RAPID COMMUNICATION
`RAPID COMMUNICATION
`
`Jpn. J. Cancer Res. 88, 1025-1028, November 1997
`Jpn. J. Cancer Res. 88, 1025-1028, November 1997
`
`Infrequent Genetic Alterations of the PTEN/MMACI Gene in Japanese Patients
`Infrequent Genetic Alterations of the PTEN/MMACI Gene in Japanese Patients
`with Primary Cancers of the Breast, Lung, Pancreas, Kidney, and Ovary
`with Primary Cancers of the Breast, Lung, Pancreas, Kidney, and Ovary
`
`
`4# Akihiko Suzuki, 1
`# Masami Sato, 12
`4 Hiromitsu Yamakawa,' Kazuhiko
`Akira Sakurada,I,4# Akihiko Suzuki,"2# Masami Sato",4 Hiromitsu Yamakawa,' Kazuhiko
`Akira Sakurada, 1
`•
`•
`•
`Orikasa, 1 Shinji Uyeno,3 Tetsuya Ono,3 Noriak.i Ohuchi, 2 Shigefumi Fujimura4 and Akira
`Orikasa,l Shinji Uyeno/ Tetsuya Ono,3 Noriaki Ohuchi/ Shigefumi Fujimura4 and Akira
`Radi l,5
`5
`Horii 1
`•
`Departments of IMolecular Pathology, 2Surgery II, 3Radiation Research, Tohoku University School of
`Departments of 1Molecular Pathology, 2Surgery II, 3Radiation Research, Tohoku University School of
`Medicine, 2-1 Seiryo-machi. Aoba-ku. Sendai 980-77 and 4Department afThoracic Surgery. Institute of
`Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-77 and 4Department of Thoracic Surgery, Institute of
`Development, Aging and Cancer, Tohoku University, 4-1 Seiryo-machi, Aoba-ku. Sendai 980-77
`Development, Aging and Cancer, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai 980-77
`
`In the present study, we searched for genetic alterations of the entire coding region of PTEN/MMA Cl,
`In the present study, we searched for genetic alterations of the entire coding region of PTEN/MMA Cl,
`a recently isolated candidate tumor suppressor gene, in 178 specimens from Japanese patients with
`a recently isolated candidate tumor suppressor gene, in 178 specimens from Japanese patients with
`various malignant tumors by the polymerase chain reaction~single strand conformation polymorphism
`various malignant tumors by the polymerase chain reaction-single strand conformation polymorphism
`method. The samples consisted of 11 glioblastoma multiformes (GBMs), 14 astrocytomas, 47 breast
`method. The samples consisted of 11 glioblastoma multiformes (GBMs), 14 astrocytomas, 47 breast
`cancers, 25 non~small cell lung cancers, 9 small cell lung cancers, 8 pancreatic cancers, 24 renal cell
`cancers, 25 non-small cell lung cancers, 9 small cell lung cancers, 8 pancreatic cancers, 24 renal cell
`carcinomas, 20 ovarian cancers, and 20 metastatic lung tumors from various organs. Only one somatic
`carcinomas, 20 ovarian cancers, and 20 metastatic lung tumors from various organs. Only one somatic
`frameshift mutation at codon 319 was observed in one (9%) of eleven GBMs. Our results suggest that
`frameshift mutation at codon 319 was observed in one (9%) of eleven GBMs. Our results suggest that
`mutation of the PTEN/MMA Cl gene does not playa major role in carcinogenesis, at least in the tumor
`mutation of the PTEN/MMA Cl gene does not play a major role in carcinogenesis, at least in the tumor
`types from Japanese patients analyzed in this study.
`types from Japanese patients analyzed in this study.
`
`Key words: Glioblastoma multiforme - Somatic mutation - PTEN/MMACI gene
`Key words: Glioblastoma multiforme - Somatic mutation -PTEN/MMACI gene
`
`Gliomas are the most common primary brain tumors
`Gliomas are the most common primary brain tumors
`of the adult central nervous system in the U. S.,I) and the
`of the adult central nervous system in the U. S., 1> and the
`second most common in Japan. 2
`) GBM is one of the brain
`second most common in Japan. 2
`) GBM is one of the brain
`tumors with a very poor prognosis: despite a variety of
`tumors with a very poor prognosis: despite a variety of
`trials of surgical treatments and adjuvant therapies, the
`trials of surgical treatments and adjuvant therapies, the
`survival rate has not shown any significant improvement.
`survival rate has not shown any significant improvement.
`To establish a method for better clinical management of
`To establish a method for better clinical management of
`patients with GBMs, it is necessary to understand the
`patients with GBMs, it is necessary to understand the
`mechanisms of carcinogenesis. To date, several genetic
`mechanisms of carcinogenesis. To date, several genetic
`alterations, including amplification and rearrangement of
`alterations, including amplification and rearrangement of
`the epidermal growth factor receptor gene'> and allelic
`the epidermal growth factor receptor gene3
`) and allelic
`deletions of Ip, 9p, 10, 13q, 17p, 18q, 19q, and 22q, have
`deletions of 1p, 9p, 10, 13q, 17p, 18q, 19q, and 22q, have
`been reported
`in GBMs (reviewed by Louis and
`been reported
`in GBMs (reviewed by Louis and
`Gussela4>); among these, loss of chromosome 10 was the
`Gussela'»); among these, loss of chromosome 10 was the
`most frequently observed.'> Recently, a candidate tumor
`most frequently observed.') Recently, a candidate tumor
`suppressor gene, PTEN/MMACI was identified on chro(cid:173)
`suppressor gene, PTEN/MMACI was identified on chro(cid:173)
`mosome 10q23.3, and frequent mutations in this gene
`mosome 10q23.3, and frequent mutations in this gene
`were reported in GBMs as well as cancers of the breast,
`were reported in GBMs as well as cancers of the breast,
`prostate, and kidney.5,6)
`6
`prostate, and kidney. 5
`•
`)
`In this study, we tried to elucidate the possible role of
`In this study, we tried to elucidate the possible role of
`mutation of PTEN/MMACI in carcinogenesis in various
`mutation of PTEN/MMACI in carcinogenesis in various
`organs. We searched for genetic alterations in 178 tumors
`organs. We searched for genetic alterations in 178 tumors
`
`II The first two authors contributed equally to this work.
`# The first two authors contributed equally to this work.
`S To whom correspondence should be addressed.
`5 To whom correspondence should be addressed.
`Abbreviations: GBM, glioblastoma multiforme; MMACl, mu w
`Abbreviations: GBM, glioblastoma multiforme; MMACl, mu(cid:173)
`tated in multiple advanced cancers I; PTEN, phosphatase
`tated in multiple advanced cancers l; PTEN, phosphatase
`and tensin homolog deleted on chromosome ten; PCR, poly(cid:173)
`and tensin homolog deleted on chromosome ten; PCR, poly(cid:173)
`merase chain reaction; SSCP, single strand conformation poly(cid:173)
`merase chain reaction; SSCP, single strand conformation poly(cid:173)
`morphism; LOH, loss of heterozygosity.
`morphism; LOH, loss of heterozygosity.
`
`(11 GBMs, 14 astrocytomas, 47 breast cancers, 25 non(cid:173)
`(11 GBMs, 14 astrocytomas, 47 breast cancers, 25 non(cid:173)
`small cell lung cancers, 9 small cell lung cancers, 8
`small cell lung cancers, 9 small cell lung cancers, 8
`pancreatic cancers, 24 rena] cell carcinomas, 20 ovarian
`pancreatic cancers, 24 renal cell carcinomas, 20 ovarian
`cancers, and 20 metastatic lung tumors from tumors at
`cancers, and 20 metastatic lung tumors from tumors at
`various primary sites, including the breast, lung, kidney,
`various primary sites, including the breast, lung, kidney,
`urinary bladder, prostate, colon, and gall bladder) re(cid:173)
`urinary bladder, prostate, colon, and gall bladder) re(cid:173)
`moved from Japanese patients at Tohoku University
`moved from Japanese patients at Tohoku University
`Hospital (Sendai) and its associated hospitals (Sendai).
`Hospital (Sendai) and its associated hospitals (Sendai).
`Clinical characteristics of these tumors are summarized
`Clinical characteristics of these tumors are summarized
`in Table I. Samples were frozen in liquid nitrogen imme(cid:173)
`in Table I. Samples were frozen in liquid nitrogen imme(cid:173)
`diately after surgical resection and stored at - 80°C until
`diately after surgical resection and stored at - 80°C until
`use. DNAs were extracted according to methods de(cid:173)
`use. DNAs were extracted according to methods de(cid:173)
`scribed previously. 7) In each case, the constitutional
`scribed previously. 1> In each case, the constitutional
`DNA was also prepared from either peripheral blood
`DNA was also prepared from either peripheral blood
`cells or from normal tissue.
`cells or from normal tissue.
`Tumor DNAs were subjected to PCR-SSCP analysis
`Tumor DNAs were subjected to PCR-SSCP analysis
`to search for mutations. Primer sets for amplification of
`to search for mutations. Primer sets for amplification of
`9 exons of PTEN/MMACI were designed according to
`9 exons of PTEN/MMACI were designed according to
`Steck et a/.,'> with some differences (see Table II). We
`Steck et al.,') with some differences (see Table II). We
`divided exons 5 and 8 into two portions, because these
`divided exons 5 and 8 into two portions, because these
`two exons are relatively large. PCR-SSCP analysis was
`two exons are relatively large. PCR-SSCP analysis was
`performed according to Orita et al. 8
`) with some modifica w
`performed according to Ori ta et al.&) with some modifica(cid:173)
`tions.'> The PCR mixture was prepared as follows: 50 ng
`tions. 9
`) The PCR mixture was prepared as follows: 50 ng
`of genomic DNA, 2.5 pmol of [r-32P] end-labeled primer
`of genomic DNA, 2.5 pmol of [r-32P] end-labeled primer
`pair, 0.75 pmol each of deoxyribonucleotide triphos(cid:173)
`pair, 0.75 pmol each of deoxyribonucleotide triphos(cid:173)
`phates, 4.5 mM Tris-HCI (pH 8.8), 67 mM (NH,)zSO,,
`phates, 4.5 rnM Tris-HCI (pH 8.8), 67 rnM (NH,)zSO"
`6.7 mM /9-mercaptoethanol, 4.5 µM EDTA, 4.5 mM
`6.7 rnM i9-mercaptoethanol, 4.5 /1M EDTA, 4.5 rnM
`MgCI,, and 0.25 unit of Taq DNA polymerase in a final
`MgC!" and 0.25 unit of Taq DNA polymerase in a final
`volume of 10 µI. In each case, the amplified product was
`volume of 10 /11. In each case, the amplified product was
`diluted two-fold with a formamide-dye mixture (95%
`diluted two-fold with a formamide-dye mixture (95%
`
`1025
`1025
`
`NOVARTIS EXHIBIT 2062
`Breckenridge v. Novartis, IPR 2017-01592
`Page 1 of 4
`
`

`

`Jpn. J. Cancer Res. 88, November 1997
`Jpn. J. Cancer Res. 88, November 1997
`
`Table I. Clinical Characteristics of Samples
`Table I. Clinical Characteristics of Samples
`
`Origin of tumor
`Origin of tumor
`
`Brain
`Brain
`Breast
`Breast
`Lung
`Lung
`Kidney
`Kidney
`Ovary
`Ovary
`Pancreas
`Pancreas
`
`No. of
`No. of
`tumors analyzed
`tumors analyzed
`25
`25
`47
`47
`34
`34
`24
`24
`20
`20
`8
`8
`
`No. of
`No. of
`advanced tumors
`advanced tumors
`11
`11
`10
`10
`20
`20
`15
`IS
`12
`12
`6
`6
`
`formamide/0.25% bromophenol blue/0.25% xylene cya(cid:173)
`formamide/O.25% bromophenol blue/O.25% xylene cya(cid:173)
`nol) and electrophoresed on a 5% polyacrylamide gel
`noll and electrophoresed on a 5% polyacrylamide gel
`containing 5% glycerol at 4°C.
`containing 5% glycerol at 4°C.
`Typical examples of the SSCP analyses are shown in
`Typical examples of the SSCP analyses are shown in
`Fig. IA. Extra-large migrating bands were observed in
`Fig. lAo Extra-large migrating bands were observed in
`tumor GB8T (a case of GBM), whereas no alterations
`tumor GB8T (a case of GBM), whereas no alterations
`were found in the constitutional DNA of this patient
`were found in the constitutional DNA of this patient
`(GB8N). These results suggested a somatic mutation in
`(GB8N). These results suggested a somatic mutation in
`this tumor. Subsequently, the nucleotide sequences of the
`this tumor. Subsequently, the nucleotide sequences of the
`
`Table II. Primers Used for Mutation Analysis of PTEN/MMACJ
`Table II. Primers Used for Mutation Analysis of PTEN/MMACI
`Sequences (5'-3')
`Sequences (5'-3')
`
`Exon
`Exon
`
`I
`I
`2
`2
`3
`3
`4
`4
`5
`5
`
`6
`6
`7
`7
`8
`8
`
`9
`9
`
`Primer
`Primer
`
`Forward
`Forward
`CAGCCGTTCGGAGGATTA
`IF/JR
`CAGCCGTTCGGAGGATTA
`IF/IR
`2F/2R
`TGACCACCTTTTATTACTCC
`TGACCACCTTTTATTACTCC
`2F/2R
`ATATTCTCTGAAAAGCTCTGG
`3F/3R
`ATATTCTCTGAAAAGCTCTGG
`3F/3R
`TTCAGGCAATGTTTGTTA
`4F/4R
`TTCAGGCAATGTTTGTTA
`4F/4R
`SF/SIR
`AGTTTGTATGCAACATTTCTAA
`AGTTTGTATGCAACATTTCTAA
`SF/SIR
`SIF/SR
`GACCAATGGCTAAGTGAAGAT
`GACCAATGGCTAAGTGAAGAT
`5IF/5R
`6F/6R
`ATATGTTCTTAAATGGCTACG
`ATATGTTCTTAAATGGCTACG
`6F/6R
`7F/7R
`ACAGAATCCATATTTCGTGTA
`ACAGAATCCATATTTCGTGTA
`7F/7R
`TGCAAATGTTTAACATAGGTGA
`8F/8IR
`TGCAAATGTTTAACATAGGTGA
`8F/8IR
`8IF/8R
`AGTCTATGTGATCAAGAAATCGA
`AGTCTATGTGATCAAGAAATCGA
`8IF/8R
`9F2/9R2 AAGATGAGTCATATTTGTGGGT
`AAGATGAGTCATATTTGTGGGT
`9F2/9R2
`
`Reverse
`Reverse
`ATATGACCTAGCAACCTGACCA
`ATATGACCTAGCAACCTGACCA
`TACGGTAAGCCAAAAAATGA
`TACGGTAAGCCAAAAAATGA
`TTAATCGGTTTAGGAATACAA
`TTAATCGGTTTAGGAATACAA
`CTTTATGCAATACTTTTTCCTA
`CTTTATGCAATACTTTTTCCTA
`TTCCAGCTTTACAGTGAATTG
`TTCCAGCTTTACAGTGAATTG
`AGCAACTATCTTTAAAACCTGT
`AGCAACTATCTTTAAAACCTGT
`CTTTAGCCCAATGAGTTGA
`CTTTAGCCCAATGAGTTGA
`TAATGTCTCACCAATGCCA
`TAATGTCTCACCAATGCCA
`GTAAGTACTAGATATTCCTTGTC
`GTAAGTACTAGATATTCCTTGTC
`CGTAAACACTGCTTCGAAATA
`CGTAAACACTGCTTCGAAATA
`GACACAATGTCCTATTGCCAT
`GACACAATGTCCTATTGCCAT
`
`Annealing
`Annealing
`temperature (oC)
`temperature (°C)
`
`55
`55
`55
`55
`55
`55
`55
`55
`58
`58
`58
`58
`55
`55
`55
`55
`58
`58
`58
`58
`58
`58
`
`A 1 2 3 4
`A 1 234
`
`B
`B
`
`t
`
`G T ACT T A ACT T T A A CA A A A A A ~ T C T
`GT ACT TA ACT TT A A CA A A A A A~ TC T
`
`,
`
`J\l/V\i\1\/\/\/\
`
`GTACTTACTTTAACAAAAAATGATCT
`GTACTTACTTTAACAAAAAATGATCT
`
`Fig. I. Mutation analysis of the PTEN/MMACJ gene. A, Results of SSCP analysis. Lane I, GB8N; lane 2, GB8T; lane 3,
`Fig. I. Mutation analysis of the PTEN/MMACl gene. A, Results of SSCP analysis. Lane I, GB8N; lane 2, GB8T; lane 3,
`GB9T; lane 4, GBlOT. Extra-large migrating bands, indicated by arrows, were observed in lane 2 (GB8T, a tumor with GBM),
`GB9T; lane 4, GBlOT. Extra-large migrating bands, indicated by arrows, were observed in lane 2 (GB8T, a tumor with GBM),
`whereas no alterations were found in the corresponding normal tissue (in lane 1, GB8N). B, Nucleotide sequencing analysis of
`whereas no alterations were found in the corresponding normal tissue (in lane 1, GB8N). B, Nucleotide sequencing analysis of
`GB8T revealed a 1-bp insertion of A at codon 319 (indicated by an arrow in the upper row). The DNA sequence of the normal
`GB8T revealed a I-bp insertion of A at codon 319 (indicated by an arrow in the upper row). The DNA sequence of the normal
`allele of this patient is shown in the lower row.
`allele of this patient is shown in the lower row.
`
`1026
`1026
`
`NOVARTIS EXHIBIT 2062
`Breckenridge v. Novartis, IPR 2017-01592
`Page 2 of 4
`
`

`

`Infrequent Mutation of PTEN/MMACl in Various Primary Cancers
`Infrequent Mutation of PTEN/MMACJ in Various Primary Cancers
`
`Table III. Results of PCR-SSCP Screening
`Table III. Results of PCR-SSCP Screening
`Mutations detected
`Mutations detected
`ACT-AACT
`ACT~AACT
`5 bp Insertion/deletion
`5 bp Insertion/ deletion
`
`Case GB8 (GBM)
`Case GB8 (GBM)
`Polymorphism
`Polymorphism
`
`Location
`Location
`Exon 8 319
`Exon 8 319
`Intron 4
`Intron 4
`
`Type of aJteration
`Type of aJteration
`Frameshift
`Frameshift
`Ins: del~53%: 47%
`Ins: del~53% : 47%
`
`extra-large migrating bands were analyzed. We used a
`extra-large migrating bands were analyzed. We used a
`Thermo Sequenase dye terminator cycle sequencing pre(cid:173)
`Thermo Sequenase dye terminator cycle sequencing pre(cid:173)
`mix kit (Amersham, Little Chalfont, UK) and an "ABI
`mix kit (Amersham, Little Chalfont, UK) and an "ABI
`PRISM" 310 Genetic Analyzer (Perkin-Elmer, Foster
`PRISM" 310 Genetic Analyzer (Perkin-Elmer, Foster
`City, CA).1O·1l) The results are shown in Fig. 1B: a
`11 > The results are shown in Fig. lB: a
`City, CA). 10
`•
`frameshift mutation due to one base insertion of A at
`frameshift mutation due to one base insertion of A at
`codon 319 (ACT to AACT) was found. Nucleotide
`codon 319 (ACT to AACT) was found. Nucleotide
`sequences of both strands were determined to confirm the
`sequences of both strands were determined to confirm the
`results. This alteration generates a termination codon at
`results. This alteration generates a termination codon at
`IS- to 20-bp downstream (see Fig. I B). Other than this
`18- to 20-bp downstream ( see Fig. 1B). Other than this
`mutation, we only found one polymorphism: a 5 bp
`mutation, we only found one polymorphism: a 5 bp
`insertion/deletion polymorphism at 106- to llO-bp down(cid:173)
`insertion/deletion polymorphism at 106- to 110-bp down(cid:173)
`stream from the 5' end of intron 4. The results of our
`stream from the 5' end of intron 4. The results of our
`mutation search are summarized in Table Ill
`mutation search are summarized in Table III.
`We further analyzed LOHs in GBMs and astrocy(cid:173)
`We further analyzed LOHs in GBMs and astrocy(cid:173)
`tomas utilizing the insertion/deletion polymorphism in
`tomas utilizing the insertion/deletion polymorphism in
`the PTEN/MMACl gene. Primers used were 4IF (5'(cid:173)
`the PTEN/MMACJ gene. Primers used were 4IF (5'(cid:173)
`GAGTCATCCAGATTATCGAGA-3') and 4R (listed
`GAGTCATCCAGATTATCGAGA-3') and 4R (listed
`in Table II), and the sizes of the products were IOS/I03
`in Table II), and the sizes of the products were 108/103
`bp. Microsatellite markers at or near the PTEN/MMACl
`bp. Microsatellite markers at or near the PTEN/MMACJ
`locus, DIOS215, AFMaOS6wg9, and DIOS541, were also
`locus, DIOS215, AFMa086wg9, and DIOS541, were also
`used. Althongh incidences of heterozygosity of these
`used. Althongh incidences of heterozygosity of these
`markers were not high in our samples, four (50%) of
`markers were not high in our samples, four ( 50%) of
`eight GBMs showed LOHs at or near the PTEN /
`eight GB Ms showed LOHs at or near the PTEN I
`MMACJ locus, whereas only one ( 17%) of six astrocy(cid:173)
`MMACl locus, whereas only one (17%) of six astrocy(cid:173)
`tomas showed LOH (data not shown). Tumor GB8T
`tomas showed LOH (data not shown). Tumor GBST
`had a two-hit mutation: LOH was found in addition to
`had a two-hit mutation: LOH was found in addition to
`the somatic frameshift mutation of PTEN/MMACJ in
`the somatic frameshift mutation of PTEN/MMACl in
`this tumor.
`this tumor.
`Frequent mutations of the PTEN/MMACJ gene as
`Frequent mutations of the PTEN/MMACl gene as
`well as homozygous deletions have been reported in cell
`well as homozygous deletions have been reported in cell
`
`lines and xenografts of various tumors.'·'> Although the
`lines and xenografts of various tumors." 6) Although the
`number of tumors analyzed was not large, mutations in
`number of tumors analyzed was not large, mutations in
`this gene in primary tumors were also reported with the
`this gene in primary tumors were also reported with the
`frequencies of 16-17% in gliomas, 14% in breast can(cid:173)
`frequencies of 16-17% in gliomas, 14% in breast can(cid:173)
`6
`cers, and 17% in kidney cancers. 5
`) In the present study,
`
`cers, and 17% in kidney cancers. 5,6) In the present study,
`•
`we detected only one (9%) mutation in 11 GBMs and no
`we detected only one (9%) mutation in 11 GBMs and no
`mutations were detected in other tumors in our series of
`mutations were detected in other tumors in our series of
`Japanese cancer patients. There are several possible ex(cid:173)
`Japanese cancer patients. There are several possible ex(cid:173)
`planations of this observation: (I) there is a limitation of
`planations of this observation: (1) there is a limitation of
`sensitivity in using the PCR-SSCP method to detect
`sensitivity in using the PCR-SSCP method to detect
`mutations in the PTEN/MMACJ gene, (2) mutations of
`mutations in the PTEN/MMACl gene, (2) mutations of
`the PTEN/MMACJ gene do not play a major role in the
`the PTEN/MMACl gene do not playa major role in the
`cancer types we analyzed in Japanese patients, or (3)
`cancer types we analyzed in Japanese patients, or (3)
`mutations in the PTEN/MMACJ gene are more frequent
`mutations in the PTEN/MMACl gene are more frequent
`in cell lines and/or xenografted tumors than the primary
`in cell lines and/or xenografted tumors than the primary
`tumors. Since SSCP is a method with high sensitivity and
`tumors. Since SSCP is a method with high sensitivity and
`is used for detection of mutations in many genes, we
`is used for detection of mutations in many genes, we
`think that possibility 2 is more likely than possibility I.
`think that possibility 2 is more likely than possibility 1.
`Since we did not examine cell lines or xenografted tumors
`Since we did not examine cell lines or xenografted tumors
`derived from Japanese patients, we cannot exclude possi(cid:173)
`derived from Japanese patients, we cannot exclude possi(cid:173)
`bility 3. Further studies are necessary to understand the
`bility 3. Further studies are necessary to understand the
`role of the PTEN/MMACJ gene in human carcino(cid:173)
`role of the PTEN/MMACl gene in human carcino(cid:173)
`genesis.
`genesis.
`
`This work was supported by the Ministry of Education,
`This work was supported by the Ministry of Education,
`Science, Sports and Culture of Japan, the Vehicle Racing
`Science, Sports and Culture of Japan, the Vehicle Racing
`Commemorative Foundation, the Terumo Life Science Foun(cid:173)
`Commemorative Foundation, the Terumo Life Science Foun(cid:173)
`dation, and the Japanese Foundation for Multidisciplinary
`dation, and the Japanese Foundation for Multidisciplinary
`Treatment of Cancer.
`Treatment of Cancer.
`
`(Received June 25, 1997/Accepted September 2, 1997)
`(Received June 25. 1997/Accepted September 2, 1997)
`
`REFERENCES
`REFERENCES
`
`I) Walker, A. E., Robins, M. and Weinfeld, F. D. Epidemi(cid:173)
`l) Walker, A. E., Robins, M. and Weinfeld, F. D. Epidemi(cid:173)
`ology of brain tumors: the national survey of intracranial
`ology of brain tumors: the national survey of intracranial
`neoplasms. Neurology, 35,219-226 (1985).
`neoplasms. Neurology, 35, 219-226 (1985).
`2) Kuratsu, J. and Ushio, Y. Epidemiological study of pri(cid:173)
`2) Kuratsu, J. and Ushio, Y. Epidemiological study of pri(cid:173)
`mary intracranial tumors: a regional survey in Kumamoto
`mary intracranial tUmors: a regional survey in Kumamoto
`Prefecture in the southern part of Japan. J. Neurosurg., 84,
`Prefecture in the southern part of Japan. J. Neurosurg., 84,
`946-950 (1996).
`946-950 (1996).
`3) Ekstrand, A. J., James, C. D., Cavenee, W. K., Seliger, B.,
`3) Ekstrand, A. J., James, C. D., Cavenee, W. K., Seliger, B.,
`Pettersson, R. F. and Collins, V. P. Genes for epidermal
`Pettersson, R. F. and Collins, V. P. Genes for epidermal
`growth factor receptor, transforming growth factor a, and
`growth factor receptor, transforming growth factor a, and
`epidermal growth factor and their expression in human
`epidermal growth factor and their expression in human
`gliomas in vivo. Cancer Res., 51, 2164-2172 (1991).
`gliomas in vivo. Cancer Res .. 51,2164-2172 (1991).
`
`4) Louis, D. N. and Gusella, J. F. A tiger behind many
`4) Louis, D. N. and Gusella, J. F. A tiger behind many
`doors: multiple genetic pathways to malignant glioma.
`doors: multiple genetic pathways to malignant glioma.
`Trends Genet., 11, 412-415 (1995).
`Trends Genet., 11, 412-415 (1995).
`5) Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang,
`5) Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang,
`S. I., Puc, J., Miliaresis, C., Rdgers, L., Mccombie, R.,
`S. I., Puc, J., Miliaresis, C., Rdgers, L., Mccombie, R.,
`Bingner, S. H., Giovanella, B. C., Ittmann, M., Tycko, B.,
`Bingner, S. H., Giovanella, B. C., Ittmann, M., Tycko, B.,
`Hihshoosh, H., Wigler, M. H. and Parsons, R. PTEN, a
`Hibshoosh, H., Wigler, M. H. and Parsons, R. PTEN, a
`putative protein tyrosine phosphatase gene mutated in
`putative protein tyrosine phosphatase gene mutated in
`human brain, breast, and prostate cancer. Science, 275,
`human brain, breast, and prostate cancer. Science, 275,
`1943-1947 (1997).
`1943-1947 (1997).
`6) Steck, P. M., Perterhouse, M.A., Jasser, S. A., Yung, W.
`6) Steck, P. M., Perterhouse, M. A., Jasser, S. A., Yung, W.
`K. A., Lin, H., Ligon, A. H., Langford, L. A., Baumgard,
`K. A., Lin, H., Ligon, A. H., Langford, L. A., Baumgard,
`
`1027
`1027
`
`NOVARTIS EXHIBIT 2062
`Breckenridge v. Novartis, IPR 2017-01592
`Page 3 of 4
`
`

`

`Jpn. J. Cancer Res. 88, November 1997
`Jpn. J. Cancer Res. 88, November 1997
`
`M. L., Hattier, T., Davis, T., Frye, C., Hu, R., Swedlund,
`M. L., Hattier, T., Davis, T., Frye, C., Hu, R., Swedlund,
`B., Teng, D. H. F. and Tavigian, S. V. Identification of a
`B., Teng, D. H. F. and Tavigian, S. V. Identification of a
`candidate tumour suppressor gene, MMACJ, at chromo(cid:173)
`candidate tumour suppressor gene, MMAC1, at chromo(cid:173)
`some 10q23.3 that is mutated in multiple advanced can(cid:173)
`some lOq23.3 that is mutated in multiple advanced can(cid:173)
`cers. Nat. Genet., 15, 356-362 (1997).
`cers. Nat. Genet.. 15,356-362 (1997).
`7) Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F.,
`7) Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F.,
`Kasumi, F., Sakamoto, G. and Nakamura, Y. Allelotype
`Kasumi, F., Sakamoto, G. and Nakamura, Y. Allelotype
`of breast cancer: cumulative allele losses promote tumor
`of breast cancer: cumulative allele losses promote tumor
`progression in primary breast cancer. Cancer Res., 50,
`progression in primary breast cancer. Cancer Res., 50,
`7184-7189 (1990).
`7184-7189 (1990).
`8) Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K. Rapid
`8) Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K. Rapid
`and sensitive detection of point mutations and DNA poly-
`and sensitive detection of point mutations and DNA poly-
`
`morphisms using the polymerase chain reaction. Genomics.
`morphisms using the polymerase chain reaction. Genomics,
`5,874-879 (1989).
`5, 874-879 (1989).
`9) Mayama, T., Mori, T., Abe, K., Sasano, H., Nishihira, T.
`9) Mayama, T., Mori, T., Abe, K., Sasano, H., Nishihira, T.
`and Horii, A. Analysis of the p53 gene mutations in
`and Horii, A. Analysis of the p53 gene mutations in
`patients with multiple primary cancers of the esophagus.
`patients with multiple primary cancers of the esophagus.
`Eur. J. Surg. Oneal.. 23,298-303 (1997).
`Eur. J. Surg. Onco/., 23, 298-303 (1997).
`10) Hattori, M. and Sakaki, Y. Dideoxy sequencing method
`10) Hattori, M. and Sakaki, Y. Dideoxy sequencing method
`using denatured plasmid templates. Anal. Biochem., 152,
`using denatured plasmid templates. Anal. Biochem., 152,
`232-238 (1986).
`232-238 (1986).
`11) Sanger, F., Nicklen, S. and Coulson, A. R. DNA sequenc(cid:173)
`11) Sanger, F., Nicklen, S. and Coulson, A. R. DNA sequenc(cid:173)
`ing with chain-terminating inhibitors. Proc. Natl. Acad.
`ing with chain-terminating inhibitors. Proc. Natl. Acad.
`Sci. USA. 74,5463-5467 (1977).
`Sci. USA, 74, 5463-5467 (1977).
`
`1028
`1028
`
`NOVARTIS EXHIBIT 2062
`Breckenridge v. Novartis, IPR 2017-01592
`Page 4 of 4
`
`