Oncogene (1998) 16, 3215 3218
`1998 Stockton Press All rights reserved 0950 9232/98 $12.00
`
`http://www.stockton press.co.uk/onc
`
`SHORT REPORT
`Point mutation and homozygous deletion of PTEN/MMAC1 in primary
`bladder cancers
`
`Paul Cairns1, Ella Evron1, Kenji Okami1, Naomi Halachmi1, Manel Esteller2, James G Herman2,
`Shikha Bose3, Steven I Wang3, Ramon Parsons3 and David Sidransky1
`
`1Head and Neck Cancer Research, Department of Otolaryngology, 2Oncology Center, Johns Hopkins University School of
`Medicine, Baltimore, Maryland 21205 and 3Department of Pathology and Medicine, College of Physicians and Surgeons, Columbia
`University, New York, NY 10032, USA
`
`A new tumor suppressor gene PTEN/MMAC1 was
`recently isolated at chromosome 10q23 and found to be
`inactivated by point mutation or homozygous deletion in
`glioma, prostate and breast cancer. PTEN/MMAC1 was
`also identified as the gene predisposing to Cowden
`disease, an autosomal dominant cancer predisposition
`syndrome associated with an increased risk of breast,
`skin and thyroid tumors and occasional cases of other
`cancers including bladder and renal cell carcinoma. We
`screened 345 urinary tract cancers by microsatellite
`analysis and found chromosome 10q to be deleted in 65
`of 285 (23%) bladder and 15 of 60 (25%) renal cell
`cancers. We then screened the entire PTEN/MMAC1
`coding region for mutation in 25 bladder and 15 renal
`cell primary tumors with deletion of chromosome 10q.
`Two somatic point mutations, a frameshift and a splicing
`variant, were found in the panel of bladder tumors while
`no mutation was observed in the renal cell carcinomas.
`To screen for homozygous deletion, we isolated two
`polymorphic microsatellite repeats from genomic BAC
`clones containing the PTEN/MMAC1 gene. Using these
`new informative markers, we identified apparent reten-
`tion at the gene locus indicative of homozygous deletion
`of PTEN/MMAC1 in four of 65 bladder and 0 of 15
`renal cell tumors with LOH through chromosome 10q.
`Identification of the second inactivation event in six
`bladder tumors with LOH of 10q implies that
`the
`PTEN/MMAC1 gene is occasionally involved in bladder
`tumorigenesis. However, the low frequency of biallelic
`inactivation suggests
`that either PTEN/MMAC1 is
`inactivated by other mechanisms or it is not the only
`target of chromosome 10q deletion in primary bladder
`and renal cell cancer.
`
`Keywords: PTEN/MMAC1; bladder cancer; renal cell
`cancer; chromosome 10q; homozygous deletion
`
`Adult sporadic cancers are known to arise through the
`accumulation of multiple genetic events (Fearon and
`Vogelstein 1990). Several of these genetic events have
`been identified in bladder and renal cell cancer while
`others remain to be elucidated (Cairns et al., 1991,
`1995; Ishikawa et al., 1991; Sidransky et al., 1991;
`Reiter et al., 1993; Latif et al., 1993; Gnarra et al.,
`
`Correspondence: D Sidransky
`Received 8 December 1997; revised 19 January 1998; accepted 20
`January 1998
`
`1994). The Rb gene on chromosomal arm 13q (Cairns
`et al., 1991; Ishikawa et al., 1991), the p53 gene on
`chromosomal arm 17p (Sidransky et al., 1991; Reiter et
`al., 1993) and the CDKN2a gene on chromosomal arm
`9p (Cairns et al., 1995) are known to be involved in
`both of these tumor types while the VHL gene is
`frequently inactivated in renal cell carcinomas (Latif et
`al., 1993; Gnarra et al., 1994). The identification of
`other areas of chromosomal deletion suggest that other
`suppressor loci
`important in bladder and renal cell
`carcinogenesis remain to be discovered (Knowles et al.,
`1994; Morita et al., 1991).
`Recently, a tumor suppressor gene on chromosome
`10q23, PTEN/MMAC1, was
`cloned and somatic
`mutations were
`identified in glioma, breast and
`prostate cancer (Li et al., 1997; Steck et al., 1997).
`PTEN/MMAC1 has also been identified as the gene
`predisposing to Cowden disease (Liaw et al., 1997), an
`autosomal dominant cancer predisposition syndrome
`associated with an increased risk of breast, skin and
`thyroid tumors and occasional cases of other cancers
`(Eng et al., 1994; Starink et al., 1986) including bladder
`(Starink et al., 1986) and renal cell carcinoma (Haibach
`et al., 1992). Deletion of chromosome 10 has been
`observed in cytogenetic studies of bladder cancer
`(Sandberg 1994), mostly as monosomy but in some
`cases as specific deletion of 10q. Loss of heterozygosity
`on chromosome 10q has previously been reported in
`5 – 7% of bladder
`tumors
`(Knowles et al., 1994;
`Habuchi et al., 1993) and 29% of renal tumors in
`allelotype studies (Morita et al., 1991a).
`To further elucidate the role of chromosome 10 in
`the progression of sporadic bladder and renal cancer
`and to identify tumors for eventual sequence analysis,
`we screened a large representative series of 285 primary
`bladder tumors and 60 primary renal cell tumors with
`a panel of microsatellite markers (Figure 1) spanning
`chromosome 10. We found LOH in 65 of 285 (23%)
`bladder tumors and 15 of 60 (25%) renal cell tumors at
`one or more markers on 10q. There were 15 cases of
`deletion of the q arm only in the bladder tumors
`suggesting the existence of a tumor suppressor locus on
`the q arm. The renal cell tumors all had monosomic
`loss of chromosome 10 with the exception of one
`tumor that displayed loss only at D10S215. A previous
`deletion mapping study of renal cell carcinoma has
`suggested that the target of deletion is on 10q (Morita
`et al., 1991b). We found a higher level of deletion of
`chromosome 10q in bladder tumors, and a similar level
`of LOH in our panel of sporadic renal cell tumors, to
`that previously reported.
`
`NOVARTIS EXHIBIT 2063
`Breckenridge v. Novartis, IPR 2017-01592
`Page 1 of 4
`
`ª
`

`

`3216
`
`PTEN/MMAC1 in bladder cancer
`P Cairns et al
`
`D10S249
`
`N
`
`T
`
`D10S226
`
`D10S1744
`
`D10S1744
`
`D10S215
`PTEN/MMAC1 265A
`D10S541
`
`D10S215
`
`D10S185
`
`D10S221
`
`265A
`
`D10S541
`
`Figure 1 Approximate map location of chromosome 10 markers
`and homozygous deletion of PTEN/MMAC1 by microsatellite
`analysis. The previously mapped 10p markers D10S249 and
`D10S226 and 10q markers D10S1744, D10S215, D10S541,
`D10S185 and D10S221 are indicated together with the newly
`cloned PETN/MMAC1 polymorphic marker 265A (D10S2491).
`To the right is a bladder tumor showing apparent retention of
`heterozygosity indicating homozygous deletion at D10S215 and
`265A (D10S2491), flanked by LOH indicated by loss of the upper
`allele at D10S1744 and loss of the lower allele at D10S541 in the
`tumor (T) lane. Primary bladder tumor specimens were obtained
`by transurethral resection or cystectomy and primary renal tumor
`specimens after nephrectomy. All primary tumor samples were
`frozen immediately and were of representative grade and stage at
`presentation. Peripheral blood from each patient was collected in
`EDTA as a normal control. Macroscopically pure tumor was
`dissected from the frozen biopsies and leukocytes were pelleted
`from blood samples before extraction and purification of DNA
`(Sambrook et al., 1989). For PCR amplification and LOH
`analysis, DNA from tumor and venous blood was analysed for
`LOH by amplification of dinucleotide repeat containing sequences
`using PCR and the conditions previously described (van der Riet
`et al., 1994). For informative cases, allelic loss was scored if the
`intensity of signal
`from one allele was significantly reduced
`(430%) in the tumor DNA when compared to the normal DNA.
`Primer sequences for D10S249, D10S226, D10S1744, D10S215,
`D10S541, D10S185 and D10S221 are available from Research
`Genetics (Huntsville, AL) or the Genome Database (JHU, MD).
`To isolate new microsatellite markers, the human genomic BAC
`clones 265 and 60 (Li et al., 1997) containing the PTEN/MMAC1
`gene were subcloned into Bluescript and plated. Colonies were
`lifted onto nylon membranes and screened with the microsatellite
`repeat oligomer, (GT)10. Two of the microsatellite blocks isolated,
`designated D10S2491 and D10S2492, were
`found to be
`polymorphic. The primer sequences used for PCR amplification
`are as follows; D10S2491 F 5' GTTAGATAGAGTACCTG
`CACTC 3', D10S2491 R 5' TTATAAGGACTGAGTGAGG
`GA 3', D10S2492 F 5' TGCAGTGAGCTGTGAAGATG 3',
`D10S2492 R 5' TGTTTCTCTTACTACCTATGTGA 3'. Both
`markers have alleles in the size range of 120 160 base pairs
`and amplify well at an annealing temperature of 558C. D10S2491
`was informative in 82% of cases and D10S2492 in 20% of cases.
`Microsatellite marker D10S2492 was only used on cases non
`informative for D10S2491
`
`Because the initial reports of PTEN/MMAC1 also
`described frequent homozygous deletion of the gene in
`tumor cell lines (Li et al., 1997; Steck et al., 1997) we
`wanted to identify homozygous deletion in primary
`tumors before selecting tumors for PTEN/MMAC1
`sequence analysis. Although we screened the bladder
`and renal tumors with the closest mapped flanking
`markers to PTEN/MMAC1, D10S215 and D10S541, in
`the initial reports approximately half of the homo-
`zygous deletions did not extend to these flanking
`markers
`(Li
`et al., 1997; Steck et al., 1997).
`Furthermore, we have previously shown at
`the
`CDKN2a tumor
`suppressor
`locus on chromosome
`9p21 that
`the frequency of homozygous deletion
`increases when markers near or within the gene are
`used since homozygous deletions are nested in size
`around the target gene (Cairns et al., 1995). The marker
`WG9 (Li et al., 1997), located between D10S215 and
`D10S541 and within PTEN/MMAC1,
`is practically
`non-informative (55%). A non-polymorphic marker
`can be used to detect homozygous deletion by simple
`presence or absence of signal in tumor cell lines which
`are composed of tumor cells only. In primary tumor
`specimens, normal cells complicate or render impossible
`this method of detecting homozygous deletions. To
`reliably detect homozygous deletion, we prefer to assess
`apparent retention of heterozygosity at the gene of
`interest
`in tumors with LOH of flanking markers
`(Cairns et al., 1995). The apparent
`retention of
`
`A
`1 2 3 4
`
`C
`1 2 3 4
`
`G
`1 2 3 4
`
`T
`1 2 3 4
`
`Figure 2 Sequencing gel showing a frameshift mutation of PTEN/
`MMAC1. Autoradiograph of a sequencing gel of exon 7 of PTEN/
`MMAC1 in primary bladder tumors. Lanes 1 and 2 show tumor of
`DNAs with wild type sequence. Lane 3 is normal DNA from
`patient 140 and lane 4 is tumor 140 DNA showing a one base pair
`deletion resulting in a frameshift
`(arrow). The mutation was
`confirmed by
`reamplification and resequencing. For PCR
`amplification and cycle
`sequencing of PTEN/MMAC1, 50
`nanograms of genomic template DNA was amplified with primers
`for exons 1 9 of PTEN/MMAC1 at 958C for 30 s, 50 588C for
`1 min and 728C for 1 min for 30 35 cycles with a final extension
`step at 728C for 5 min. The resulting PCR product was cycle
`sequenced according to the manufacturer’s instructions (Perkin
`Elmer, Roche Molecular Systems Inc., Branchburg, NJ) and run
`on a 6% acrylamide gel. The primer
`sequences used for
`amplification and sequencing of the gene were as described in
`Liaw et al. (1997) and Wang et al. 1997). Sequence changes were
`confirmed by reamplification and resequencing of the tumor DNA
`and normal DNA
`
`NOVARTIS EXHIBIT 2063
`Breckenridge v. Novartis, IPR 2017-01592
`Page 2 of 4
`
`

`

`heterozygosity is due to amplification of DNA from
`normal cells contaminating the tumor biopsy and
`correlates with homozygous deletion assessment by
`Southern and FISH analysis (Cairns et al., 1995).
`We therefore obtained two overlapping BACs that
`together contained the entire genomic PTEN/MMAC1
`gene (Li et al., 1997) and screened for microsatellite
`blocks with a GT oligomer. We isolated several
`microsatellite blocks, two of which were found to be
`polymorphic. These markers must map within or
`immediately adjacent
`to PTEN/MMAC1 and are
`nearer to the gene than D10S215 and D10S541 which
`are not included on the BAC clones (Li et al., 1997).
`We tested the bladder and renal tumors with 10q LOH
`for PTEN/MMAC1 homozygous deletion with the new
`markers D10S2491 and D10S2492. These markers
`recently detected PTEN/MMAC1 homozygous dele-
`tions in primary prostate tumors confirmed by FISH
`analysis (Cairns et al., 1997).
`We found four cases of homozygous deletion of
`PTEN/MMAC1 in the 65 primary bladder tumors with
`LOH of 10q (Figure 1). Two of the four cases were
`grade II, T1 tumors and two were grade III, T2
`tumors. After exclusion of tumors with homozygous
`deletion, we then proceeded with complete sequence
`analysis of the coding region of PTEN/MMAC1 and
`the intron/exon boundaries. In the 25 bladder tumors
`sequenced we found one frameshift mutation in exon 7
`(Figure 2), predicted to result in a truncated protein in
`tumor 140 (grade III, T2) and a somatic mutation in
`the 5' UTR near
`the start of exon 1, probably
`representing a splicing variant
`(Senapathy et al.,
`1990) in tumor 115 (grade III, T4). Tumor suppressor
`genes in general and CDKN2a in particular, can be
`inactivated by epigenetic methylation of the promoter
`resulting in complete blocking of transcription (Merlo
`et al., 1995). We investigated promoter methylation as
`a possible inactivation mechanism of the retained allele
`of PTEN/MMAC1 in tumors with 10q LOH but
`without homozygous deletion or point mutation.
`However, using methylation-specific PCR (Herman et
`al., 1996) with appropriate controls, we found no
`evidence of PTEN/MMAC1 promoter methylation in
`12 bladder and 12 renal cell tumors (data not shown).
`
`References
`
`3217
`
`PTEN/MMAC1 in bladder cancer
`P Cairns et al
`
`Thus, we detected the second inactivation event at
`PTEN/MMAC1 in two of 25 (8%) bladder tumors by
`sequence analysis and four of 65 (6%) by homozygous
`deletion. Overall, 14% of bladder tumors with LOH of
`10q analysed for both point mutation and homozygous
`deletion had a second mutation of PTEN/MMAC1.
`No somatic mutation or homozygous deletion was
`observed in the renal cell tumors with LOH through
`PTEN/MMAC1 despite a mutation reported in one of
`four primary renal
`cell
`tumors with 10q LOH
`sequenced by Steck et al., (1997) and our finding of
`one tumor with a localized LOH at D10S215.
`Previous reports suggested that mutation of PTEN/
`MMAC1 is associated with advanced cancers (Li et al.,
`1997; Steck et al., 1997). LOH of chromosome 10 was
`seen in renal cell carcinomas of all stages. For bladder
`cancer, we observed LOH of 10q in 8% of Ta, 20% of
`T1 and 29% of T2 tumors. The six tumors with deletion
`and point mutation were all grade II or III with stromal
`(T1) or muscle (T2) invasion. It appears then that
`PTEN/MMAC1 is mutated and inactivated in approxi-
`mately 14% of primary bladder tumors with 10q LOH.
`Moreover, as in other cancer types, tumors of high
`grade and stage are more likely to harbor 10q loss and
`PTEN/MMAC1 mutations. This result is likely to be an
`underestimation since we did not search for mutations
`in the promoter or regulatory regions, did not sequence
`tumors without LOH (potentially harboring point
`mutations of both alleles), and almost certainly missed
`some
`small homozygous deletions. However,
`the
`relatively infrequent detection of the second inactivat-
`ing event leads us to conclude that other mechanisms of
`inactivation may exist
`for PTEN/MMAC1 or that
`another tumor suppressor locus may be an additional
`target of 10q deletion in bladder and renal cancer.
`
`Abbreviations
`LOH, Loss of Heterozygosity; PCR, Polymerase Chain
`Reaction; CDKN2a, Cyclin Dependent Kinase 4 Inhibitor/
`p16/MTS1; PTEN/MMAC1, Phosphatase and Tensin
`homolog deleted on chromosome Ten/Mutated in Multi
`ple Advanced Cancers 1; BAC, Bacterial Artificial
`Chromosome; UTR, Untranslated Region.
`
`Cairns P, Proctor AJ and Knowles MA. (1991). Oncogene, 6,
`2305 2309.
`Cairns P, Polascik TJ, Eby, Y, Tokino K, Califano J, Merlo
`A, Mao L, Herath J, Jenkins R, Westra, W, Rutter JL,
`Buckler A, Gabrielson E, Tockman M, Cho KR, Hedrick
`L, Bova GS, Issacs W, Schwab D, and Sidransky D.
`(1995). Nat. Gen., 11, 210 212.
`Cairns P, Okami K, Halachmi S, Halachmi N, Esteller M,
`Herman JG, Jen J, Isaacs WB, Bova GS and Sidransky D.
`(1997). Cancer Res., 57, 4997 5000.
`Eng C, Murday V, Seal S, Mohammed S, Hodgson SV,
`Chaudary MA, Fentiman IS, Ponder BA and Eeles RA.
`(1994). J. Med. Genet., 31, 458 461.
`Fearon ER and Vogelstein B. (1990). Cell, 61, 759 767.
`Gnarra J, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif
`F, Liu S, Chen F, Duh F M, Lubensky I, Duan DR,
`Florence C, Pozzatti R, Walther MM, Bander NH,
`Grossman HB, Brauch H, Pomer S, Brooks JD, Issacs
`WB, Lerman MI, Zbar B and Linehan WM. (1994). Nat.
`Gen., 7, 85 90.
`
`Habuchi T, Ogawa O, Kakehi Y, Ogura K, Koshiba M,
`Hamazaki S, Takahashi R, Sugiyama T and Yoshida O.
`(1993). Int. J. Cancer, 53, 579 584.
`Haibach H, Burns TW, Carlson HE, Burman KD and Deftos
`LJ, (1992). Am. J. Clin. Path., 97, 705 712.
`Herman JG, Gra€ JR, Myohanen S, Nelkin BD and Baylin
`SB. (1996). Proc. Natl. Acad. Sci. USA, 93, 9821 9826.
`Ishikawa J, Xu HJ, Hu SX, Yandell DW, Maeda S,
`Kamidono S, Benedict WF and Takahashi R. (1991).
`Cancer Res. 51, 5736 5743.
`Knowles MA, Elder PA, Williamson M, Cairns JP, Shaw
`ME and Law MG. (1994). Cancer Res., 54, 531 538.
`Latif F, Tory K, Gnarra J, Yao M, Duh F M, Orcutt ML,
`Stackhouse T, Kuzmin I, Modi W, Geil L, Schmidt L,
`Zhou F, Li H, Wei MH, Chen F, Glenn G, Choyke P,
`McClellan MW, Weng Y, Duan D SR, Dean M, Glavac
`D, Richards FM, Crossey PA, Ferguson Smith MA, Le
`Paslier D, Chumakov I, Cohen D, Chinault AC, Maher
`ER, Linehan WM, Zbar B and Lerman MI. (1993).
`Science, 260, 1317 1320.
`
`NOVARTIS EXHIBIT 2063
`Breckenridge v. Novartis, IPR 2017-01592
`Page 3 of 4
`
`

`

`3218
`
`PTEN/MMAC1 in bladder cancer
`P Cairns et al
`
`Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc
`J, Miliaresis C, Rodgers L, McCombie R, Bigner SH,
`Giovanella BC, Itterman M, Tycko B, Hibshoosh H,
`Wigler MH and Parsons R. (1997). Science, 275, 1943
`1947.
`Liaw D, Marsh DJ, Li J, Dahia PLM, Wang SI, Zheng Z,
`Bose S, Call KM, Tsou HC, Peacock M, Eng C and
`Parsons R. (1997). Nat. Gen., 16, 64 67.
`Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger
`PC, Baylin SB and Sidransky D. (1995). Nat. Med., 1,
`686 692.
`Morita R, Ishikawa J, Tsutsumi M, Hikiji K, Tsukada Y,
`Kamidono S, Maeda S and Nakamura Y. (1991a). Cancer
`Res., 51, 820 823.
`Morita R, Saito S, Ishikawa J, Ogawa O, Yoshida O,
`Yamakawa K and Nakamura Y. (1991b). Cancer Res., 51,
`5817 5820.
`Reiter RE, Anglard P, Liu S, Gnarra JR and Linehan WM.
`(1993). Cancer Res. 53, 3092 3097.
`Sambrook J, Fritsch EF and Maniatis T. (1989). Molecular
`Cloning: A Laboratory Manual, 2nd edn, Cold Spring
`Harbor Laboratory Press: Cold Spring Harbor, NY.
`
`Sandberg AA. (1994). J. Urol., 151, 545 560.
`Senapathy P, Shapiro MB and Harris NL. (1990). Methods
`Enzymol., 183, 252 278.
`Sidransky D, von Eschenbach A, Tsai YC, Jones P,
`Summerhayes I, Marshall F, Paul M, Green P, Hamilton
`SR, Frost P and Vogelstein B. (1991). Science, 252, 706
`709.
`Starink TM, Van Der Veen JPW, Arwert F, De Waal LP, De
`Lange GG, Gille JJP and Eriksson AW. (1986). Clin. Gen.,
`29, 222 233.
`Steck PA, Pershouse MA, Jasser SA, Yung WAK, Lin H,
`Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis
`T, Frye C, Hu R, Swedlund B, Teng DHF and Tavtigian
`SV. (1997). Nat. Gen., 15, 356 362.
`van der Riet P, Karp D, Farmer E, Wei Q, Grossman L,
`Tokino K, Ruppert JM and Sidransky D. (1994). Cancer
`Res., 54, 25 27.
`Wang SI, Puc J, Bruce JN, Cairns P, Sidransky D and
`Parsons R. (1997). Cancer Res., 57, 4183 4186.
`
`NOVARTIS EXHIBIT 2063
`Breckenridge v. Novartis, IPR 2017-01592
`Page 4 of 4
`
`