward,
`R A Raphael & D J Rubio
`Ultra-high energy radiation from young supernovae
`T K Gaisser , T Stanev & F Halzen
`BOOK REVIEWS
`The Problems of Physics by A J Leggett Sudip Chakravarty 315
`A Climate Modelling Primer by A Henderson-Sellers
`& K McGuffie A Slingo • Immobilized Cells: Principles
`and Applications by J Tampion & MD Tampion and
`lmmobilised Enzymes and Cells by A Rosevear et at
`Peter Dunnill
`Simple Curiosity: Letters from George Gaylord Simpson
`to His Family L F Laporte ed Colin Patterson
`Cancer Cytogenetics by S Heim & F Mite/man K W Jones
`• Vectors: A Survey of Molecular Cloning Vectors and
`Their Uses R L Rodriguez & D T Denhardt eds Tim Harris
`ARTICLES
`Evidence of bias in estimations of earthquake size
`G Ekstrom & AM Dziewonski
`Reshaping human antibodies for therapy
`L Riechmann. M Clark. H Waldmann & G Winter
`323
`Contents continued ..,..
`
`301
`302
`303
`
`304
`
`305
`
`306
`307
`
`308
`309
`310
`310
`
`311
`311
`
`312
`312
`
`313
`
`314
`
`316
`
`317
`
`318
`
`319
`
`BIOEPIS EX. 1069
`Page 2
`
`

`

`~N~A~TU~~~~E~v~o=L.~3~3~2~24~M~A~R=C~H~I~98~R~----------------------ARTICL£S.--------------------------------------------~3=23
`
`1 di fferent paths, and by ensuring that an azimuthally uniform
`coverage of stations is used in the averaging calculation. To
`compensate for other factors, such as focal depth, fault geometry
`and corner frequency would require such a detailed knowledge
`of the earthquake source that the M, measurement itself would
`be redundant.
`The results of this analysis can be summarized in five p_s>ints.
`( 1) A global average moment-magnitude relationship M, has
`been defined which can be used to predict M 0 over a wide range
`of magnitudes and scalar moments.
`(2) The variance of surface wave measurements for an event
`of a particular scalar moment is -0.2 magnitude units.
`
`(3) Large regional biases in Ms exist.
`(4) Differences in source scaling may explain some of the
`differences. Specifically, observations show that the transition
`from a slope of unity to a smaller value occurs at large moments
`for continental events than for ridge and fracture zone events,
`suggesting systematic differences in stress drop.
`(5) Other systematic factors affecting the calculation of M,
`also appear to contribute to the observed regional bias.
`We thank Professor J. H. Woodhouse for reading and correct(cid:173)
`ing the manuscript and Professor H. Kanamori for constructive
`criticism throughout our work on this subject. This work was
`supported by the NSF.
`
`Received 20 October 1987; accepted 4 February 1988.
`
`\. Richte r, C. F. Bull. seism. Sor. Am. 25, 1- 32 ( 1935).
`2 Va nek, J. et al. l zv. akad. Na uk.. USS R, Ser. Geophys. 2, 153- 158 (1962).
`3. Aki , K. Bull Earthqu. Res. lnst. Tokyo Univ. 44, 23-88 ( 1966).
`4. Agnew, D .. Berger, J., Buland, R., Farrell, W. & Gilbert, F. Eos 57, 280-288 ( 1976).
`5. Peterson, J., Butler, H. M., Holcomb, L. G . & Hull, C. R. Bull .<eism. Sor. Am. 66,2049-2068
`( 1976).
`6. Kana mori, H. & Given, J. W. Phys. Earth planet. Inter. 27,8-31 ( 198 1).
`1. Dziewonski , A.M ., Chou, T. A. & Woodhouse, J. H. J. geophys. Res. 86,2825-2852 (1981).
`8. Wood house, J. H. & Dziewonski, A. M. J. geophys. Res. 88,3247-3271 ( 1983).
`9. Woodhouse, J. H. & Dziewonski, A. M. J. geophys. Res. 89, 5953-5986 ( 1984).
`10. Oziewonski, A.M., Franzen, J. E. & Woodhouse, J. H. Phy.t. Ear1h planet. Inter. 34, 209-219
`( 1984).
`~
`tl . Oziewonski, A. M ., EkstrOm, G., Franzen, J. E. & Woodhouse, J. H. Phys. Earth plantt.
`Inter. 45, 11 -36 ( 1987).
`
`12. Dziewonski, A. M., EkstrOm, G., Woodhouse, J. H. & Zwart, G. Phys. Earth planer. fnr er.
`(in the press) .
`13. Kanamori, H. J. geophys. Res. 82, 2981 -2987 (\977).
`14. Richter, C. F. Elem entary Seismology (W. H. Freeman , San Fransisco, 1958) .
`15. Lienkamper, J. J. Bull. seism. Soc. Am. 74, 2357-2378 ( 1984).
`16. Kanamori, H. Anderson, D. L. Bull. seism. Soc. Am. 65, 1073-1095 (1975).
`17. Ekstrom, G. & Dziewonski, A.M. Bull. seism. Soc. Am. 75, 23-39 ( 1985).
`18. Sipki n, S. A. Bull. seism. Soc. Am. 76, 1515-1 54 1 (1986).
`19. Harkrider, D. G. Bull. seism. Soc. Am. 54, 627- 679 (1964).
`20. Gutenberg, B. & Ri chter, C. F. Gerlands Beitr. z. Geophysik 47, 73-13 1 (1936).
`21. Gutenberg, B. Bull . .<eism. Soc. Am. 35, 3- 12 ( 1945).
`22. VonSeggern, D. Bull. seism. Soc. Am. 60, 503-516 (1970).
`23. Nuttli, 0. Tectonophysics 118, 16 1-1 74 (1985).
`24. Kanamori, H. & Allen, C. R. in Maurice Ewing Series Vol. 6, Earlhquake Source Mechanics
`(A merican G eophysica l Union, Was hington, DC, 1986 ).
`25. Zhuo, T. & Kanamori, H. Bull seism. Soc. Am. 77, 514-529 ( 1987).
`
`Reshaping human antibodies for therapy
`
`Lutz Riechmannt, Michael Clark·, Herman Waldmann· & Greg Winter*
`
`MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK
`• Department of Pathology, University of Cambridge, Tennis Co urt Road, Cambridge CB2 IQP, UK
`
`A human /gG/ antibody has been reshaped for serotherapy in humans by introducing the six hyper6ariable regions from
`the heavy- and light-chain variable domains of a rat antibody directed against human lymphocytes. The reshaped human
`antibody is as effective as the rat antibody in complement and is more effective in cell-mediated lysis of human lymphocytes.
`
`IN 1890 it was shown that resistance to diphtheria toxin could
`be transferred from one animal to another by the transfer of
`serum. It was concluded that the immune serum contained an
`anti-toxin, later called an antibody 1
`• For many years animal
`antisera were used in the treatment of microbial infections and
`for the neutralization of toxins in man 2
`• More recently rodent
`monoclonal antibodies (mAbs) 3 have been used as 'magic bul(cid:173)
`6
`lets'4 to kill and to image tumours5
`. The foreign immuno(cid:173)
`•
`globulin, however, can elicit an anti-globulin response which
`may interefere with therapy 7 or cause allergic or immune com(cid:173)
`pl ex hypersensitivit/. Thus ideally human antibodies would be
`used. Human immunoglobulins are widely used as both prophy(cid:173)
`lactic and microbicidal agents8
`, but it would be far better to
`have available human mAbs of the desired specificity. It has
`proven difficult, ·however, to make such mAbs by the conven(cid:173)
`ti onal route of immortalization of human antibody-producing
`cells9
`•
`There is an alternative approach. Antibody genes have been
`transfected into lymphoid cells, and the encoded antibodies
`expressed and secreted; by shuffling genomic exons, simple
`chimaeric antibodies with mouse variable regions and human
`12
`constant regions have been made 10
`. Such chimaeric antibodies
`-
`
`t Address from April 1988: Department of Molecular Biology, The
`Research Institute of Scripps Clinic, North Torrey Pines Road, La Jolla,
`California 02937, USA
`:j: To whom correspondence should be addressed.
`
`have at least two advantages over mouse antibodies. First, the
`effector functions can be selected or tailored as desired. For
`example, of the human lgG isotypes, lgG 1 and lgG3 appear to
`be the most effective for complement and cell-mediated lysis 13
`15
`-
`,
`and therefore for killing tumour cells. Second, the use of human
`rather than mouse isotypes shou ld minimize the anti-globulin
`responses during therapy 16
`17 by avoiding anti-isotypic anti(cid:173)
`•
`bodies. The extent to which anti-idiotypic responses to rodent
`antibodies in therapy are dictated by foreign components of the
`variable versus the constant region is not known, but the use of
`human isotypes should reduce the anti-idiotypic response. For
`example, when mice were made tolerant to rat immunoglobulin
`constant-region determinants, administration of rat anti(cid:173)
`lymphocyte antibodies did evoke anti-idiotypic responses, but
`these were delayed and weaker than in animals that had not
`been made t.olerant 18
`. Nevertheless, it is likely that a chimaeric
`antibody would provoke a greater immune response than a
`human mAb.
`We have attempted to build rodent antigen binding sites
`directly into human antibodies by transplanting only the antigen
`binding site, rather than the entire variable domain, from ·a
`rodent antibody. The antigen binding site is essentially encoded
`by the hypervariable loops at one end of the ,B-sheet framework.
`The hypervariable regions of the heavy chain of mouse anti(cid:173)
`bodies against a hapten 19 or a protein antigen47 were previously
`transplanted into a human heavy chain, and, in association with
`the mouse light chain, the antigen binding site was retained.
`
`BIOEPIS EX. 1069
`Page 3
`
`

`

`~3Z~4-----------------------------------------ARTI CLES----------------------~N~AT~U~R~E~v~o~L~·~33~2~24~M~AR~C~H~I 9=~~
`
`11 ..... ATGCAAATCCTCTGAATCTACATGGTAAATATAGGTTTGTCTATACC
`1 Sp I i ce
`
`a
`~ ~ nd I I
`11------7 ANA slarls ~ ANA slarls
`ACAAACAGAAAAACATGAGATCACAGTTCTCTCTACAGTTACTGAGCACACAGGACCTCA +60
`s i gna 1
`-
`J.J S C
`L F L U A T A T)
`I
`I
`(M G
`CCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTAAGGGGCTCA + 120
`ATGAAGTTGTGGCTGAACTGGATTTTCCTTTTAACACTTTTAAAT
`J.J
`J.J
`. CM K L
`L N
`I F
`L L T L L N)
`
`CAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAATGACATCCACTTTGCCTTT + 180
`S I .
`oligos Ill, IY, Yll
`1
`P ICe-J., signal
`10
`S
`1
`(G U H S) Q U Q L Q E S G P G L U R
`CTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGAGAGCGGTCCAGGTCTTGTGAGA +240
`GGTATCCAGTGTGAGGTGAAACTGTTGGAATCTGGAGGAGGCTTGGTACAG
`I Q C)E U K L L E S G G G L U 0
`(G
`oligo X
`oligo XIII
`.,
`30., CDR 1
`·
`25
`20
`1 S
`P S Q T L S LTC T USGS T F S~
`CCTAGCCAGACCCTGAGCCTGACCTGCACCGTGTCTGGCAGCACCTTCAGCGATTTCTAC +300
`CCGGGGGGTTCTATGAGACTCTCCTGTGCAGGTTCTGGATTCACCTTCACTGATTTCTAC
`P G G S M R L S C A G S G F T F T~
`
`52 a
`SO
`45
`40
`oligo IX
`35
`J.J
`lli:Ji)J.J U R Q P P G R G L E
`I R D l
`I G I F
`ATGAACTGGGTGAGACAGCCACCTGGACGAGGTCTTGAGTGGATTGGATTTATTAGAGAC +360
`ATGAACTGGATCCGCCAGCCTGCAGGGAAGGCACCTGAGTGGCTGGGTTTTATTAGAGAC
`[}[]JJ.J
`I R Q P A G K APE J.J
`L GIF
`I R Dl
`oligo XI
`70
`65
`60
`CDR 2
`SS
`c 53
`b
`IK A K G V T T E V N P S U K Gl R U T M L
`AAAGCTAAAGGTTACACAACAGAGTACAATCCATCTGTGAAGGGGAGAGTGACAATGCTG +420
`AAAGCTAAAGGTTACACAACAGAGTACAATCCATCTGTGAAGGGGCGGTTCACCATCTCC
`I K A K G V T T E V N P S U K G l R F T
`I S
`
`85
`c 83
`a b
`82
`80
`75
`UDTSKNQFSLRLSSUTAADT
`GTAGACACCAGCAAGAACCAGTTCAGCCTGAGACTCAGCAGCGTGACAGCCGCCGACACC +480
`AGAGATAATACCCAAAACATGCTCTATCTTCAAATGAACACCCTAAGAGCTGAGGACACT
`RDNTQNMLVLQMNTLRAEDT
`oligo XII
`105
`100 a b101
`CDR 3
`95
`90
`A U V V C A R IE G H T A A P F 0 v i J.J G Q
`GCGGTCTATTATTGTGCAAGAGAGGGCCACACTGCTGCTCCTTTTGATTACTGGGGTCAA +540
`GCCACTTACTACTGTGCAAGAGAGGGCCACACTGCTGCTCCTTTTGATTACTGGGGCCAA
`AT v v c A R I E G H T A A p F D viJ.J G Q
`oli~ofoy ' Yl, Yl\ 13 lSpl ice
`G S L U T U S S
`GGCAGCCTCGTCACAGTCTCCTCAGGT .
`GGAGTCATGGTCACAGTCTCCTCA
`GUMUTUSS
`
`$amH I
`. ..... 3 ' +600
`
`Oligonucloolidos : I : 5 '-GGC CAG TGG ATA G ... C-3 ', Ill : 5'-CAG TTT CAT CT A
`GAA CTG GAT A-3', IY: 5'-GC ... GTT GGG TCT AG ... AGT GG"' C"'C C-3',
`Y: S'-TCA GeT G"'G TCG "'CT GTG AC-3', VI : S'-TC"' CCT G"'G TCG "'CT GTG
`AC-3 ', VII : S'- ... GT TTC "'CC TCG G ... G TGG ... c ... CCT-3 ', VIII : 5 '-TC ... CCT GAG
`GAG ACT GTG AC-3 ' ; IX : S'-GGC TGG CGA ATC CAG TT-3 ', X: S'-CTG TCT CAC
`CCA GTT CAT GT"' GM, ATe GCT G·A ... ' GGT GCT-3 ', XI : 5'-C"'T TGT CAC TCT
`CCC CTT CAC "'GA tGG "'TT GTA CTC TGT TGT GTA ... CC TTT AGC TTt GTC
`TCT AAT MA TCC ...... T CC"' CTC- 3', XII : S'-GCC TTG ACC CC"' GTA ATC AAA
`AGG AGe ... GC ... GT GTG Gee CTC TCT TGC AC ...... TA-3 ', XIII : 5'-AGA AAT
`CGG / C TGA AGG TGA AGC CAG ACA C-3 '.
`
`11.
`
`... ATGCAAATCCTCTGAATCTACATGGTAAATATAGGTTTGTCTATACC
`
`h
`H ~ ':'d I I
`.
`~RNA starts
`~RNA starts
`ACAAACAGAAAAACATGAGATCACAGTTCTCTCTACAGTTACTGAGCACACAGGACCTCA +60
`ATGA
`([)
`
`lSpl ice
`signal
`J.J
`L F L U A T A T)
`S C
`I
`I
`(M G
`CCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTAAGGGGCTCA + 120
`TGGCTGCAC TTCAACTCTTAGGGGTAGCTGCTAGCTCTGGCTCCCAG
`( M A A L
`a L
`L G U A A S S G S Q)
`
`CAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAATGACATCCACTTTGCCTTT + 180
`
`Spl iceJ,s i gnal
`10
`S
`1
`I Q M T Q S P S S L S A
`(G U H S)D
`CTCTCCACAGGTGTCCACTCCGACATCCAGATGACCCAGAGCCCAAGCAGCCTGAGCGCC +240
`GCCATGAGATGTGACATCAAGATGACCCAGTCTCCCTCATTCCTGTCTGCA
`(A M R C) D
`I K M T Q S P S F L S A
`oligo XIY
`
`CDR 1
`30
`25
`20
`15
`I D K v L I
`I T c IK A s Q N
`s u G D R u T
`AGCGTGGGTGACAGAGTGACCATCACCTGTAAAGCAAGTCAGAATATTGACAAATACTTA +300
`TCTGTGGGAGACAGAGTCACTCTCAACTGCAAAGCAAGTCAGAATATTGACAAATACTTA
`.c I K A s Q N
`I D K v L I
`s u G D A u T L N
`oligo XY
`CDR 2
`SO
`45
`40
`35
`a K P o K A P K L L 1 v IN T N N I
`[EJ w v a
`AACTGGTACCAGCAGAAGCCAGGTAAGGCTCCAAAGCTGCTGATCTACAATACAAACAAT +360
`AACTGGTATC AGCAAAAGCTTGGAGAATCTCCCAAACTCCTGATATATAATACAAACAAT
`[EJ w v a
`a K L G E s P K L L
`1 v IN T N N I
`
`•
`70
`65
`60
`55
`~G UPS R F S G S G S G T D F T F
`TTGCAAACGGGTGTGCCAAGCAGATTCAGCGGTAGCGGTAGCGGTACCGACTTCACCTTC +420
`TTGCAAACGGGCATCCCATCAAGGTTCAGTGGCAGTGGATCTGGTACTGATTTCACACTC
`~G I P SA F S G S G S G T D F T L
`oligo XY I
`COR 3
`90
`85
`80
`75
`I AT V V elL Q HI sl
`T IS SLaPE D
`ACCATCAGCAGCCTCCAGCCAGAGGACATCGCCACCTACTACTGCTTGCAGCATATAAGT +480
`ACCATCAGCAGCCTGCAGCCTGAAGATGTTGCCACATATTTCTGCTTGCAGCATATAAGT
`T IS SLaPE D VAT V Fe lLaH I sl
`
`108
`95
`100
`105
`I A P A Tl F G a G T K U E
`I K R
`AGGCCGCGCACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGTGAGTAGAATTTAAAC +540
`AGGCCGCGC ACGTTTGGAACTGGGACCAAGCTGGAGCTGAAACGG
`IRPRT IFGTGTKLELKR
`BamHI
`TTTGCTTCCTCAGTTGGATCC-3'
`
`Oligonucloot idos : II : S'-TGC AGC ATC AGC C-3' , XIY : S'-CTG CTG GTA CCA
`GTT TAA GTA TTT GTC AAT ATT CTG ACT TGC TTT "'CA GGT GAT GGT-3',
`XY : 5 '- GCT TGG CAC ACC CGT TTG CAA ATT GTT TGT ATT GTA GAT CAG
`CAG-3', XY I : S'-CCC TTG GCC GAA CGT GCG CGG CCT ACT TAT ATG CTG CAA
`GCA GT A GTA GGT-3 '.
`
`(
`Fig. 1 Heavy-chain (a) and light-chain (b) sequences of the variable domains of reshaped (upper line) or rat YTH 34.5HL (lower line)
`antibodies. The reshaped heavy-chain variable domain HuVHCAMP was based on the HuVHNP gene 12 •19, with the framework regions of
`~uman NEW (see note) alternating with the hypervariable regions of rat YTH 34.5HL. The reshaped light-chain variable domain HuVLCAM P
`is a similar construct, except with the framework regions of the human myeloma protein REI , with the C-terminal and the 3' non-coding
`sequence taken from a human J. -region sequence 36 The sequences of oligonucleotide primers are gi ve n and their locati ons o n the genes are
`marked.
`Methods. Messenger mRNA was purified37 from the hybridoma clone YTH 34.5HL ( y2a, K b) . First strand eDNA was synthesized by priming
`with oligonucleotides complementary to the 5' end of the CHI (oligonucleotide I) and the CK exons (oligonucleotide II ), and then cloned
`39
`and sequenced as described previously38
`. Two restriction sites ( Xba I and Sal! ) were introduced at each end of th e rat heavy-chain va ri abl e
`•
`region RaVHCAMP eDNA clone in M13 using mutagenic oligonucleotides III and V respectively, and the Xbai-Sa/i fragment was excised .
`The corresponding sites were introduced into the M13-HuVHNP gene using oligonucleotides IV and VI , and the region between the sites
`was then exchanged . The sequence at the junctions was corrected with oligonucleotides VII and VIII , and an internal Bam HI site removed
`using the oligonucleotide IX, to create the M13-RaVHCAMP gene. The encoded sequence of the mature domain is thus identical to th at of
`YTH 34.5HL. The reshaped heavy-chain variable domain (HuVHCAMP) was constructcxl in an M13 vector by priming wi th three long
`oligonucleotides simultaneously on the single strand containing the M 13-HuVHNP gene 12 · 19 . Each oligonucleotide (X, XI and XII) was
`designed to replace each of the hypervariable regions with the corresponding region from the heavy chain of 1he YTH 34.5HL antibody.
`Colony blots were probed initially with the oligonucleotide X and hybridization positives were sequenced: the overall yield of the triple mutan1
`was 5%. The (Ser27-+ Phe) and (Ser27-> Phe, Ser30-> Thr) mutants of MI3mp8-HuVHC AMP were made with the mi xed oligonucleotide
`XIII. The reshaped light-chain variable domai n (HuVLCAMP) was constructed in M 13 from a gene with framework regions based on hum an
`REI (J. Foote, unpublished data). As above, three long oligonucleotides (XIV, XV and XVI) were used to introduce the hypervariable regions
`of the YTH 34.5HL light chain.
`Note : There are discrepancies involving the first framework region and the first hypervariable loop of the NEW heavy chain between the
`published sequence 27 used here and the sequence deposited in the Brookhaven data base (in parentheses): Ser27 (-> Thr), Thr28 (->Ser) and
`Ser30 (->Asp). Neither version is de finitive (R. J. Poljak, person al communication) and the discrepancies do no1 affec1 o ur interpretations.
`
`BIOEPIS EX. 1069
`Page 4
`
`

`

`NATURE VOL. 332 24 M A RCH 1988
`
`ARTICLfS.- - -- - - - -- -- - ----=325
`
`,.
`I.
`
`Hu\'HCA MP RalgG2b
`
`l·luVLC\MP-I Iu ll!"
`
`~~ v II,.VIICA .\11'-II"i<Gi
`v ~ '""""'"•'''' 3 Jf
`rat v human
`
`Table 1 Reshaping the heavy-chain variable domain
`
`1-jeavy chain variable domain
`
`C oncentration of antibody
`in !-Lg ml - 1 at
`50%
`50%
`antigen
`complement
`lysis
`binding
`
`RaVHCAMP
`HuVHCAMP
`HuVHCAMP (Ser27 ~ Phe}
`HuVHCAMP (Ser 27-+Phe, Ser 30-+Thr)
`
`0.7
`27 .3
`1.8
`2.0
`
`2.1
`
`16.3
`17.6
`
`Antibodies with the heavy-chain variable domains listed above, rat
`lgG2b constant domains a nd rat light chains were collected fro m super(cid:173)
`nata nts of cells at sta tionary phase a nd concentrated by precipitation
`with ammonium sulphate , follo wed by ion exchange chromatography
`on a Pharm acia MonoQ column. The yields of antibody were meas ured
`by a n enzyme-linked immunosorbent assay (E LISA) directed agai nst
`the ra t IgG2b isotype, and each was adjusted to the same concentration35
`.
`To meas uring binding to a ntigen, pa rti ally purified CAMPATH-1 a nti(cid:173)
`gen was coated onto microtitre wells and bound antibody was -detected
`via a biotin-labelled anti-rat IgG2b mAb3 5
`, developed with a strep(cid:173)
`tavidin-peroxidase conjugate (Amersham). Co mplement lysis of human
`lymphocytes was with hum a n se rum as the complement source21. For
`both binding a nd complement assays, antibody titres we re determined
`by fitting the data to a sigmoid curve by at least squares iterative
`procedure21 .
`*Complement lysis with the HuVHCAMP variable domain was too
`weak for the estimation of lytic titre.
`
`CAMPATH-1 antigen and the selection of human effector func(cid:173)
`tions to match the lytic potential of the rat lgG2b isotype.
`Strategy
`The amino-acid sequences of the heavy- and light-chain variable
`domains of the rat lgG2a CAMPATH-1 antibody YTH 34.5HL
`were determined from the cloned complementary DNA (Fig. 1),
`and the hypervariable regions were identified according to
`Kabat 25
`• In the heavy-chain variable domain there is an unusual
`feature in the framework region. In most known heavy-chain
`sequences Pro41 and Leu45 are highly conserved: Pro41 helps
`turn a loop distant from the antigen binding site and Leu45 is
`in the {3 bulge which forms part of the conserved packing
`between heavy- and light-chain variable domains26
`• In YTH
`34.5HL these residues are replaced by Ala41 and Pro45 and
`presumably this could have some effect on the packing of the
`heavy- and light-chain variable domains. Working at the level
`of the gene and using three large mutagenic oligonucleotides
`for each variable domain, the rat hypervariable regions were
`mounted in a single step on the human heavy- or light-chain
`framework regions taken from the crystallographically solved
`proteins NEW27 and REI 28 respectively (Fig. 1). The REI light
`chain was used because there is a deletion at the beginning of
`the third framework region in NEW. The reshaped human
`heavy- and light-chain variable domains were then assembled
`with constant domains in three stage (Fig. 2). This permits a
`step-wise check on the reshaping of the heavy-chain variable
`domain (stage 1), the selection of the human isotype (stage 2),
`and the reshaping of the light-chain variable domain and the
`assembly of human antibody (stage 3). The plasmid construc(cid:173)
`tions were genomic, with the sequences encoding variable
`domains cloned as Hindiii-BamHI fragments and those encod(cid:173)
`ing the constant domains as BamHI- BamHI fragments in either
`pSVgpt (heavy chain) 29 or pSVneo (light chain) 30 vectors. The
`heavy-chain enhancer sequence was included on the 5' si de of
`the variable domain, and expression of both light and heavy
`chains was driven from the heavy-chain promoter and the heavy(cid:173)
`chain signal sequence.
`Heavy-chain variable domain
`In stage 1,
`the
`reshaped heavy-chain variable domain
`(HuVHCAMP) was attached to constant domains of the rat
`
`Fig. 2 Strategy fo r resha ping a human a ntibody for therapy.
`Sequences of rat o ri gin a re ma rked in black, and those of huma n
`o rigin in white. The reco mbin a nt he avy a nd light chains are also
`marked using a systematic no mencl ature. See text for description
`of stages I, 2 a nd 3. The ge nes encoding the vari able domains were
`excised from the MI3 vectors as Hindiii- BamHI fr agments, and
`recloned int o pSV2gpt29 (heavy chains) or pSV2neo30 {light
`chai ns), ex pression vecto rs co ntaining th e immunoglobulin en(cid:173)
`hancer1 2 The huma n y l (ref. 40), y2 (ref. 41 ), y3 ( ref. 42). y4
`(ref. 41 ) a nd K (ref. 36) a nd th e rat y2b (ref. 43) co nsta nt domains
`we re introduced as Bam HI~ fragments . The fo llowing plasm ids
`lines by
`were constru cted and transfected into lymph o id cell
`electroporation•• . In stage I, the pSVg pt plasmids HuVH CAM P(cid:173)
`Ra lgG2B, HuVHCAMP( Ser~ Phe)- Ra lgG2 B, HuVHCAMP(cid:173)
`(Ser27 ~ Phe, Ser30~Thr)-R a l gG2B we re introduced into th e
`heavy chai n loss va ri a nt of YTH 34.5 HL. In stage 2, th e pSVgpt
`pl asmids
`RaV HCAMP- Ra lgG2B,
`RaV HCAM P- Hul gGI,
`RaVHCAMP- Hul gG2, RaVHCAMP- Hul gGJ , RaVHCAMP(cid:173)
`HuigG4 were tran sfected as above. In stage 3, the pSV-gpt plas mid
`Hu (Ser27 ~ Phe, Ser30 ~ Thr )VHCAMP-H ul gG I was co-t ra ns(cid:173)
`fec ted with th e pSV-neo plasmid HuVLCAM P- HuigK into -th e rat
`myeloma cell line YO (Y B2/ 3.0 Ag 20 (ref. 31 ). In each of th e
`three stages, clones resistant to myco phenolic acid we re se lected
`a nd scree ned for a ntibod y production by ELISA assays. Clo nes
`secreti ng a ntibody were subcloned by limiting dilution (for YO) o r
`the soft aga r meth od ( for the loss vari a nt) and assayed again before
`I litre growt h in roller bottles.
`
`Since, to a first approximation, the sequences of hypervariable
`regions do not contain characteristic rodent or human motifs,
`such
`'reshaped' antibodies should be indistinguishable in
`sequence from human antibodies.
`There are mAbs to many cell-type-specific differenti ation anti(cid:173)
`gens, but only a few have therapeutic potential. Of particular
`interest is a group of rat mAbs directed against an antigen, the
`'CAMPATH-1' antigen, which is strongly expressed on virtually
`all human lymphocytes and monocytes, but is absent from other
`including the haemopoietic stem cells20
`• The
`blood cells
`CAMPATH-1 series contains rat mAb of lgM, lgG2a and lgG2c
`isotypes2 1
`, and more recently lgG I and lgG2b isotypes which
`were isolated as class-switch variants from the lgG2a-secreting
`cell line YTH 34.5 HL22
`• All of these antibodies, except the rat
`lgG2c isotype, are able to lyse human lymphocytes efficiently
`with human complement. Also the IgG2b antibody YTH
`34.5HL-G2b, but not the other isotypes, is effective in antibody(cid:173)
`dependent cell-mediated cytotoxicity (A DCC) with human
`effector cells 22
`. These rat mAbs have important applications in
`problems of immunosuppression: for example control of graft(cid:173)
`in bone-marrow transplantation 20
`versus-host disease
`the
`;
`management of organ rejection23
`; the prevention of marrow
`rejection ; and the treatment of various lymphoid malignancies
`(ref. 24 and M. J. Dyer, Hale, G., Hayhoe, F. G. J. and
`Waldmann, H., unpublished observations). The IgG2b antibody
`YTH 34.5HL-G2b seems to be the most effec.~ive at depleting
`lymphocytes in vivo but the use of all of these antibodies is
`limited by the anti-globuli n response which can occur within
`two weeks of the initiation of treatment 24
`. Here we describe the
`reshaping of human heavy and light chains towards binding the
`
`BIOEPIS EX. 1069
`Page 5
`
`

`

`~32~6---------------------------------------------ARTICUES~----------------------~NA~T~U~R~E~v~o~L~·~3~32~24~M~A~R=CH~t~98~8
`
`Fig. 3 Loop Phe27 to Tyr35 in the heavy-chain variable
`domain of the human myeloma protein KOL, which has
`been solved crystallographically'5
`. The backbone of the
`hypervariable region according to Kabat 25 is highlighted,
`and a 200 % van der Waal surface is thrown around Phe 27
`to show the interactions with Tyr 32 and Met 34 of the
`Kabat hypervariable region. In the rat YTH 34.5HL heavy
`chain, these three side chains are conserved in character,
`but in HuVHCAMP, Phe27 is replaced by Ser.
`
`We therefore selected the human lgG 1 isotype for the
`reshaped antibody. Other recent work also favours the use of
`lgG1 isotype for therapeutic application. When the effector
`functions of human isotypes were compared using a set of
`chimaeric antibodies with an anti-hapten variable domain, the
`lgG1 isotype appeared superior to the lgG3 in both complement
`and cell-mediated lysis 15
`. Also, of two mouse chimaeric anti(cid:173)
`bodies with human lgG 1 or lgG3 isotypes directed against cell
`surface antigens as tumour cell markers, only the IgG1 isotype
`14
`mediated complement lysis 13
`•
`.
`
`a 60
`50
`
`"'
`~
`c:
`" u
`" a.
`
`40
`
`30
`
`20
`
`10
`
`.01
`
`. 1
`
`10
`
`100
`
`1,000
`
`Antibod y co nc entration , j.J.-9 ml'1
`
`b
`
`50
`
`40
`
`"'
`~ 30
`~ 20
`"
`a.
`
`10
`
`.0001
`
`001
`
`.01
`
`. 1
`
`10
`
`100
`
`Antibod y co nc entration , jJ.9 mt· '
`
`Fig. 4 a, Complement lysis and b, ADCC for antibodies with rat
`light-chain and rat heavy-chain variable domain attached to human
`lgGI (D), lgG2 (0), lgG3 (•), or lgG4 (\7) isotypes. Lysis with
`the YTH 34.5HL antibody (e ) is also shown.
`Methods. Antibody was collected from cells in stationary phase,
`concentrated by precipitation with ammonium sulphate and desal(cid:173)
`ted into phosphate buffered saline (PBS). Antibodies bound to the
`CAMPATH-1 antigen-coated on microtitre plates , were assayed
`in ELISA directed against the rat K light chain3 5
`, and each adjusted
`to the same concentration . The antibodies were assayed in comple(cid:173)
`ment lysis (Table I) and ADCC with activated human peripheral
`46
`blood mononuclear cells35
`. Briefly, 5 x 104 human peripheral
`·
`blood cells were labelled with 51C r and incubated for 30 min at
`room temperature with different concentrations of antibody. Excess
`antibody was removed and a 20-fold excess of activated cells add ed
`as effectors. After 4 h at 37 oc cell death was estimated by 51Cr
`release.
`
`isotype IgG2b and transfected into a heavy-chain loss variant
`of the YTH 34.5 hybridoma. This variant carries two light chains,
`one derived from the Y3 fusion partner31
`. The cloned rat heavy(cid:173)
`chain variable domain (RaVHCAMP) was also expressed as
`above, and the antibodies were purified and quantified (Table
`1). The HuVHCAMP and RaVHCAMP antibodies, each of the
`rat IgG2b isotype, were compared to the CAMPATH-1 antigen
`in a direct binding assay and in complement lysis of huma