`
`•
`RESEARCH
`
`RESHAPING A HUMAN MONOCLONAL ANTIBODY TO
`
`
`
`
`INHIBIT HUMAN RESPIRATORY SYNcmAI. VIRUS
`INFEOION
`IN VNO
`Philip R. Temfest1•2,
`
`
`Patricia Bremner1•2, Martin Lambert2, Geraldine Taylor3,
`Julie M. Furze , Frank J. Carr1 and William J. Harris1•2·*
`
`1Scotgen Limited, 2 Tillydrone Avenue, Aberdeen AB9 2TN, Scotland, UK. 2Department of Molecular and Cell Biology,
`
`
`
`
`
`
`
`
`
`
`University of Aberdeen, Aberdeen AB9 !AS, Scotland, UK. 3AFRC Institute for Animal Health, Compton, Newbury, Berkshire,
`
`RG16 ONN, UK. *Corresponding author.
`
`and possibly intragastric or intravenous feeding. Recently,
`
`
`
`We transferred the complementarity de
`
`
`
`the drug ribavirin has been introduced and has shown
`termining regions from a murine mono
`
`
`efficacy5. However, the drug has to be administered over
`
`clonal antibody that neutralizes infection
`
`
`
`an 18-hour period by aerosol inhalation. In addition, the
`
`by respiratory syncytial virus (RSV) to a
`
`
`
`level of secondary infections following cessation of treat
`
`
`ment is significantly higher than in untreated patients.
`human IgGl monoclonal antibody. The
`
`
`
`Evidence that serum therapy may protect against RSV
`resulting reshaped human antibody lost
`
`
`
`infection comes from a number of sources: ( 1) infants, less
`affinity for RSV, but an additional
`alter
`
`than one month old, show a low incidence of severe
`
`
`bronchiolitis and this has been interpreted as due to
`ation to one of the framework regions
`
`
`protecting maternal antibodies6; (2) human intravenous
`restored binding affinity and specificity.
`
`immunoglobulin (IVIG) prepared from high titer RSV
`This second generation reshaped human
`immune humans reduces nasal RSV shedding and im
`
`monoclonal antibody cross-reacted with
`
`
`proves oxygenation7; (3) a number of animal studies have
`shown that cotton rats and monkeys are protected against
`all clinical isolates of RSV tested and both
`
`infection by passive administration of IVIG8•9, and mouse
`
`
`prevented disease and cured mice even
`10
`
`
`monoclonal antibodies both protect against infection
`
`when administered four days after infec
`
`
`and clear an established RSV infection in mice11• It is
`
`
`
`possible then that a single i�jection of high titer neutral
`tion. We expect the antibody will prove
`
`
`
`izing monoclonal antibody will be more acceptable to the
`useful in the management of this major
`
`
`clinician to protect and possibly treat the child and pre
`childhood disease.
`vent virus spread.
`While mouse monoclonal antibodies with high neutral
`
`
`
`
`izing activity could be used in human therapy, application
`syncytial virus (RSV) is the major
`
`
`
`
`
`is severely limited by the immune response against mouse
`
`
`cause of acute respiratory illness in young chil
`
`
`
`protein, reduced half-life of mouse antibodies in humans
`
`
`dren admitted to hospitals, and the community
`
`
`and poor recognition of mouse antibody effector domains
`
`practice will treat perhaps five times the num
`
`12·13. Two genetic engineer
`
`
`
`ber of hospitalized children. It therefore causes one of the
`by the human immune system
`
`ing techniques have been devised in an attempt to reduce
`
`
`major childhood diseases, giving rise to annual epidemics
`
`
`of bronchiolitis and pneumonia in children throughout
`
`
`
`immunogenicity. Chimaeric antibodies14 were described
`
`the world1·2. While the majority of communit'.y-acquired
`
`in which the genetic information encoding the murine
`
`heavy and light chain variable regions are fixed to genes
`
`
`
`infections resolve themselves in a week to ten days, many
`
`encoding the human heavy and light constant regions.
`
`
`
`hospitalized children, especially under six months of age,
`
`
`The resulting mouse-human hybrid has about 30% of the
`
`
`require assisted ventilation. More severe disease may
`
`intact immunoglobulin derived from murine sequences.
`result in permanent damage to the lungs leading to
`
`
`
`In the second approach, only the genetic information for
`
`
`pulmonary fibrosis. This can leave a child with increased
`
`
`
`the hypervariable complementarity determining regions
`
`
`susceptibility to chest infections such as chronic bronchitis,
`
`(CDRs) is derived from the murine antibody and trans
`
`and indeed about 50% of the more seriously ill children
`
`
`planted in a human monoclonal antibody. With this tech
`
`
`go on to show recurrent bouts of wheezing in later years3•
`nique, only about 3% of the amino acid sequence is of
`
`
`Efforts to produce an effective vaccine have been un
`
`
`successful4 and the major current treatment consists of
`
`
`murine origin15• Here we have used this CDR grafting
`
`
`technique to redesign an anti-RSV mouse monoclonal
`
`
`
`intensive patient management involving the use of oxygen
`
`R espiratory
`
`266 BIO/TECHNOLCGY
`VOL 9 rv!ARCH 1991
`
`1 of 6
`
`BI Exhibit 1070
`
`
`
`from at least ten independent clones. All VH clones were
`
`
`antibody as a human IgG l monoclonal antibody and
`
`
`
`
`demonstrate the ability of this reshaped antibody to pro
`
`identical as were VK clones except for one unrelated
`tect and cure mice from RSV infection.
`
`
`
`sequence, which contained a base pair deletion and con
`
`
`
`sequently would be expected to be non-functional. The
`
`
`deduced amino acid sequences following DNA sequenc
`RESULTS
`ing of clones is shown in Figure l, with CD Rs defined by
`V region sequence analysis of murine antibody. The
`
`original murine monoclonal antibody was RSV19
`
`computer assisted alignment with other VH and VK
`
`
`
`(lgG2a,K), specific for the fusion (F) protein of RSV. This
`
`
`
`sequences16. The VH sequence is most closely related to
`
`
`
`antibody has been shown to neutralize RSV infection
`Kabat subgroup IIC and the VK to Kabat subgroup II.
`in
`
`vitro and protect mice (see below and E. J. Stott and G. T.,
`
`The DNA sequence has been lodged with the EMBL data
`
`in preparation). Cytoplasmic RNA was prepared from
`library.
`
`RSV19 hybridoma cells and cDNA from the immunoglob
`Transplantation of CDR sequences into human frame
`
`
`ulin (lg) mRNA using primers specific for lg heavy chain
`works. The human frameworks chosen to accept the CDR
`
`were derived from NEWM for VH and REI for
`sequences
`
`
`
`variable (VH) regions and lg light chain variable regions
`
`VK17•18 and were within Ml3 based templates with irrel
`
`(VK) (see Experimental Protocol). VH and VK cDNAs
`
`evant CDRs as described by Riechmann et al.19 Synthetic
`
`
`were then amplified using the polymerase chain reaction
`and cloned into Ml3. Amplified DNAs from two separate
`
`
`
`oligonucleotides were synthesized containing the VH and
`
`VK CDRs flanked by short sequences drawn from NEWM
`
`
`cDNA preparations were sequenced in both directions
`
`
`and REI frameworks respectively and grafted into the
`
`
`
`human frameworks by site-directed mutagenesis20. The
`
`
`resulting constructs (HuRSV19VH/VK) are shown in Fig
`ure 2.
`Expression of reshaped antibody. The reshaped VH
`TDLE 1 Binding of anti-RSV antibodies to clinical isolates.
`
`
`
`
`and VK genes were transferred into vectors pSVgpt
`Extent of Fluorescence•
`
`
`
`(conferring resistance to mycophenolic acid) and pSVhyg
`
`
`
`
`(conferring resistance to hygromycin) respectively21 and
`HuRSV19VHFNS/VK Murine RSV19
`
`
`human IgG 1 and human kappa constant regions added.
`
`These were then cotransfected into YB2/0 rat myeloma
`
`
`
`cells and mycophenolic acid resistant clones selected and
`
`
`
`
`screened for antibody production. Antibody was purified
`
`
`by protein A affinity chromatography and analyzed by
`
`
`SDS-PAGE under reducing conditions. Two polypeptides
`
`
`of approximately 55kD and 25kD, corresponding to the
`
`
`heavy and kappa chains, were visible. Such clones secrete
`
`intact human IgG l with yields of approximately 5 µg/ml/
`106 cells.
`Figure 3
`Antigen binding of reshaped antibodies.
`
`shows the binding of HuRSV l 9VH/VK antibody to anti
`
`gen. Levels of binding were not significantly above back
`
`
`ground. Comparison of VH amino acid sequences be
`tween murine RSV19VH (Fig. 1) and HuRSV19VH (Fig.
`
`2) shows that 3 out of 4 amino acid differences occur
`
`between amino acids 9 1-94. The majority of mouse and
`
`
`human VHs have arginine at position 94, which is able to
`acid at fosition 101
`form a salt bridge with aspartic
`
`
`contributing to the conformation of CDR3 2. Since the
`murine RSV19VH lacks Arg94 but has AsplOl we
`
`thought it possible that in HuRSV19VH an Arg94-
`Aspl01 salt bridge has been imposed thereby altering the
`
`
`conformation and antigen interaction of CDR3. Accord
`
`ingly, a second generation antibody was constructed,
`HuRSV19VHFNS/VK, with the murine amino acids
`
`9 1-94 FCNS being used to replace the human VH frame
`work amino acids YCAR (Fig. 2). It can be seen from
`
`
`Figure 3 that this resulted in the restoration of substantial
`
`
`
`antigen-binding ability. The restored binding affinity was
`
`lower than that with the original murine monoclonal
`
`
`antibody though direct comparison is difficult since dif
`FIGURE 1 Deduced amino acid sequences of (a) VH and (b) VK of
`
`
`
`ferent conjugated antibodies were used to detect mouse
`
`murine RSV19 antibody. CDRs are boxed. Amino acids dictated
`and human immunoglobulins.
`by the PCR primers are underlined.
`
`Su�oupB
`
`00634
`V4715
`V00463
`V4712
`VOOl65
`V00422
`V837
`V00900
`4677
`4424
`VOI231
`
`•
`
`© 1991 Nature Publishing Group http://www.nature.com/naturebiotechnology
`
`++++
`++++
`++
`+
`++
`++
`++
`++++
`+++
`+++
`+
`++
`+
`
`+
`++
`+
`++
`++
`++
`+++
`++
`+++
`++
`+
`
`++++
`++++
`+++
`++
`+++
`+++
`++
`++++
`+++
`+++
`+
`++
`++
`
`++
`+++
`++
`++
`++
`++
`+++
`++
`+++
`++
`+
`
`Isolate Number
`
`Sutrsoup A
`
`818
`V795
`V00401
`V00214
`V00764
`V743
`V316
`V369
`Vl249
`V04692
`Vl248
`V01232
`V729
`
`•+, ++, +++ and ++++ refer to relative numbers of fluo
`�esdng cells observed and represent the proponion of cells
`infected.
`
`(•)
`
`YK
`
`(b) VK
`DI 0 LT 0 SP LS LP YTL G D QA SIS C �
`0 Y 0 L 0 E/Q S G T E L E R S C A S V K L S
`C T A S C
`L E \v r L o K P c
`lo Y v " HI v " K o R P o o c L E w 1 c �
`
`O T L v K T o c N T v o s r x L L
`F N 1 K
`PEND DY Q YAP K F Q clK AT KT AD TS SN T
`1 v IR vs s R r sic v Po R rs cs cs c Tor TL
`
`A y L Q L T s I. T F E D T A v v r c N s
`lw G s D r D
`£ o L c v v r c Ir o c s H L P R Tl r c
`K 1 s R v E A
`�WC 0 G T TV TVS S
`G G T K L E I
`
`BIO!ffCHNOLcx;Y VOL 9 MARCH 1991 267
`
`2 of 6
`
`BI Exhibit 1070
`
`
`
`•
`
`© 1991 Nature Publishing Group http://www.nature.com/naturebiotechnology
`
`MuRSV19
`
`HuRSV19VHFNS/V
`K
`
`1.8
`In vitro biological activity of reshaped antibody. For
`
`
`
`
`
`clinical use, an antibody must recognize a high percentage
`
`of clinical isolates. Table I shows that the human antibody
`1.6
`
`
`
`HuRSVl9VHFNS/VK recognizes the same broad spec
`
`
`
`trum of isolates as the original murine antibody. Inhibi
`
`tion of virus induced cell fusion in vitro is a good indicator
`1.4
`
`of in vivo protection 10• Table 2 shows that the human
`
`
`
`antibody is effective at preventing the formation of giant
`1.2
`
`
`
`cells associated with RSV-induced cell fusion. Moreover,
`
`
`residual giant cells in antibody treated cultures were
`smaller and had fewer nuclei per cell than in untreated
`1.0
`
`
`
`cultures. The concentration of reshaped antibody which
`A,1>2
`
`produced a 50% reduction in the number of multinucle
`
`ated giant cells (6.3 µg/ml) was equivalent to that observed
`0.8
`
`
`with the original murine antibody (4.0 µg/ml).
`
`In vivo biological activity of reshaped antibody.
`with l 04 pfu of
`BALB/c mice were challenRed intranasally
`A2 strain of human RSV1 either before or after intrana
`
`
`sal or intraperitoneal treatment with HuRSVl9VHFNS/
`
`VK human antibody. It can be seen from Table 3 that a
`
`single dose of 25 µg antibody per mouse is extremely
`
`
`
`effective in both prevention and treatment of RSV infec
`0.2
`tion.
`A comparison of the ability of the original mouse
`
`
`
`
`
`antibody and the reshaped human antibody to clear an
`
`
`
`established infection in BALB/c mice, when administered
`
`
`intraperitoneally on day 4 of infection, is shown in Figure
`ANTIBOOY,ng
`
`
`4. In this experiment, mice were infected with 105 pfu of
`virus, which is IO times greater than that used in the
`FIGlll 3 Antigen binding by murine RSV19, HuRSV19VH/VK
`
`experiment shown in Table 3. There were no significant
`
`
`and HuRSV19VHFNS/VK antibodies measured by ELISA.
`
`
`
`differences in the ability of the two antibodies to remove
`virus from the lungs of mice. However, with the greater
`
`
`challenge dose of virus, approximately 5 mg/kg body
`
`weight were required to clear the infection.
`
`0.6
`
`0.4
`
`0.8 3.1 12.5 50 200
`
`HuRSV19VH/
`VK
`
`Average Number
`of Nuclei per
`Cell
`
`TAILE 2 Inhibition of RSV induced cell fusion by reshaped
`
`DISCUSSION
`
`anti-RSV antibody.
`
`
`
`The potential uses for human monoclonal antibodies in
`Concentration of
`
`
`
`diagnosis, prophylaxis and therapy were immediately
`Number of
`HuRSVl9VHFNS/VK
`
`
`recognized with the first isolation in 1977 of a human cell
`Giant Cells*
`(µ.g/ml)
`
`
`
`
`line secreting specific antibody, but the development of an
`44
`100
`
`
`
`
`appropriate production technology has been a slow, labo
`71
`50
`
`
`rious process23-26. Despite continuing research, a rou
`40
`25
`
`
`
`tinely applicable efficient methodology for isolating hu
`12.5
`67
`
`
`man monoclonals by mammalian cell transformation or
`89
`6.3
`
`
`
`cell fusion, techniques now so well established for rodent
`87
`3.1
`
`
`
`monoclonal production, is still not available. As an alter
`164
`1.6
`0.8
`201
`
`
`native, the use of genetic engineering has allowed the
`292
`0.4
`
`
`
`partial conversion of rodent antibodies into mouse-hu
`219
`0.2
`
`
`
`man chimaerics 14 and the use of protein engineering now
`239,259
`0 (virus only)
`
`allows the transfer of antigen binding specificity and
`10
`0 (no virus)
`
`affinity from a rodent antibody into a human immuno
`
`globulin of any desired subtype15•27-29•
`*Scored as the number of cells with 2 or more nuclei in 20 fields
`
`
`
`with a 25 x objective microscope lens.
`
`The seminal studies on the use of CDR grafting to
`N.D., not determined.
`
`
`
`reshape human antibodies have already demonstrated the
`
`
`
`ability to transfer the properties required for successful
`
`
`
`depletion of T cells 19, inhibition of T-cell proliferation 30
`
`
`and tumour imaging (M. Verhoeyen, personal communi
`
`
`cation). Our data has now shown that it is possible to
`
`
`produce a human monoclonal antibody with the compos
`FIGUIE 2 Amino acid sequences of murine and reshaped
`VH and
`
`
`of an ite of properties necessary for in vivo treatment
`
`
`to Kabat et is according VK containing RSV19 CDRs. Numbering
`
`al.16
`
`
`
`infectious disease. The concentrations of human antibody
`
`4.5
`4.0
`3.8
`N.D.
`N.D.
`N.D.
`N.D.
`N.D.
`N.D.
`N.D.
`14,13.5
`
`:::::::::::IT::::::
`::: __ ::::::��'.
`::�tt::::: ::::::
`HuRSV19VH :::".:::;:::
`--------PG-V-PSOTLS- T--V---T:o ::_P-GR-----..._ _____ ,.,. V--LV---K-OFS-R-S-V-AA-----F-ND ���-------
`
`MuRSV19VH
`
`HuRSV19VHFNS
`
`HuRSV19VK
`
`9.. 101
`
`HuRSV19VK
`
`268
`
`BIOffECHNOLOGY VOL. 9 MARCH 1991
`
`3 of 6
`
`BI Exhibit 1070
`
`
`
`•
`
`© 1991 Nature Publishing Group http://www.nature.com/naturebiotechnology
`
`required to inhibit in vitro virus-induced cell fusion and to
`
`
`
`in our laboratories. Ideally, reshaping of antibodies would
`
`
`
`
`
`
`treat mice in vivo (Tables 2 and 3) are equivalent to those
`
`be based upon structural data for each antigen-antibody
`
`
`needed with the original murine antibody (Fig. 4).
`
`
`
`interaction but this is clearly impractical. Our approach is
`
`
`Structural and computer analysis of antigen antibody
`
`
`
`to introduce ordered steps of additional alterations to
`
`
`interactions have clearly demonstrated that individual
`
`achieve the minimal number of changes to the human
`
`
`
`framework residues can be critical for correct interactions
`
`
`
`structure necessary to restore binding affinity and speci
`
`
`
`
`ofCDRs with antigen. For example, an arginine residue at
`
`
`
`ficity. Comparison of the amino acid sequences of the
`
`
`position 94 in VH is thought to interact with the invariant
`
`
`murine and human frameworks (Fig. 2) reveals a number
`
`
`
`aspartic acid residue at position 101 in the CDR22. It is not
`
`
`of potential sites of framework-CDR interaction, and in
`
`
`surprising then that simple transplantation of the CD Rs as
`
`this case, the interaction between CDR3 and its flanking
`
`
`
`defined by Kabat from mouse to human often results in
`
`
`
`framework residues was considered a significant struc
`
`loss of binding affinity. This occurred with RSVl 9 (Fig. 3)
`
`
`
`tural variation (residues 91-94). An alternative to our
`
`
`
`and with several other antibodies undergoing reshaping
`
`
`
`
`approach30 involves the construction of a consensus hu
`
`man structure based upon the best homology achievable
`
`
`
`with the original rodent antibody sequence. Which of
`
`
`
`these approaches is more effective at eliminating a human
`
`immune response remains to be clarified.
`
`
`The projected advantages for human therapy of a
`
`reshaped human antibody compared with a rodent anti
`
`body are the absence of, or a considerably reduced,
`
`
`immune response allowing repeated treatment and an
`
`
`
`
`increased serum half-life, reducing the dose required and,
`
`
`in the case of prophylactics, extending the period of
`
`
`
`protection provided by a single treatment. The lack of an
`
`
`
`immune response has now been demonstrated with re
`
`
`
`gard to one reshaped antibody constructed upon the same
`
`
`
`human framework used in our studies and antibody was
`still detectable
`in vivo eight days after administration31•
`
`
`These data also demonstrate the superiority in half-life
`
`and reduced immune response of the reshaped product
`
`compared to a chimaeric antibody13.
`The findings that our reshaped antibody is effective
`
`
`FIGUIE 4 Effects of monoclonal antibodies on growth of RSV in
`
`
`
`
`against a wide range of clinical isolates of RSV (Table 1)
`(e) and murine RSV19 (0) given
`lungs. HuRSV19VHFNS/VK
`
`and both protects and cures mice (Table 3) raises hope
`
`
`
`intraperitoneally 4 days after intranasal inoculation of mice with
`
`
`
`that it will be clinically effective, thereby offering an
`105 pfu RSV strain A2.
`
`additional weapon in the management of this major
`
`childhood infection.
`
`6
`
`� Q, 5
`9 0
`!2
`CJ z "
`:::> ..J
`;/;;
`w � 3
`�
`en :::> a:
`> 2
`<t.7
`1.3
`
`3.7
`3.1
`2.5
`1.9
`DOSE OF IG ( log,.µg/kgbody welghl)
`
`43
`
`Antibody Treatment
`
`Day*
`-I
`
`-1
`
`+4
`
`+4
`
`No antibody
`
`EXPERIMENTAL PROTOCOL
`
`
`
`TAILE 3 Prevention and treatment of RSV infection in mice by
`Materials. Murine monoclonal antibody hybridoma cell line
`
`
`
`HuRSV19VHFNS/VK antibody.
`
`
`RSV 19 was obtained from AFRC Institute for Animal Health,
`
`
`
`Compton, UK10. Rat myeloma YB2/032, obtained from ATTC, is
`
`
`a non-lg secreting cell line and was grown in Dulbecco's modified
`
`
`
`Eagle's medium (DMEM) containing 10% fetal calf serum. Vec
`tors M13VHPCR1, Ml3VKPCR1, pSVgpt and pSVhyg have
`been described in detail21 and were obtamed from G. Winter,
`
`
`
`
`
`MRC Laboratory of Molecular Biology, Cambridge, UK. Oligo
`
`
`
`nucleotides were synthesized using an Applied Biosystems 381
`
`
`DNA synthesizer. For cDNA synthesis, the primers were
`VH l FOR 5' TGAGGAGACGGTGACCGTGGTCCCTTGGC·
`CCCAG 3'; VKJFOR 5' GTTAGATCTCCAGCTTGHGTCCC
`
`
`3'. For PCR, the additional primers were VHl BACK 5' AGGTS
`MARCTGCAGSAGTCWGG 3'; VKIBACK 5' GACATTCAGC
`
`
`TGACCCAGTCTCCA 3'. For site-directed mutagenesis to
`
`transplant CDRs, the primers used were: VHCDRl 5' CTGTC
`TCACCCAGTGCATATAGTAGTCGCTGAAGGTGAAGCC
`AGACACGGT 3', VHCDR2 5' CATTGTCACTCTGCCCTG
`
`GAACTTCGGGGCATATGGAACATCATCATTCTCAGGA
`TCAATCCA 3', VHCDR3 5' CCCTTGGCCCCAGTGGT
`
`CAAAGTCACTCCCCCATCTTGCACAATA 3', VKCDRl 5'
`CTGCTGGTACCATTCTAAATAGGTGTTTCCATCAG·
`
`TATGTACAAGGGTCTGACTAGATCTACAGGTGATG
`
`GTCA 3', VKCDR2 5' GCTTGGCACACCAGAAAATCGGT
`TGGAAACTCTGTAGATCAGCAG 3', VKCDR3 5'
`CCCTTGGCCGAACGTCCGAGGAAGATGTGAACCT·
`
`
`
`TGAAAGCAGT AGT AGGT 3'. For site-directed mutagenesis of
`
`the human VH framework the oligonucleotide used was 5'
`CTCCCCCATGAA TT ACAGAAATAGACCG 3'.
`Murine variable region DNA sequencing. Cyt� lasmic RNA
`
`
`was prepared as described by Favaloro et al.3 The cDNA
`
`
`synthesis reaction consisted of 10-20 µg RNA, 0.4 µM VHl FOR
`*-1 refers to administration of HuRSV l 9VHFNS/VK antibody I
`
`
`
`day prior to RSV infection, +4 refers to administration of
`
`or VKIFOR, 250 µMeach of dATP, dCTP, dGTP and dTTP, 50
`
`mM Tris-HCI, pH 7.5, 75 mM KC!, 10 mM DTT, 3 mM MgCl2
`
`antibody 4 days post infection.
`
`
`and 27 units RNase inhibitor (Pharmacia) in a total volume of 50
`
`*Virus pfu is expressed as the mean virus titre from 100 µI of
`µI. Samples were heated at 70°C for 10 min and slowly cooled to
`
`
`either I 0%, I%, or 0.1 % (w/v) lung homogenates adjusted to pfu
`42°C over a period of 30 min. Then, 100 units MML V reverse
`per gram of lung.
`
`i.n.
`
`i.p.
`
`i.n.
`
`Virus
`Route Recovered (pfu)
`0
`i.p.
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`1
`0
`1
`0
`2950
`2100
`4400
`4150
`3600
`
`Log pfu/g
`lung*
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`<1.7
`1.7
`<1.7
`1.7
`<1.7
`4.47
`4.32
`4.64
`4.61
`4.55
`
`BIOITECHNOLOGY VOL 9 MARCH 1991 269
`
`4 of 6
`
`BI Exhibit 1070
`
`
`
`•
`
`© 1991 Nature Publishing Group http://www.nature.com/naturebiotechnology
`
`transcriptase (BRL) was added and incubation at 42°C continued
`
`
`RSV and treated with 0.5% (v/v) NP40 detergent to yield a cell
`
`
`
`for 1 hour. The VH and VK cDNAs were then amplified using
`prepared using unin
`lysate. A control
`cell lysate was similarly
`
`fected CK cells. Microtiter plate wells were blocked with PBST
`
`
`
`the PCR as described by Orlandi et al.21 For PCR amplification of
`
`
`
`VH, DNA/primer mixtures consisted of 5 µl RNA/cDNA hybrid,
`
`
`
`
`and humanized or murine anti-RSV antibody applied. After 1
`
`0.5 µM VHlFOR and VHlBACK primers. For PCR amplifica
`
`hour at 37°C wells were washed and biotinylated goat anti-human
`
`
`
`tions of VK, DNA/primer mixtures consisted of 5 µI RNA/cDNA
`
`
`
`IgG or biotinylated goat anti-mouse IgG antibodies (Sera-Lab)
`
`hybrid, 0.5 µM VHIFOR and VKlBACK primers. To these
`
`I hour incubation at 37°C peroxidase
`added. After a further
`
`mixtures was added 200 µM each of dA TP, dCTP, dGTP and
`
`
`
`conjugated streptavidin (Sera-Lab) was added for 20 min at 37°C.
`dTTP, 10 mM Tris-HCI, pH 8.3, 50 mM KC!, 1.5 mM MgCl2,
`
`
`The wells were washed and peroxidase substrate buffer added.
`
`0.01% (w/v) gelatin, 0.1% (v/v) Tween 20, 0.01% (v/v) NP40 and
`
`
`Reactions were stopped after a few minutes by the addition of
`
`sulphuric acid.
`
`
`2 units Taq DNA polymerase (United States Biochemicals) in a
`
`final volume of 50 µI. Samples were subjected to 25 thermal cycles
`Twenty-four
`analysis of clinical
`Immunofluorescence
`isolates.
`
`
`
`
`during the winter of from children clinical isolates were obtained
`of 94°C, I min; 60°C, I min; 72°C, 2 min; ending with 5 min at
`
`
`
`1983/84 by the Bristol Public Health Laboratory, UK, and repre
`
`
`72°C. Amplified VH and VK DNA were purified on low melting
`
`
`
`sented both of the major subgroups of RSV. Thirteen isolates were
`point agarose
`
`gels, and by Elutip-d column chromatography
`
`
`
`
`serotyped as subgroup A and 11 isolates as subgroup B. HeLa or
`(Schleicher
`
`and Schuell) and cloned into Ml3. Clones were
`
`
`MAI04 cells infected with RSV isolates were grown in tissue
`
`
`sequenced by the dideoxy method using Sequenase (United
`
`
`
`
`culture. When the cells showed evidence of cytopathic effect, 20 ml
`States Biochemicals).
`
`0.02% (w/v) disodium EDT A in PBS and 3 ml 0.25% (w/v) trypsin
`of CDRs into human frameworks. Oligonu
`Transplantation
`
`in PBS were added and the cell suspension spotted into wells of
`
`
`cleotide site-directed mutagenesis was based on the method of
`
`
`PTFE-coated slides. After 3 hours at 37°C, the slides were dried
`
`Nakamaya and Eckstein20• To 5 µg of VH or VK single-stranded
`
`
`and fixed in 80% acetone. Cells were overlaid with anti-RSV
`
`DNA in Ml3 was added a two-fold molar excess of each of the
`
`
`
`antibody for I hour at room temperature. After extensive wash
`
`
`
`three VH or VK phosphorylated oligonucleotides encoding the
`
`
`ing, either ftuorescein-conjugated rabbit anti-mouse IgG (Nordic
`
`
`mouse CDR sequences. Primers were annealed to the template by
`
`
`
`Laboratories) or ftuorescein-conjugated goat anti-human IgG I
`heating to 70°C and slowly cooled to 37°C. After site-directed
`
`
`(Southern Biotechnology, Alabama) were added and incubation
`
`mutagenesis, the DNA was transformed into competent
`
`E. coli
`
`
`repeated. After further washing, cells were mounted in glycerol
`
`
`TGl cells. Single-stranded DNA was prepared from individual
`and examined under UV light.
`
`plaques and sequenced. If only single or double mutants were
`In vitro analysis of inhibition
`
`
`
`obtained, then these were subjected to further rounds of muta
`of virus-induced cell fusion.
`
`
`
`The reshaped antibody, HuRSV19VHFNS/VK was tested for
`genesis using the appropriate
`
`oligonucleotides until the triple
`
`biological activity
`
`in vitro in a fusion inhibition assay. A suspension
`CDR mutants were obtained.
`
`of MA I 04 cells was infected with RSV at 0.1 pfu per cell. After I
`
`The CDR replaced VH and VK genes were cloned in expres
`
`
`sion vectors21 to yield the plasmids termed pHuRSV19VH,
`
`hour at 37°C, 2 ml of cells at 105/ml were distributed to glass
`
`pHuRSV19VHFNSand pHuRSVl9VK. For pHuRSV19VH and
`
`
`coverslips in tubes. After a further 24 hours at 37°C, the culture
`
`
`
`medium was replaced by medium containing dilutions of re
`
`
`
`pHuRSV19VHFNS, the CDR replaced VH gene together with
`
`
`the lg heavy chain promoter, appropriate splice sites and signal
`
`
`
`shaped antibody. Twenty-four hours later, coverslip cultures
`
`
`peptide sequences was excised from M l3 by digestion with
`were fixed in methanol for 10 min and stained with May
`
`Hindlll and BamHI, and cloned into an expression vector
`Grunwald stain (BDH).
`In vivo analysis of efficacy. BALB/c mice (MRC Clinical
`
`
`containing the murine lg heavy chain enhancer, the SV40
`the gpt gene for selection
`
`
`
`
`Research Centre, London: category 4, standard) were challenged
`promoter,
`in mammalian cells and
`
`genes for replication and selection in E. coli. A human IgG I
`
`
`intranasally with 104 pfu of the A2 strain of human RSV37.
`
`
`Groups of mice were administered 25 µg of reshaped antibody
`
`
`
`constant region34 was then added as a BamHI fragment. The
`
`either one day prior to virus infection or 4 days following
`
`
`construction of the pHuRSVI 9VK plasmid was essentially the
`same except that the gpt gene was replaced by the hygromycin
`
`
`
`
`infection. Administration was either by the intranasal (i.n.) or
`
`
`
`
`
`intraperitoneal (i.p.) routes. Five days after RSV infection, mice
`
`
`region35 was resistance gene and a human kappa chain constant
`
`
`
`CK were sacrificed and lungs assa�ed for RSV pfu, on secondary
`added.
`� 0. In a second experiment,
`mice
`
`cells as described previous!
`Antibody expression. Ten µg pHuRSVl 9VH or
`
`
`were inoculated i.n. with 10 pfu of RSV, followed 4 days later
`pHuRSV19VHFNS and 20 µg pHuRSV19VK were linearized by
`
`
`
`with various concentrations of reshaped or murine antibody
`
`
`digestion with Pvul. The DNAs were mixed together, ethanol
`for the level
`day 5 of infection
`i. p. and examined on
`
`
`
`precipitated and dissolved in 25 µI water. Approximately 107
`administered
`
`
`YB2/0 cells were grown to semiconftuency, harvested by centrif
`of RSV in the fungs.
`
`
`ugation and resuspended in 0.5 ml DMEM together with the
`Acknowledgments
`
`
`
`digested DNA in an electroporation cuvette. After 5 min on ice,
`It is a pleasure to acknowledge the advice of the Scotgen
`
`
`the cells were given a single pulse of 170V at 960 µF (Gene
`
`
`
`Scientific Advisory Panel particularly G. Winter, and for gifts of
`Pulser,
`Bio-Rad)
`and left in ice for a further 20 min. The cells
`
`
`
`vectors from his laboratory in the MRC Laboratory of Molecular
`were then put into 20 ml DMEM plus 10% fetal calf serum and
`
`Biology, Cambridge, UK. We would also like to thank E. J. Stott
`
`allowed to recover for 48 hours. At this time the cells were
`
`
`
`for advice on selection of RSV monoclonal antibodies and 0.
`
`
`
`distributed into a 24-well plate and selective medium applied
`
`
`
`Caul, Bristol Public Health Laboratory, for clinical isolates.
`
`(DMEM, 10% fetal calf serum, 0.8 µg/ml mycophenolic acid, 250
`
`
`Received 12 November 1990; accepted 2 January 1991.
`
`µg/ml xanthine). After 3-4 days, the medium and dead cells were
`
`
`removed and replaced with fresh selective medium. Transfected
`References
`
`clones were visible with the naked eye 8-10 days later.
`1. Brandt, C. D., Kim, H. W., Orrobio,J. O.,Jeffries, B. C., Wood, S. C.,
`
`
`
`
`
`The presence of human antibody in the medium of wells
`
`R. H. I 973. Epidemiology of respiratory
`
`Chanock, R. M., and Parrott,
`
`
`containing transfected clones was measured by ELISA. Microtiter
`
`
`
`
`
`syncytial virus infection in Washington DC III. Composite analysis of
`
`plate wells were coated with goat anti-human lgG (gamma chain
`
`
`eleven consecutive yearly epidemics. Am. J. Epidemiol.
`98:355-364.
`
`
`
`specific) antibodies (Sera-Lab). After washing with PBST (phos
`
`
`2. Sims, D. G., Downham, M.A. P. S., McQuillin, J., and Gardner, P. S.
`
`
`
`
`
`I 976. Respiratory syncytial virus infection in north-east England. Br.
`
`phate buffered saline containing 0.02% Tween 20, pH 7.5), 100
`Med. J. 2: 1095-1098.
`
`µI of culture medium from the wells containing transfectants was
`
`3. Bruhn, F. W. and Yeager, A.G. 1977. Respiratory syncytial virus in
`
`
`
`
`
`added to each microtiter well for I hour at 37°C. The wells were
`
`early infancy. Am. J. Dis. Child. 131:145-148.
`
`
`then emptied, washed with PBST and either peroxidase-conju
`
`4. Wright, P. F., Belshe, R. B., Kim, H. W., Van Voris, L. P., and
`
`
`goat antigated goat anti-human IgG or peroxidase-conjugated
`
`
`
`Chanock, R. M. 1982. Administration of a highly attenuated live
`
`
`
`human kappa constant region antibodies (Sera-Lab) were added
`respiratory syncytial
`
`to adults and children. Infect.
`virus vaccine
`
`and incubated at 37°C for I hour. The wells were then emptied,
`Immun. 37:397-400.
`
`
`washed with PBST and substrate buffer containing o-phenylene
`5. Conrad, D. A., Christenson,]. C., Waner,]. L., and Marks, M. I. 1987.
`
`
`
`
`
`
`
`
`Aerosolized ribavirin treatment of respiratory syncytial virus infection
`
`diamine added. Reactions were stopped after a few minutes by
`
`
`
`
`
`in infants hospitalised during an epidemic. Pediatr. Infect. Dis. J.
`
`
`
`the addition of sulphuric acid and absorbance at 492 nm was
`6: 152-158.
`measured.
`6. Ogilvie, M. M., Vathenen, A. S., Radford, M., Codd,]., and Key, S.
`
`
`
`
`
`
`Antigen binding assays. Humanized antibody secreted from
`
`
`
`
`I 981. Maternal antibody and respiratory syncytial virus infection in
`transfected cell lines and the murine antibody
`
`secreted by the
`
`
`infancy . .J. Med. Virol. 7:263-271.
`
`
`
`
`original hybridoma were purified by protein A affinity chroma
`7. Hemming, V. G., Rodriguez, W., Kim, H. W., Brandt, C. D., Parrott,
`
`
`
`tography and tested for binding to RSV in an ELISA. Antigen
`
`R.H., Burch, B., Prince, G. A., Baron, P.A., Fink, R.J., and Reaman,
`
`
`
`G. 1987. Intravenous immunoglobulin treatment of respiratory syn-
`
`
`consisted of calf kidney (CK) cells infected with the A2 strain of
`
`270
`
`BIO!fECHNOLOGY VOL. 9 MARCH 1991
`
`5 of 6
`
`BI Exhibit 1070
`
`
`
`•
`
`© 1991 Nature Publishing Group http://www.nature.com/naturebiotechnology
`
`cytial virus infections in infants and young children. Anti. Agents and
`
`
`
`
`
`Chemotherapy 31: 1882-1886.
`8. Hemming, V. G., Prince, G. A., Horswood, R. L., London, W. T.,
`
`
`
`
`Murphy, B. R., Walsh, E. E., Fischer, G. W., Weisman, L. E., Baron,
`
`
`P.A., and Chanock, R. M. 1985. Studies of passive
`immunothera
`py
`
`for infections of respiratory syncytial virus in the respiratory tract of a
`
`
`
`
`
`primate model. J. Infect. Dis. 152: 1083-1087.
`9. Prince, G. A., Hemming, V. G., Horswood, R. L., and Chanock, R. M.
`
`
`
`
`
`
`1985. Immunoprophylaxis and immunotherapy of respiratory syncy
`
`tial virus infection in the cotton rat. Virus Res. 3: 193-206.
`
`10. Taylor, G., Stott, E.J., Bew, M., Femie, B. F., Cote, P.J., Collins,
`
`
`
`A. P., Hughes, M., and Jebbett,]. 1983. Monoclonal antibodies protect
`
`
`
`
`against respiratory syncytial virus infection in mice. Immunology
`52:137-142.
`11. Stott, E. J. and Taylor, G. 1989. Immune Responses, Virus Infections
`
`
`
`
`
`and Disease, p. 85-104. N. J. Dimmock and P. D. Minor (Eds.). I.R.L.
`
`Press, London.
`12. Benjamin, R. J., Cobbold, S. P., Clark, M. R., and Waldmann, H.
`
`
`
`
`
`
`
`1986. Tolerance of rat monoclonal anti