3000 Ci/mM) (UTP) was then added and the
`
`was incubated at 3lrC for 30 nuclear suspension
`minutes, after which time IS j.1.1 ofDNase I (S .,.,;
`ml) in 10 mM CaC12 (S l't/ml) was added. After S
`
`at 30°C, the reaction was made Ix SET minutes
`(I percent sodium dod�yl sulfate (SOS), S mM
`
`EDTA, 10 mM tris-HCI, pH 1.<4), and proteinase
`
`K was added to a concentration of 200 l'i/ml.
`
`
`the After incubation at 37"C for 4S minutes,
`
`was extracted with an equal volume of a solution
`
`
`of phenol and cblorofonn, and mixture the inter­
`
`phase was aaain extracted with 100 µ.I of Ix
`
`SET. Ammonium acetato (IOM) was added to
`
`the combined aqueous phases (orieinal plus
`
`reextraction) to a fin al concentration
`of 2.3M, an
`
`
`equal volume of isopropyl alcohol was added,
`and nucleic acid was precipitated
`(-70'C for IS
`
`
`
`in a was centrifu&ed minutes). The precipitate
`microccntrifu&e for 10 minutes, and the peUet
`was resuspended in 100 j.1.1 of TE (10 mM tris­
`HCl, I mM EDTA) and centrifuged lhrou&h a G·
`
`SO (medium) spin column. The eluate was made
`0.2M in NaOH and after 10 minutes on iu,
`HEPES was added to a concentration or 0.24M.
`
`Two and one-half volumes of ethanol were then
`added, and the solution containing the precipi-
`
`
`tate held overoJ&ht at -20'C. After untrifuaa ­
`SSC) for 30 minutes. Either protocol for proc­
`
`tion in a microcentrifuae for S minutes, the pellet
`
`essina of the filters after hybridization yielded
`was resuspended in hybridization buft'er, which
`the same specificity in sipal. Filten were then
`tainina Li&hteniiia
`
`consisted of [10 mM TES, pH 7.4, 0.2 percent
`ex�sed to Kodak XAR film in cassettes con·
`SDS, 10 mM EDTA, 0.3M NaCl, IX Den­
`-Plus screens at -70'C for
`bardt's, and EscMrichJa coll RNA (2SO l'&fml)].
`various times.
`filters containing plasmid.ON A's
`Nitrocellulose
`
`4S. C. Yanisch-Perron, J. Vierra, J. Messina,
`Gtnt
`
`were prepared with a Schleicher Slot
`cl Schuell
`33, 103 (198S).
`
`Blot Apparatus under conditions sugested by S
`46. S. L. McKniaht, E. R. Gavis, R. Kinasbury, R.
`
`and S, except that wells were washed with !Ox
`Axel, Ct/J 25, 38S (1981).
`
`SSC (saline sodium citrate). These filters were
`
`
`47. M. Groudine and C. Casimir,
`Nucltlc Acids
`first hybridiied in the hybridization solution
`
`Rts. 12, 1427 (1984).
`described above for a minimum of 2 hours at
`48. We thank many of our coUeagues for discussion
`
`6S°C. After this preliminary hybridization,
`
`and su11,1estions during the course of this work;
`the
`
`filters were hybridized to the runotf products in
`Hal Wemtraub, Paul Neiman, and Craia Thom{>·
`
`hybridization solution
`for 36 hours. A typical
`
`son for comments on the manuscript; Cnu&
`
`reaction contained 2 ml of hybridization solution
`
`
`Thompson for assistance in obtainin& lympho­
`with I x 107 cpm/ml. After hybridization, filters
`cyte preparations;
`Bill Schubach for plasmid
`were washed for I hour in 2x SSC at 6S°C. The
`
`
`with pBK2S; and Kay Shiozaki for assistance
`filters were then incubated at 37"C in 2x SSC
`
`the manuscript. Supported by NIH arants CA
`with RNase A (10 mafml) for 30 minutes and
`18282 {M.L.) and CA 28151 {M.L. and M.G.),
`
`were subsequently washed in 2x SSC at 37"C
`and NSF arant PCM 82-04696 (M.G.), and a
`after hybridization the
`for I hour. Alternatively,
`scholanhi_p from the Leukemia Society or
`filters were washed tW!ce for IS minutes in 0.1
`America (M.G.)
`percent SDS, 2X SSC at room temperature, and
`then washed at 60'C (0.1 percent SOS, 0.1 x
`30 July 198S; accepted IS October 198S
`
`RHEARCH ARTICLE
`
`Tyrosine Kinase Recepto� with Extensive
`Homology to EGF Receptor Shares
`Chromosomal Location with neu Oncogene
`
`Lisa Coussens, Teresa L. Yang-Feng, Yu-Cheng Liao
`Ellson Chen, Alane Gray, John McGrath, Peter H. Seeburg
`Towia A. Libermann, Joseph SchJessinger,
`Uta Francke
`Arthur Levinson, Axel Ullrich
`
`In contrast to v-erbB, which encodes a
`68,000-dalton truncated EGF receptor,
`the. neu oncogene product is a 185,000-
`dalton cell surface antigen that can be
`detected by cross-reaction with polyclo­
`nal antibodies against EGF receptor (1 J);
`neu may itself be a structurally altered
`cell surface receptor with homology to
`the EGF receptor and binding specificity
`for an unidentified ligand.
`Using v-erbB as a screening probe, we
`isolated genomic and cDNA clones cod­
`ing for an EGF receptor-related, but
`distinct, 138,000-dalton polypeptide hav­
`ing all the structural features of a cell
`surface receptor molecule. On the basis
`of its structural homology' this putative
`receptor is a new member of the tyro­
`sine-specific protein kinase family. It is
`encoded by a 4.8-kb messenger RNA
`(mRNA) that is widely expressed in nor­
`mal and malignant tissues. We have lo­
`calized the gene for this protein to q21 of
`chromosome 17, which is distihct fi:om
`the EGF receptor locus, but coincident
`with the neu oncogene mapping position
`(12). We therefore consider the possibili­
`ty that we have isolated and character­
`ized the normal human counterpart of
`the rat neu oncogene.
`Tyrosine kinase-type receptor gene and
`complementary DNA. As part of our at­
`tempts to isolate and characterize the
`chromosomal gene coding for the human
`cellular homologue of the viral erbB gp68
`p0lypcptide, AEV-ES4 erbB sequences
`(2.5-kb Pvu II fragment of pAEV) (J 3)
`were used as a 32P-labeled hybridization
`probe for the screening of a human geno­
`mic DNA library at reduced stringency
`
`!in (6), POOF (7), and insulin-like growth
`factor 1 (IGF-1) (8); hence more connec­
`tions may be found between tyrosine
`kinase growth factor receptors and tyro­
`sine kinase oncogene product$.
`Comparison of the complete primary
`structure of the human EGF receptor (9)
`with the sequence of the avian erythro­
`blastosis virus (AEV) transforming gene,
`v-erbB (10), revealed close sequence
`similarity; in addition, there were amino
`and carboxyl terminal deletions that may
`reflect key structural changes in the gen­
`eration of an oncogene from the gene for
`a normal growth factor receptor (3, 9).
`Another oncogene, termed neu, is also
`related to v-erbB and was originally
`identified by its activation in ethylnitro­
`sourea-induced rat neuroblastomas (1 J).
`
`Growth factors and their receptors are
`involved in the regulation of cell prolif­
`eration, and several recent findings sug­
`gest that they also play a key role in
`oncogenesis (14). Of approximately 20
`identified oncogenes, the three that have
`been correlated with known cellular pro­
`teins are each related to either a growth
`factor or a growth factor receptor. the B
`chain of platelet-derived growth factor
`(POOF) is encoded by the proto-onco­
`gene c-sis (2), the erb-B oncogene prod­
`uct gp68 is a truncated form of the epi·
`dermal growth factor (EGF) receptor (3),
`and the proto-oncogene c-fms may be
`related or identical to the receptor for
`macrophage colony-stimulating factor
`(CSF-tR) (4).
`The receptor-related oncogenes are
`members of a gene family in that each
`has tyrosine-specific protein kinase ac­
`tivity, and is associated with the plasma
`membrane (5). Such features are also
`shared by several other polypeptide hor­
`mone receptors, including those for insu-
`1132
`
`
`Yu-Chena Liao, Ellson Chen, Alane Gray, Peter H. Seeburg, Arthur Levinson, and Axel
`Usa Cousseos,
`Ullrich are in the Department of Molecular
`
`
`Inc., 460 Point San Bruno Boulevard, BiolOJY, Gencntech, South
`
`San Francisco, California 94080; John McGrath 1s currently
`with the Department of BiolO&Y, Massachusetts
`are in
`
`Institute of Techn9logy,
`
`Cambridee, Massachusetts 02142; Towia Libermann and Joseph Scblessin&er
`
`
`the Department of Cliemical
`
`
`
`and of Science, Rehovot 76100, Israel; Immunology at the Weizmann Institute
`
`
`
`
`Teresa L. Yang-Pena and Uta Francke are in the Department of Hu.man Genetics at Yale University School
`of Medicine,
`
`333 Cedar Street, New Haven, Connecticut
`06SIO.
`SCIENCE, VOL. 230
`
`1 of 8
`
`BI Exhibit 1043
`
`

`

`(14). Clone AC-erbB/1 was isolated; it
`contained a hybridizing 1.8-kb Barn HI
`fragment, which was subjected to DNA
`sequence analysis. The 1838-bp se­
`quence contains three complete and one
`partial erbB-homologous exons separat­
`ed by short intervening sequences (Fig.
`I). Comparison of this human gene se­
`quence with our complete cDNA-de­
`rived human EGF receptor protein se­
`quence (9) revealed 32 differences (18.7
`percent) within the 171 amino acid
`stretch of combined exons, suggesting
`that this gene fragment was not derived
`from the human EGF receptor gene.
`Since this gene may code for an un­
`known tyrosine kinase-type receptor
`that is closely related to the human EGF
`receptor, we named it HER2.
`Northern blot analysis (15) with the
`32P-labeled 1.8-kb HER2 fragment as a
`hybridization probe revealed a 4.8-kb
`mRNA in human term placenta poly(A)+
`RNA, distinct from the 5.8- and 10.5-kb
`EGF receptor mRNA's also present at
`high levels in this tissue (Fig. 2a, lane I).
`Thus, we had isolated a portion of an
`EGF receptor-erbB-related but distinct
`gene. To obtain its complete primary
`structure, two single-stranded synthetic
`oligonucleotide probes (16) were pre­
`pared from HER2 exon sequence regions
`that differed sufficiently (less than 60
`percent nucleotide sequence homology)
`from EGF receptor DNA sequences
`(Fig.
`l, l and 2) and used to screen
`a term placenta complementary DNA
`(cDNA) library of 2 x 106 independent
`recombinant clones in AgtlO (17). Fifty­
`two clones were isolated; they hybrid­
`ized strongly with both synthetic probes
`and weakly with an EGF receptor cDNA
`fragment (HER64-3) (9) containing the
`homologous region within the tyrosine
`kinase domain. One of these, AHER2-
`436, had the longest cDNA insert (4.5
`kb), consisting of three Eco RI fragments
`( l.4, 1.5, and 1.6 kb).
`The complete cDNA sequence of this
`clone is shown in Fig. 3. The longest
`open reading frame starting with a me­
`thionine codon codes for a 1255 amino
`acid polypeptide (137,828 daltons) and
`contains the 171 residues encoded by the
`four exons in the 1.8-kp HER2 gene Bam
`HI fragment (Fig. 1). This 3765-bp cod­
`ing sequence is flanked by 150 bp of 5'
`untranslated sequence and a TGA stop
`codon, followed by a 627-nucleotide 3'
`untranslated sequence. No stop codon is
`found in the 5' untranslated region. In
`support of our assignment, however, the
`initiation codon at position 151 is flanked
`by sequences that follow perfectly Ko­
`zak 's rule (18) for translation initiation.
`The 3' untranslated sequence contains a
`
`6 DECEMBER 1985
`
`potential poly(A) addition signal se­
`quence (AATATA) 12 nucleotides up­
`stream from a stretch of 15 adenylate
`residues. We are not certain if this (A)1s
`stretch is part of a poly(A) tail or repre­
`sents an internal poly(A) stretch of a
`longer 3' untranslated sequence.
`
`those for EGF and insulin (9, 19). Such
`features are apparent in the hydropathy
`profile (20) comparison (Fig. 4a). On the
`basis of this comparison, and on amino
`acid sequence alignment with the EGF
`receptor (Fig. 4b, region 1), we predict a
`21 amino acid signal sequence (Fig. 4b,
`
`Abstract. A novel potential
`
`cell surface receptor of the tyrosine kinase gene family
`
`
`
`
`
`has been identified and characterized by molecular cloning. Its primary sequence is
`
`
`
`very similar to that of the human epidermal growth factor receptor and the v-erbB
`oncogene product; the chromosomal location of the gene for this protein is
`
`coincident with the neu oncogene, which suggests that the two genes may be
`identical.
`
`Comparison of EGF receptor and
`HER2 sequence. As already indicated by
`the v-erbB sequence homology used to
`isolate HER2, the putative HER2 pro­
`tein is very similar in its overall domain
`organization and sequence to the EGF
`receptor. Nevertheless, there are differ­
`ences that are likely to define a specific
`biological role for the HER2 polypep­
`tide.
`The predicted HER2 polypeptide con­
`tains each of the domain features found
`in hormone receptor precursors, such as
`
`1), an amino terminal serine residue, and
`a 632 amino acid putative extracellular
`ligand-binding domain; a highly hydro­
`phobic, 22-amino acid transmembrane
`anchor domain separates the extracellu­
`lar domain from a 580-residue-long car­
`boxyl-terminal cytoplasmic domain,
`which possesses the highest homology to
`v-erbB and other members of the tyro­
`sine kinase family.
`The 632-amino acid, putative HER2
`ligand binding domain is about 40 per­
`cent homologous with the 621-residue
`
`Glu Ala
`740 Glu �ys
`769
`1 �:�����J�����:���:��!:M�:���=�:����������=:����GTMGCCCCTCCACCCTCTCCTGCTAGG
`
`
`
`TTTTTlTGGAGACGGAGCTTGCTCTGTCAC 121 AGGACAGGMGGACCCCATGGCTGCAGGTCTGGGCTCTGGTCTCTCTTCATlGGGGmGGGGAGATATGACTCCCGCAAACCTAGACTA
`
`241 CCAGGCTGGAGTGCAGTGGCGTTATCTCGGCT
`CACTGCAACCTCCACCTCCTGGACTCAAGCGATTTTCATGCCTCAGGCTCCTGAGTAGCTGGGATTACAAGCGCCCGCTMTTTTTTT
`CTCAGCCTCCCAGGTTMAGCGATTmCTCCCTCAGTCTCCTGAGTAGCT
`CCAGGCTAGAGTGMATGGTGCGGTCTCAG
`GGGATTA
`TCTCGCTCTGTCAC
`361 TTTTTTmGAGACAGAG
`<SI CAGGCGCGAGCCACCACGCCCGGCTMTmTGIAmTTAGTAGAGATGGGATTTCACCATGTTGGCCAGGTTGGTGT
`
`CAAACTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCAA
`CACAGGC TGTGGGCCATG
`
`601 AGTGCTGGGATTACAGGTGTGAGCCACGTGCCCGGCCTMTCTTTGTATTTlTAGTAGAGACAGGGTTTCACCATGTTGTCCAGGCTGGTAtmGAGCCTT
`Ser AspAsn H1
`110
`
`GluA l 1TyrVa llletA 1 oGl)'i1 lG lyS.rProTy
`
`
`
`CAGGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATA 721 GCIGTGGTTTGTGATGGTTGGGAGGCTGTGTGGTGTTTGGGGGTGTGTGGTCTCCCATACCCTCTCAGCGTACCCTTGTCCC
`
`Tyr H1Slf$ASpAsn Ile Ty
`s Cys
`llt
`Phe
`
`
`
`
`
`
`
`
`rV 1 l Sf.rArgleultuGlyI l�ysltuThtSerThrVa lG lnleuV.1 ThrG lnltuMet.ProT yrG l yCysltuleuA.spHt sYa lArgG luAsnArgG l yArgl.euG lnAs 1 ySerG
`
`
`
`GGGAMACCGCGGACGCCTGGGCTCCCAGGA 841 TGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACACAGCITATGCCCTATGGCTGCCTCTTAGACCATGTCC
`r
`Val
`831
`
`pltule-uAsnTrpCysMetGlnJ ltAlatys
`961 CCTGCTGMCIGGTGTATGCAGATTGCCAAGGTATGCACCTGGGCTCTTTGCAGGTCTCTCCGGAGCMACCCCIATGTCCACAAGGGGCTAGGATGGGGACTCTTGCTGGGCATGT6GC
`
`
`
`
`��t��T yrteoG tu.Asp�� ArgleuV• 1HhAf9AspleuA1aAlaAr9AsnV1 I LeuYa l Lys��
`
`
`
`1081 CAGGCCCAGGCCCTCCCAGAAGGTCTACATGGGTGCTTCCCATTCCAGGGGATGAGCTACCTGGAGGATGTGCGGC
`
`
`TCGTACACAGGGAmGGCCGCTCGGAACGTGCTGGTCMGAGT
`1-CCGT::Cf-G-G=t-C=t
`1-!(i)
`Gin
`
`lys GlyAlaGlu lys Glu 883
`
`
`
`l)G lylys ProAs.nH h V.1LYt1 I e ThrAspPhe<i l)'leuAl1ArgleuLeuAspJ ltAspG 1ulhrG1uTyrHisA1 a.AspG
`CATTGAC�CAGAGTACCATGCAGATGGGGGCAAGGTTAGGTGMGGACCMGGAG CAGAGGAGGCTGGGT
`
`1201 CCCAACCATGTCAAAATTACAGACTTCGGGCTGGC�
`
`H; __ TGC!j-=A.,J@
`884 V.1ProJ lel.yslr"pHetA
`hleuGluSerl le-Lev
`
`
`
`CCATCAAGTGGATGGCGCTGGAGTCCATTCTC 1321 GGAGTGGTGTCTAGCCCATGGGAGAACTC TGAGTGGCCACTCCCACAACACACAGTTGGAGGACTTCCTCTTCTGCCCTCCCCAGTGC
`H1s lltlyr
`910
`
`1441 ������c���srr�m�����rr�m�TGATGGGGGGTGTTGGGAGGGGTGGGTGAGGAGCCATGGCTGGAGGGAGGATGAGAGCTGGGATGGGGAGAATTA
`
`
`
`TTGCAGGG TCTGTGCACTTCCCAGGATTA£GGAAA6ACCGGGTAGGGTCTGTCTCCTGGCATCACATCT 1561 CGGGGCCACCTCAGCATGTGAAGGGAGGGMGGGGCTGCCTGTGCCCCACC
`AGGTGTGACTGTGTGGGA 1681 CCCCCIGCTACCTGCCATGATGCTAGACTCCTGAGCAGAACCTCTGGCTCAGTACACTMAGCTCCCTCTGGCCCTCCCACTCCTGACCCTGTCTCTGCCTT
`
`
`
`1801 GCTGATGACTTTTGGGGCCAMCCTTACGATGGGATCC
`
`Fig. I. Partial sequence of the HER2 gene. A partial Hae III-Alu I genomic library (14) of human
`fetal DNA in � Charon 4A was screened using a radiolabeled 2.5-kb Pvu II fragment of pAEV
`(13) containing coding sequences for the tyrosine kinase domain. Hybridization was as
`described elsewhere (3/), except that 30 percent formamide was used at 42°C. Three
`independent clones were isolated which shared a 1.8-kb hybridizing Barn HI fragment. This
`fragment and subsets thereof were isolated, subcloned into M13mpl0 and M13mpll, and
`sequenced (32). The intron-exon organization was determined by comparison with v-erbB
`
`sequences (JO). Amino acid numbering is based on the complete cDNA sequence shown in Fig.
`3. Nucleotide sequence differences with the human EGF receptor sequence are shown in the
`regions that were used for the design of synthetic oligonucJeotide probes I (30 nucleotides) and
`2 (21 nucleotides). Amino acid sequence differences with the EGF receptor are shown above the
`HER2 sequence.
`1133
`
`2 of 8
`
`BI Exhibit 1043
`
`

`

`extracellular EGF binding domain of the
`EGF receptor. This homology includes
`two cysteine-rich subdomains of 26 and
`21 regularly organized cysteine residues
`(Figs. 4a and 2c, subdomains 2 and 3), all
`of which are conserved in the EGF re­
`ceptor. The cysteine residue spacing in
`this region is also homologous with the
`single cysteine-rich domain in the insulin
`receptor a subunit (19). In contrast,
`HER2 contains only eight potential N­
`linked glycosylation target sites (Asn-X­
`Thr or Ser) as compared to 12 in the
`corresponding region of the EGF recep­
`tor. Only five of these are conserved
`with respect to their relative position in
`cacti polypeptide.
`The hydrophobic, putative membrane
`anchor sequence located between resi­
`dues 653 and 676 (Fig. 4b, region 4) is
`flanked at its carboxyl terminus by a
`stretch of amino acids of predominantly
`basic character (KRRQQKIRKYTMRR)
`(21), as is found in the EGF receptor
`sequence (9) (Fig. 4b, region 5). This
`region of the EGF receptor contains
`Thr654, which plays a key role in protein
`kinase C-mediated receptor modulation
`(22). A homologous threonine residue is
`embedded in a basic environment in the
`HER2 sequence at position 685 (Fig. 4, a
`and b).
`The region of most extensive homolo­
`gy (78.4 percent) between EGF receptor
`and HER2 (beginning at residue 687)
`extends over 343 amino acids and in­
`cludes sequences specifying the adeno­
`sine triphosphate (ATP) binding domain
`(23) and tyrosine kinase activity (Fig. 4b,
`region 6) (5). This region is also the most
`conserved between v-erbB and EGF re­
`ceptor (95 percent) (9). The collinear
`homology between the EGF receptor­
`erbB and HER2 ceases at position 1032,
`but introduction of gaps into the EGF
`receptor or HER2 sequences reveals
`continued, although decreased, related­
`ness (Fig. 4b, region 7). This sequence
`alignment suggests that the two genes
`evolved by duplication of an ancestral
`receptor gene, and that subsequent nu­
`cleotide sequence divergence in this car­
`boxyl terminal domain led to diverged
`biological roles for the encoded polypep­
`tides.
`The carboxyl terminal domain of
`HER2 is characterized by an unusually
`high proline content (18 percent) and
`predominant hydrophilicity (Fig. 4a).
`These general features are also found in
`the EGF receptor carboxyl terminal do­
`main with a 10 percent proline content.
`The sequences in this region that are
`found to be conserved are almost exclu­
`sively centered around five tyrosine resi­
`dues, which include the major (Tyr1173)
`1134
`
`and two minor (Tyr1148, Tyr1068) in vitro
`autophosphorylation sites in the human
`EGF receptor (24) (Fig. 4, a and b).
`Three of these tyrosine residues of
`HER2 (positions 1139, 1196, 1248) are
`flanked by homologous
`sequences
`PQPEYV, ENPEYL, and ENPEYL .
`(21), respectively (Fig. 4b, region 7).
`HER2 chromosomal location. In situ
`hybridization of two 3H-labeled HER2
`probes (legend, Fig. 5a) to human chro­
`mosomes resulted in specific labeling at
`bands ql2--+q22 of chromosome 17 (Fig.
`5a). Metaphase cells (100) were analyzed
`for each probe; 40 percent of cells scored
`for HER2 probe l (HER2-1) had silver
`grains over 17q12--+q22 (Fig. 5b). Of the
`209 grains observed, 42 (20 percent)
`were found at this specific region, with
`no other site labeled above background.
`For HER2 probe 2, 36 percent of cells
`had silver grains over the ql2--+q22
`bands of chromosome 17. Of all silver
`grains, 17 percent ( 42/246) were localized
`to this chromosomal region. A second­
`ary site of hybridization with 3 .3 percent
`(8/246) of silver grains was detected at
`bands p13--+ql 1.2 of chromosome 7.
`To test whether this secondary site
`represented cross-hybridization with the
`EGF receptor gene, in situ hybridization
`was carried out with 3H-labeled EGF
`
`a
`
`1 2 3 4 5 6 b
`
`l234567
`
`Fig. 2. Northern blot hybridization analysis of
`normal and malignant human tissues. (a) Fetal
`
`tissues; (lane 1) term placenta, (lane 2) 20-
`week placenta, (lane 3) 20-week liver, (lane 4)
`20-week kidney, (lane 5) 20-week lung, (lane
`6) 20-week brain. (b) Embryonic tumors; (lane
`I) hepatoblastoma, (lanes 2 and 3) Ewing
`sarcoma, (lane 4) rhabdomyosarcoma, (lanes
`S and 6) neuroblastoma, (lane 7) Wilms • tu­
`mor. Total poly(Ar RNA was isolated as
`described (JJ); 4 µg per lane was analyzed on
`a 1 percent formaldehyde-agarose gel. 32P­
`Labeled HER2-1 and HER-2 (legend to Fig. 5)
`were used as hybridization probes under high
`stringency conditions (50 percent formamide,
`
`Sx Denhardt's solution, Sx standard saline
`citrate (SSC), sonicated salmon sperm DNA
`(SO µg/ml), SO µ.M sodium phosphate buffer
`(pH 6.8), I mM sodium pyrophosphate, and
`10 µM ATP at 42°C for 16 hours; filters were
`washed three times for 15 minutes at 45°C
`with 0.2x SSC]. The filters were exposed at
`-60°C with a Cronex Lightning Plus intensi­
`
`fying screen (Dupont) for 7 days. Rat ribo­
`somal RNA's were used as size standards
`(28S, 4.8 kb; 18S, 1.8 kb). RNA sizes are
`given in kilobases.
`
`receptor subclone 64-3. Of 100 cells ex­
`amined, 30 had silver grains at bands
`pl3--+ql 1.2 of chromosome 7 and 3 per­
`cent (5/166) of total grains were found
`over q12--+q22 of chromosome 17. With
`the other variant probe (HER2-1) no
`grain accumulation was observed at the
`EGF receptor site on chromosome 7.
`Southern blot analysis (25) of DNA
`extracted from nine somatic cell hybrids
`from human and rodent cells confirmed
`the localization of HER2 sequences to
`chromosome 17.
`32P-labeled HER2-1
`and HER2-2 probes were hybridi.zed to
`the same set of Eco RI-digested DNA
`samples. With HER2-1, a 13-kb hybrid­
`izing band was detected in human DNA
`(Fig. 5c, lane 1) and in DNA samples
`from hybrids containing human chromo­
`some 17 (Fig. 5c, lanes 6, 8, 10, and 12).
`Likewise, hybridization of HER2-2 to a
`6.6-kb DNA fragment was observed in
`human control DNA (Fig. 5c, lane 1) and
`in hybrids containing human chromo­
`some 17 (Fig. 5c, lanes 6, 8, 10, and 12).
`Chromosome 17 was the only chromo­
`some with perfect concordant segrega­
`tion; all other chromosomes were ex­
`cluded by two or more discordant hy­
`brids.
`Regional localization to chromosome
`17 was also confirmed by Southern blot
`analysis. In a mouse-human hybrid con­
`taining a rearranged human chromo­
`some 17 with region l7q21--+qter, the
`human HER2 restriction fragments were
`detected (Fig. 5c, lane 4). The HER2
`gene was therefore localized to region
`17q21--+qter, in agreement with the local­
`ization made by in situ hybridization.
`Even though a low level of hybridiza­
`tion with probe HER2-2 was seen at the
`site of the EGF receptor gene on chro­
`mosome 7, we were able to show that
`this finding represented cross-hybrid­
`ization. In a control experiment an
`EGF receptor probe cross-hybridized to
`the same extent with the HER2 site on
`17q.
`Taken together, the results of the in
`situ and Southern blot hybridizations
`permit the site of the HER2 sequences to
`be further narrowed down to bands
`17q21-q22, with the major peak of silver
`grains at band 17q21.
`HER2 expression in normal and malig·
`nant tissues. To obtain further clues re­
`garding the function of this receptor both
`in normal cells and in neoplasms, North­
`ern hybridization analyses (15) were car­
`ried out with several normal human tis­
`sues and randomly collected tumors. A
`hybridizing 4.8-kb mRNA was detected
`in all human fetal tissues analyzed, in­
`cluding term placenta, 20-week placenta,
`liver, kidney, lung, and brain obtained
`SCIENCE. VOL. 230
`
`3 of 8
`
`BI Exhibit 1043
`
`

`

`30
`
`40
`
`6ACAGCA6AG6A
`
`�
`
`C66GCT6GCT
`
`C66CT GCT66ACA
`
`TTGAC6A6ACAGA6
`
`TACCA TGCAGATQGIXSCMEGT6CCCATCMGTG6AT66C6CT""6
`
`liCTCEEMC
`
`MTTCTCSAGCTC6TCGACC6GTCGACGAGCTCWGGTC6AC&MiCTC&A66GCGC6C GCCC6GCCCCCACCCCTCGCAGCACCCCGCGCCCCGCGCCCTCCCAGCC666TCCMICC6GMlCCAT&GG6C�C6CACTCMCACC
`50
`20
`10
`1
`
`sleuA.spMetl�t sltuTyr aSer Thr&l nV a 1. ThrGlyThrAs!Jlle tlysleuArgl.euProA 1 &Serl'ro61 uThrH1
`
`
`Met6 luleuA lM 1 aleu Trp61yLeuleuleuA1aleuleuProPro61yA1M1
`151 AT66AliCTli&C6GCCTTS ""'6CTCCTCCTC6CCCTCTTGCCCCCC$&AGCC6C6AGCACCCMGT61iA CCG6CACAGACAT&M&CT6C66CTCCCT6CCASTC™CACCT6&ACAT6CTca;ccACCTCTM:
`�
`�
`�
`
`
`a euSer""-leu61nAspll�ln61uVa16ln6lyTyrValltu61n61� 1nYa1Ya161n611Mnleu61uleuThrTyrll\IProThr
`
`lleAlaHlsAsll61nYalA1'96lnY1lProltuArt
`
`��
`TQCQI
`
`T66T6CAG66MACCTGGMCTCACCTACCTGCCCACCAATGCCAGCCT6TCCTTCCTGCA66ATATCCA&&A66T6CA666CTAC6TGCTCATCGCTCACAACCMGT&AS6CA66TCCCACT
`301 �
`110
`130
`150
`120
`140
`spProleUAsnAsn TllrThrProVa l Thr&lyA 11SerPl'o6 ly6lyLtuArg6l ultu61nleuArgSerleuThr61uJ1
`
`
`
`leuAspAsn61yA 11eVa1 Arg61 yThrGl nleuPtte61 uAspAsn TyrA 1aleuA1aVa1
`
`
`
`eltul.11
`451 ATT6TGCliA&&CACCCA6CTCm6Mi&ACAACTATGCCCT6GCC6T6CTAGACMT66AGACCCGCTGMCMTACCACCCCT6TCACAGGGGCCTCCCCAGGA6GCCT6C666AGCT6CAGCTTCGMGCCTCACNMATCTT&MA
`= ���tlmlft
`170
`160
`l�
`-1�
`200
`6ly6lyY1lll\IJle6lnArgAsnPl'oGlnleu.TyrGlnAspThrlleleuTrplysAspllePheHlsLysAsnAsn6lnleuAlaleuThrleulleAspThrAsnArgSer
`
`
`
`
`A&ACACCAACCCCTCT CC CJmTC TCC8AT69M;
`
`601 &GAG666TCTT6ATCCAGCGGMCCCCCAGCTC91TACCAGGACAC6ATTTT6TGGMGGACATCTTCCACA'l6,t'CAACCAGCT66CTCTCACACT6AT
`.
`210
`220
`230
`240
`250
`S!lllaus&lu61'9A lM la61 .• nwnyl'rolys HlsSer
`6lySerArg
`
`lSr rp&ly61uSerSer61uAsc>mGlnSerll\IThrArgThrVa lllA la61y&l1'1A 1MrdllY$6lyProll\IPl'oThrA
`CCGC . . •6666CCACTGCCCACT�
`T�
`751 66CTCCCGC91T66'&AGAGA&TTCTGAGGA'19 CAGA6CCT6ACGC6CACT6TC9C C6GT6'(9C
`CT
`270
`JOO
`280
`290
`--26IL_
`Alas.9 Vall'llrA1 .. m
`,Asollt.euA1.mL euHts�61yJ1 . 61ull\IHts9roo\ lal.euVa1ThrTyrAsnThrAspThrl'lleGluSertletProAsnPro61u61yArgT11"Thrl'he61y
`
`
`TGGCATC9GAGCTliCACSCAGCCCT66TCACCTACMCACAGAC.AC6m6A6TCCATGCCCMTCCC6A66GCCG6
`901 6At9CT66C C9TCCACTT CAACCAr.N.
`TATACATT��
`1nArg· l�lnLL.rsProli4 hArgYa 11Sr yr&lyL"61Jfltt61uH1sltu TyrAsnTyrleuSerThrAspVa 161ySer9fhrleuVa 1. Pl'oleuHtsAsn61n61uYa 1ThrA la61uAsp61yThr6
`310
`320
`330
`340
`lSO
`
`
`
`
`400
`1li6MCACAGC66 �CC9CCCGAG 'f611TAT66TCT6"CA
`TACAACT ACcmCTACSGACGT66GAT CC9ACCCTC&TCSCCCT�"6ASGT
`1051
`390
`380
`370
`360
`
`A1'961uVa1ArgA1aVa1ThrSerAlaAsnlltiln61uPW1a61
`
`& ysLystlePtte61ySerleuAlaPMl.euPro61uSerl'tleAsp61Jl\.spl'roA1&SerAsnThrAlaProl"61nPro61u61nleu61nYall'lle
`
`
`CGMiAGGTGA66GCMiTTACCA6TGCCMTATCCA66A6mGCTGGC9 '16,t'16,tTCTTT666AliCCTGGCAmCTGCCG6A6AGCTTT6AT6666ACCCAGCCTCCAACACTGCCCCCCTCCAGCCA6ASCA&CTCCAA6TQm
`1201
`410
`420
`450
`430
`440
`
`
`
`
`
`
`G1u61u1 leThrGl yT yrleu Tyr I le Ser A 1 a TrpProAspSerleuProAspleuSerYa I Ph� I nAsnleu61 nV a I J leArg6 lyArg I lell\IH
`
`yrSerll\I Thrleu61 n61 yLluG lyJ le
`I sAsn61yA 1 a T
`61uThrleu
`GA6ACTCT6GM6AGATCACA&GTTACCTATACATCTCAGCAT6GCC66ACAGCCTGCCT6ACCTCAGCGTCTTCCAGMCCTGCMGTMTCC61i66ACGMTTCTGCACMT6'CGCCTACTCGCT6ACC�lt
`1351
`�
`470
`490
`460
`500
`
`Pl"ollts61nAlal.euleuHtsThrA11Asn
`SerTrplt\16lyLeuArgSerLeuArg61uleu61ySerc:ly
`
`
`LeuAlal.eu!leHfsHtsAsnThrHtsl ... PheV•IH1sThrVa1ProTrpAsp61nleuPheArgAsn
`AraPro
`
`AGCT6'CTGGGGCTGC6CTCACTWGGMCTG66CAST66ACT6'CCCTCATCCACCATAACACCCACCTcmn csT&CACAC6&T6CCCT666ACCAGCTCTTTC66AACCCGCACCMGCTCTGCTCCACACT6CCAACC&CCCA
`1501
`520 �
`•
`� a161u61�a1Llu61MllyLeu
`550
`510
`
`
`.. Yal 1nPhel.tuArg61y61n61GluAsp6lumv a1sly61u61yLeuA1Al ts61nL..6 1-"1'9ArgAlaleultu61ySer61yProThr61
`WWW9f666CC'66ECCT66C C9ACCAGCT�CCGCA666CACT6CT666ETCA66GCCCACCCMi9T
`TTCCTTC6666CC!\6&' -�ACT$CMll66Clt
`1651
`lyPrG&luAlaAsp61,. V1lAl� l1HtsT11"1.ysAsi>ProPr�alAl
`d
`ProArgGluTyrV11AsnAl=•ri�
`57�
`590
`�
`.
`560
`fsPro61- �nl'ro61 l;s;;:val�
`GCC�&'S9AGCCCCAGM
`T66CTCA6TGAC �GACcA69 T66Cc9cCCACTATMGGACCCTCCCTT T8EC
`1�1
`CC CA6611iA6 TAT6TliMTGC
`TC'9 :t:G6A T6ACA'�
`620 �
`610
`640
`650
`
`
`
`
`ProSar61yYallysProAspleuSerTyrttetPro!leTrpLysPheProAsp61u61u61yA1am& lnl'ro9ro tl Hfs� Va1Aspl.euAspAsply$�.A�1�1nArgAl&Serl'ro
`6AGGA666C GCAllCAGCCTSCCAT
`1951
`CCMCCCT
`CCCA6C66 T6T6AAACCT 6ACCTCTCCTACATGCCCATCT66MEmCCAGAT
`690
`700
`690
`
`1n61uThr61uleuYa1Elu
`
`leuThr 1eWa1SerAlaVa1Va1Ely!leleuleuValV11Valleu61yYa1ValArgArg61n61nlysJ11Ar9l1:STyr rtletArgArgleuleu6Ptte6lyllft.eul1
`l'roleu
`CTGACGT TC6TCTCT
`&C66T66TT66CATTCTGCT66TCET66TtTT66E66T66TCTTT66GATCCTCAT C&6CMiCA6>16'TCCEEMETACACGATGCEEA6ACTGCT6CAE6AMC66A6Tii6AGCC8CT6
`2101
`710
`720
`740
`750
`730
`Va 1LysVa1 leuG lySet"GlJI\ laPheGlyThrVa 1
`
`
`
`ThrProSer61yA1aMttProAsn61nA1 a61nMetArgl1 eleuLys61u ThrGluleuArgt.ys
`TyrlY$61yl le Trp J l eProAsp61y61uAsnVa1lysJleProVa1
`
`ACACCTAGC66AGCGATGCCCAACCAGGCGCAGAT6C66ATCCT6AMSAGAC66A6CTGAE6M66TGM6ETGCTT66ATCT6'CGCTTTT66CACAGTCTACAA66ECATCT66ATCCCTGAT6666A&MT6TGMMTTCCAET6
`2251
`�
`780
`no
`790
`eoo
`
`AlallelysV11leuArg61�Pl'olysA1aAsnlys61ulleleuAsp61uA11TyrV11MetAla61yVa161ySerPl'oTyrValSerArgleuleuGlyJ1 ... euThrSerThrVa16lnleuVa1Thr61nleu
`
`
`TCCAC66TGCAGCT66'T6ACACM1CTT
`666CATC9;T&ACA
`6CCATCMA6T6TTGAG66'.J•�TCCCCCAMGCCAACA1'6'1'TCTTA6ACGMGCATACST6AT6'CTG6T6TGEGCTC
`CCCATAT6TCTCCCGCCTTCT
`2401
`6
`810
`830
`840
`850
`
`
`
`IWtPro l11"6IY9. euLeuAspH Is Ya IA1'96l uASftAr96 lyArgleu61ySer61 nAspleuleuAsn T� t61nIleA1 llys6 lJflttSerTyrleu61uAspVa1 ArQleuVa I Hi sArgAspleuA
`
`l IA 1 MrgAsn
`AT6CCCTAT66CSfCTT"6ACCA TGTCC666ol •••CCGC66ACGC
`CT66GCTCC CAEEACCT 6CTGAACT6'9ATGCAGATT6CCAM!,666ATGA&CTACCT&EMiEAT6T GCE6cTCET�C
`2551
`880 Li
`890
`toO
`860
`810
`Va lleuVa 1L�ProAsnH1 sVa lLys I leThrAspl'lleElyLeuA 1-"f'9lelll. euAspI leAsp61uThr61uTyrHt sAl aAsp61y61YLY$Ya 1mJ lelysT,,_tA 1 aleu&l uSer I lel�
`TIW
`TCCATT�CACC
`2701
`GT6CT66TCMEAGTC CCAA CCAT6TCAMATTACAGACTT
`6
`910
`930
`920
`940
`KO
`
`1ThrValTrp6luleulletWlyA11L,ysProTyrAsp6lylleProA l�luJleProAspl.eullu6luLys6ly6�leuPro6lnProl'roll.-nir t1eAsp
`Hls61nSerAspVa1TrpSerTyrGlyVa
`CACCA6ASTSAT6T6T66AETTAT66T6T6ACT6T6T666AlieT6AT6ACTTTT6666CCAMCCTTACGAT66GAT CCCAGCCC6iiSA6A TCCCTSACCTGC�•••&eGGG�CCCAGCCCCCCAfC9CtA
`TTGAT
`2851
`6
`1000
`970
`980
`990
`1nAsn61uAsplMl�l&Serl'roleu
`ValTyrtletJlffletValLys
`euV11Ser61uPheSerArglle tA11ArgAspPro61nArgPheVa1Vallle6
`mr ,,...t1leAspSer6l�lul
`
`
`6TCTACAT6ATCATG6TCAM9f66AT6ATT6ACTCT
`CAMiATTCC6&SA6TT66 T6TCTEAATTCTCCC&CAT66CCA&66ACCCCCAGCGCTTT6T6ETCATCCAGMT6AGGACTT966CCCAGCCAETCCCTTI
`�
`3001
`1040
`1020
`1010
`1030
`10IO
`dmProA
`
`n61n6lyf'hePhspProAl1Pro6IJI\ 1 e61y61""l
`Ya 1 Ht sHt sArtH I sArt$erSer
`
`Asp Ser ThrPheT yrArgSerleuleuG 1 uAspAspAspMet61yAspleuVa IAspA la61u61uTyrleuVa1 Pro61
`
`
`6ACA6CACCTTCTACC6CTCACTGCT66A66ACGATGACAT66GG6ACCT66TG6ATGCT6AGGAGTATCT66TACCCCAGCAG66CTTCTT<9 CA6ACCCTGCCCCGEECGCT6666GCATGGTCCAC�
`3151
`1100
`1060
`1070
`1080
`1090
`
`l'lleAsp61yAspl.eu61Jfltt61yA11Alal.ys61yLeu61nSer
`
`Leu61uProSer61u61u61uAlaProArgSerPrSerThrAr9Ser61y61y61yAspleuThrleuSlyoleuAlal'roSer61u61)'1\la61ySerAspVal
`TCTACCA66A6T66CE6T&SGGACCTSACACTA66GCT66A6CCCTCT6MGA66A66CCCC�TCTCCACT6GCACCCTCC6AA666GCT6'CTCC6AT6TAm6ATGGT6ACCT66GAAT6666GCMiCCAAGGGGCTGCAAAGC·
`3301
`. 1130
`1140
`1150
`lllO
`1120
`
`
`G I uThrAsp6lyTyrVa1A1 ProEl nPro61uT11"Va1 Asn61nPToAspVa1
`aProleu Th.
`leuPn> ThrH I sAspProSer Pl'oleu6 I nArg TyrSerG luAspPro ThrVa 1 ProleuProSer
`ArgPro61nl'rol'ro
`CCCCCCTGACC96CCCCCAGCCTWTATS TSAACCAGCCA&A
`3451
`CTCTGA6ACT6A T6GCTAC6TTG
`CTCCCCACACA TGACCCCA6CCCTCTACA6C66
`1160
`1170
`u�
`11�
`uoo
`Serl'roArg61u61yProleul'roA11A1-"f'9ProA la611'\1aThr
`
`leu6111ArgAlal.ysThrltuSerPro61YLysAsn61yVa1YalL.ysAspYa1PheA11Phe6ly6lyAlaValGluAsnPro6lwTyrleu�h1
`TCGCCCC6A&AG6GCCCTCTGCCT6CTGCCC6ACCT6CT66TGCCACTCTWWWCMGACTCTCTCCCCA6GUVJAT666ETCETCMA6ACETTTTT6CCTTTiiGGGGT6CC6T66MiAACCCACTTWACCCtAG
`V 1250
`lZlO
`1220
`1230
`1240
`
`&ly61)'1\laA1aPl'o61nProHts�laPheSerl'roAlaPheAspAsnleuTyrTyrTl"pAsp61nAspProPro6111Ar96 1"'1aProl'roSerThrPhelys 61yThrPn>ThrAla61uAs11Pro6luTyrleuGly
`CCACCAEA6Cli0066GCTCCACCCAGCAC
`3751
`GGA&GAGCT6CCCCT
`1255
`
`leuAspVa I ProVa lEllO
`CT66ACGTGCCA6T6TWCCAG/''6GCCMGTCCGCA&MGCCCTGAT6T6TCCTCA666AECAGEGl'�6GCCT6ACTTCTGCT6GCATCMGA66TWCCTCC6ACCACTTCCA66GSAACCT6CCATGCCA68MCCTltTC
`mt 4051
`CTMEGMCCTTCCTTCCT6CTT6A6TTCCCA6AT66CT66AAGG6ETCCAGCCTCGTTW'\6AE6'1CA6CACT66G6A6TCm6T66ATTCT6A6GCCCTGCCCMTGAGACTCTA666TCCA6T66ATGCCACAGCCCAGCTT811
`
`666TACTGMAGCCTTAE66AAGCT6'CC�6666A"6C6'CCCTMG66AET6TCTA'\6,t*CA••AGCGACCCATTCA6AGACTGTCCCTGAMCCTA6TACTGCCCCCCATSAWt,SGA•CNJU. cccmcCTTCCA6ATCCT
`4201
`ATGGT6TCA6TATCCA6GCm6TACA6AGTGCTTTTCT6mAGTTmACmTTTT6TTTTSmTTTTMAGAC6AMTMAGACC"6�AT6661'6TT6TAT6666AGGCAA6T6TWTCCTTCTCCACACCCACT
`4351
`TT6TCCAmGCMA�TTTT 66A••w••••••••UUA
`4501
`Fia. 3. Complete nucleotide and amino acid sequences of HER2 (clone ).HER2-436). Synthetic probes 1 and 2 (Fig. 1) were used to screen 2 x l<l6
`clones of a human placental cDNA library in >.gt10 (17) as described (9). Fifty-two clones were isolated and characterized by Eco RI restn'ction di·
`aestion and Southern blot hybridization (25) with the