`nuclear suspension was incubated at 3lrC for 30
`minutes, after which time IS j.1.1 ofDNase I (S .,.,;
`ml) in 10 mM CaC12 (S l't/ml) was added. After S
`minutes at 30°C, the reaction was made Ix SET
`(I percent sodium dod~yl sulfate (SOS), S mM
`EDTA, 10 mM tris-HCI, pH 1.<4), and proteinase
`K was added to a concentration of 200 l'i/ml.
`After incubation at 37"C for 4S minutes, the
`solution was extracted with an equal volume of a
`mixture of phenol and cblorofonn, and the inter(cid:173)
`phase was aaain extracted with 100 µ.I of Ix
`SET. Ammonium acetato (IOM) was added to
`the combined aqueous phases (orieinal plus
`reextraction) to a final concentration of 2.3M, an
`equal volume of isopropyl alcohol was added,
`and nucleic acid was precipitated (-70'C for IS
`minutes). The precipitate was centrifu&ed in a
`microccntrifu&e for 10 minutes, and the peUet
`was resuspended in 100 j.1.1 of TE (10 mM tris(cid:173)
`HCl, I mM EDTA) and centrifuged lhrou&h aG·
`SO (medium) spin column. The eluate was made
`0.2M in NaOH and after 10 minutes on iu,
`HEPES was added to a concentration or 0.24M.
`Two and one-half volumes of ethanol were then
`added, and the solution containing the precipi-
`
`tate held overoJ&ht at -20'C. After untrifuaa(cid:173)
`tion in a microcentrifuae for S minutes, the pellet
`was resuspended in hybridization buft'er, which
`consisted of [10 mM TES, pH 7.4, 0.2 percent
`SDS, 10 mM EDTA, 0.3M NaCl, IX Den(cid:173)
`bardt's, and EscMrichJa coll RNA (2SO l'&fml)].
`Nitrocellulose filters containing plasmid.ON A's
`were prepared with a Schleicher cl Schuell Slot
`Blot Apparatus under conditions sugested by S
`and S, except that wells were washed with !Ox
`SSC (saline sodium citrate). These filters were
`first hybridiied in the hybridization solution
`described above for a minimum of 2 hours at
`6S°C. After this preliminary hybridization, the
`filters were hybridized to the runotf products in
`hybridization solution for 36 hours. A typical
`reaction contained 2 ml of hybridization solution
`with I x 107 cpm/ml. After hybridization, filters
`were washed for I hour in 2x SSC at 6S°C. The
`filters were then incubated at 37"C in 2x SSC
`with RNase A (10 mafml) for 30 minutes and
`were subsequently washed in 2x SSC at 37"C
`for I hour. Alternatively, after hybridization the
`filters were washed tW!ce for IS minutes in 0.1
`percent SDS, 2X SSC at room temperature, and
`then washed at 60'C (0.1 percent SOS, 0.1 x
`
`SSC) for 30 minutes. Either protocol for proc(cid:173)
`essina of the filters after hybridization yielded
`the same specificity in sipal. Filten were then
`ex~sed to Kodak XAR film in cassettes con·
`tainina Li&hteniiia-Plus screens at - 70'C for
`various times.
`4S. C . Yanisch-Perron, J. Vierra, J. Messina, Gtnt
`33, 103 (198S).
`46. S. L. McKniaht, E . R. Gavis, R. Kinasbury, R.
`Axel, Ct/J 25, 38S (1981).
`47. M. Groudine and C. Casimir, Nucltlc Acids
`Rts. 12, 1427 (1984).
`48. We thank many of our coUeagues for discussion
`and su11,1estions during the course of this work;
`Hal Wemtraub, Paul Neiman, and Craia Thom{>·
`son for comments on the manuscript; Cnu&
`Thompson for assistance in obtainin& lympho(cid:173)
`cyte preparations; Bill Schubach for plasmid
`pBK2S; and Kay Shiozaki for assistance with
`the manuscript. Supported by NIH arants CA
`18282 {M.L .) and CA 28151 {M.L. and M.G.),
`and NSF arant PCM 82-04696 (M.G .), and a
`the Leukemia Society or
`scholanhi_p from
`America (M.G.)
`
`30 July 198S; accepted IS October 198S
`
`RHEARCH ARTICLE
`
`Tyrosine Kinase Recepto~ with Extensive
`Homology to EGF Receptor Shares
`Chromosomal Location with neu Oncogene
`
`Lisa Coussens, Teresa L. Yang-Feng, Yu-Cheng Liao
`Ellson Chen, Alane Gray, John McGrath, Peter H. Seeburg
`Towia A. Libermann, Joseph SchJessinger, Uta Francke
`Arthur Levinson, Axel Ullrich
`
`In contrast to v-erbB, which encodes a
`68,000-dalton truncated EGF receptor,
`the. neu oncogene product is a 185,000-
`dalton cell surface antigen that can be
`detected by cross-reaction with polyclo(cid:173)
`nal antibodies against EGF receptor (1 J);
`neu may itself be a structurally altered
`cell surface receptor with homology to
`the EGF receptor and binding specificity
`for an unidentified ligand.
`Using v-erbB as a screening probe, we
`isolated genomic and cDNA clones cod(cid:173)
`ing for an EGF receptor-related, but
`distinct, 138,000-dalton polypeptide hav(cid:173)
`ing all the structural features of a cell
`surface receptor molecule. On the basis
`of its structural homology' this putative
`receptor is a new member of the tyro(cid:173)
`sine-specific protein kinase family. It is
`encoded by a 4.8-kb messenger RNA
`(mRNA) that is widely expressed in nor(cid:173)
`mal and malignant tissues. We have lo(cid:173)
`calized the gene for this protein to q21 of
`chromosome 17, which is distihct fi:om
`the EGF receptor locus, but coincident
`with the neu oncogene mapping position
`(12). We therefore consider the possibili(cid:173)
`ty that we have isolated and character(cid:173)
`ized the normal human counterpart of
`the rat neu oncogene.
`Tyrosine kinase-type receptor gene and
`complementary DNA. As part of our at(cid:173)
`tempts to isolate and characterize the
`chromosomal gene coding for the human
`cellular homologue of the viral erbB gp68
`p0lypcptide, AEV-ES4 erbB sequences
`(2.5-kb Pvu II fragment of pAEV) (J 3)
`were used as a 32P-labeled hybridization
`probe for the screening of a human geno(cid:173)
`mic DNA library at reduced stringency
`
`!in (6), POOF (7), and insulin-like growth
`factor 1 (IGF-1) (8); hence more connec(cid:173)
`tions may be found between tyrosine
`kinase growth factor receptors and tyro(cid:173)
`sine kinase oncogene product$.
`Comparison of the complete primary
`structure of the human EGF receptor (9)
`with the sequence of the avian erythro(cid:173)
`blastosis virus (AEV) transforming gene,
`v-erbB (10), revealed close sequence
`similarity; in addition, there were amino
`and carboxyl terminal deletions that may
`reflect key structural changes in the gen(cid:173)
`eration of an oncogene from the gene for
`a normal growth factor receptor (3, 9).
`Another oncogene, termed neu, is also
`related to v-erbB and was originally
`identified by its activation in ethylnitro(cid:173)
`sourea-induced rat neuroblastomas (1 J).
`
`Growth factors and their receptors are
`involved in the regulation of cell prolif(cid:173)
`eration, and several recent findings sug(cid:173)
`gest that they also play a key role in
`oncogenesis (14). Of approximately 20
`identified oncogenes, the three that have
`been correlated with known cellular pro(cid:173)
`teins are each related to either a growth
`factor or a growth factor receptor. the B
`chain of platelet-derived growth factor
`(POOF) is encoded by the proto-onco(cid:173)
`gene c-sis (2), the erb-B oncogene prod(cid:173)
`uct gp68 is a truncated form of the epi·
`dermal growth factor (EGF) receptor (3),
`and the proto-oncogene c-fms may be
`related or identical to the receptor for
`macrophage colony-stimulating factor
`(CSF-tR) (4).
`The receptor-related oncogenes are
`members of a gene family in that each
`has tyrosine-specific protein kinase ac(cid:173)
`tivity, and is associated with the plasma
`membrane (5). Such features are also
`shared by several other polypeptide hor(cid:173)
`mone receptors, including those for insu-
`1132
`
`Usa Cousseos, Yu-Chena Liao, Ellson Chen, Alane Gray, Peter H . Seeburg, Arthur Levinson, and Axel
`Ullrich are in the Department of Molecular BiolOJY, Gencntech, Inc., 460 Point San Bruno Boulevard, South
`San Francisco, California 94080; John McGrath 1s currently with the Department of BiolO&Y, Massachusetts
`Institute of Techn9logy, Cambridee, Massachusetts 02142; Towia Libermann and Joseph Scblessin&er are in
`the Department of Cliemical Immunology at the Weizmann Institute of Science, Rehovot 76100, Israel; and
`Teresa L. Yang-Pena and Uta Francke are in the Department of Hu.man Genetics at Yale University School
`of Medicine, 333 Cedar Street, New Haven, Connecticut 06SIO.
`
`SCIENCE, VOL. 230
`
`1 of 8
`
`Celltrion, Inc., Exhibit 1043
`
`
`
`(14). Clone AC-erbB/1 was isolated; it
`contained a hybridizing 1.8-kb Barn HI
`fragment, which was subjected to DNA
`sequence analysis. The 1838-bp se(cid:173)
`quence contains three complete and one
`partial erbB-homologous exons separat(cid:173)
`ed by short intervening sequences (Fig.
`I). Comparison of this human gene se(cid:173)
`quence with our complete cDNA-de(cid:173)
`rived human EGF receptor protein se(cid:173)
`quence (9) revealed 32 differences (18.7
`percent) within the 171 amino acid
`stretch of combined exons, suggesting
`that this gene fragment was not derived
`from the human EGF receptor gene.
`Since this gene may code for an un(cid:173)
`known tyrosine kinase-type receptor
`that is closely related to the human EGF
`receptor, we named it HER2.
`Northern blot analysis (15) with the
`32P-labeled 1.8-kb HER2 fragment as a
`hybridization probe revealed a 4.8-kb
`mRNA in human term placenta poly(A)+
`RNA, distinct from the 5.8- and 10.5-kb
`EGF receptor mRNA's also present at
`high levels in this tissue (Fig. 2a, lane I).
`Thus, we had isolated a portion of an
`EGF receptor-erbB-related but distinct
`gene. To obtain its complete primary
`structure, two single-stranded synthetic
`oligonucleotide probes (16) were pre(cid:173)
`pared from HER2 exon sequence regions
`that differed sufficiently (less than 60
`percent nucleotide sequence homology)
`from EGF receptor DNA sequences
`(Fig. l, l and 2) and used to screen
`a term placenta complementary DNA
`(cDNA) library of 2 x 106 independent
`recombinant clones in AgtlO (17). Fifty(cid:173)
`two clones were isolated; they hybrid(cid:173)
`ized strongly with both synthetic probes
`and weakly with an EGF receptor cDNA
`fragment (HER64-3) (9) containing the
`homologous region within the tyrosine
`kinase domain. One of these, AHER2-
`436, had the longest cDNA insert (4.5
`kb), consisting of three Eco RI fragments
`(l.4, 1.5, and 1.6 kb).
`The complete cDNA sequence of this
`clone is shown in Fig. 3. The longest
`open reading frame starting with a me(cid:173)
`thionine codon codes for a 1255 amino
`acid polypeptide (137,828 daltons) and
`contains the 171 residues encoded by the
`four exons in the 1.8-kp HER2 gene Bam
`HI fragment (Fig. 1). This 3765-bp cod(cid:173)
`ing sequence is flanked by 150 bp of 5'
`untranslated sequence and a TGA stop
`codon, followed by a 627-nucleotide 3'
`untranslated sequence. No stop codon is
`found in the 5' untranslated region. In
`support of our assignment, however, the
`initiation codon at position 151 is flanked
`by sequences that follow perfectly Ko(cid:173)
`zak 's rule (18) for translation initiation.
`The 3' untranslated sequence contains a
`6 DECEMBER 1985
`
`potential poly(A) addition signal se(cid:173)
`quence (AATATA) 12 nucleotides up(cid:173)
`stream from a stretch of 15 adenylate
`residues. We are not certain if this (A)1s
`stretch is part of a poly(A) tail or repre(cid:173)
`sents an internal poly(A) stretch of a
`longer 3' untranslated sequence.
`
`those for EGF and insulin (9, 19). Such
`features are apparent in the hydropathy
`profile (20) comparison (Fig. 4a). On the
`basis of this comparison, and on amino
`acid sequence alignment with the EGF
`receptor (Fig. 4b, region 1), we predict a
`21 amino acid signal sequence (Fig. 4b,
`
`Abstract. A novel potential cell surface receptor of the tyrosine kinase gene family
`has been identified and characterized by molecular cloning. Its primary sequence is
`very similar to that of the human epidermal growth factor receptor and the v-erbB
`oncogene product; the chromosomal location of the gene for this protein is
`coincident with the neu oncogene, which suggests that the two genes may be
`identical.
`
`Comparison of EGF receptor and
`HER2 sequence. As already indicated by
`the v-erbB sequence homology used to
`isolate HER2, the putative HER2 pro(cid:173)
`tein is very similar in its overall domain
`organization and sequence to the EGF
`receptor. Nevertheless, there are differ(cid:173)
`ences that are likely to define a specific
`biological role for the HER2 polypep(cid:173)
`tide.
`The predicted HER2 polypeptide con(cid:173)
`tains each of the domain features found
`in hormone receptor precursors, such as
`
`1), an amino terminal serine residue, and
`a 632 amino acid putative extracellular
`ligand-binding domain; a highly hydro(cid:173)
`phobic, 22-amino acid transmembrane
`anchor domain separates the extracellu(cid:173)
`lar domain from a 580-residue-long car(cid:173)
`boxyl-terminal
`cytoplasmic domain,
`which possesses the highest homology to
`v-erbB and other members of the tyro(cid:173)
`sine kinase family.
`The 632-amino acid, putative HER2
`ligand binding domain is about 40 per(cid:173)
`cent homologous with the 621-residue
`
`~ys
`
`740 Glu
`Glu
`Ala
`769
`1 ~:~~~~~J~~~~~:~~~:~~!:M~:~~~=~:~~~~~~~~~~=:~~~~GTMGCCCCTCCACCCTCTCCTGCTAGG
`121 AGGACAGGMGGACCCCATGGCTGCAGGTCTGGGCTCTGGTCTCTCTTCATlGGGGmGGGGAGATATGACTCCCGCAAACCTAGACTATTTTTlTGGAGACGGAGCTTGCTCTGTCAC
`
`241 CCAGGCTGGAGTGCAGTGGCGTTATCTCGGCTCACTGCAACCTCCACCTCCTGGACTCAAGCGATTTTCATGCCTCAGGCTCCTGAGTAGCTGGGATTACAAGCGCCCGCTMTTTTTTT
`
`361 TTTTTTmGAGACAGAGTCTCGCTCTGTCACCCAGGCTAGAGTGMATGGTGCGGTCTCAGCTCAGCCTCCCAGGTTMAGCGATTmCTCCCTCAGTCTCCTGAGTAGCTGGGATTA
`
`<SI CAGGCGCGAGCCACCACGCCCGGCTMTmTGIAmTTAGTAGAGATGGGATTTCACCATGTTGGCCAGGTTGGTGTCAAACTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCAA
`
`601 AGTGCTGGGATTACAGGTGTGAGCCACGTGCCCGGCCTMTCTTTGTATTTlTAGTAGAGACAGGGTTTCACCATGTTGTCCAGGCTGGTAtmGAGCCTTCACAGGCTGTGGGCCATG
`
`110
`H1
`AspAsn
`Ser
`GluA l 1TyrVa llletA 1 oGl)'i1 lG lyS.rProTy
`721 GCIGTGGTTTGTGATGGTTGGGAGGCTGTGTGGTGTTTGGGGGTGTGTGGTCTCCCATACCCTCTCAGCGTACCCTTGTCCCCAGGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATA
`
`llt
`s Cys
`Ty
`H1Slf$ASpAsn Ile
`Tyr
`Phe
`rV 1 l Sf.rArgleultuGlyI l~ysltuThtSerThrVa lG lnleuV.1 ThrG lnl tuMet.ProT yrG l yCysltuleuA.spHt sYa lArgG luAsnArgG l yArgl.euG 1 ySerG lnAs
`841 TGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTGACACAGCITATGCCCTATGGCTGCCTCTTAGACCATGTCCGGGAMACCGCGGACGCCTGGGCTCCCAGGA
`
`831
`Val
`r
`pltule-uAsnTrpCysMetGlnJ ltAlatys
`961 CCTGCTGMCIGGTGTATGCAGATTGCCAAGGTATGCACCTGGGCTCTTTGCAGGTCTCTCCGGAGCMACCCCIATGTCCACAAGGGGCTAGGATGGGGACTCTTGCTGGGCATGT6GC
`
`~~t~~T yrteoG tu.Asp~~ ArgleuV• 1HhAf9AspleuA1aAlaAr9AsnV1 I LeuYa l Lys~~
`1081 CAGGCCCAGGCCCTCCCAGAAGGTCTACATGGGTGCTTCCCATTCCAGGGGATGAGCTACCTGGAGGATGTGCGGCTCGTACACAGGGAmGGCCGCTCGGAACGTGCTGGTCMGAGT
`1-!(i)
`1-CCGT::Cf-G-G=t-C=t
`
`Glu
`lys
`GlyAlaGlu
`lys
`883
`Gin
`ProAs.nH h V.1LYt1 I e ThrAspPhe<i l)'leuAl1ArgleuLeuAspJ ltAspG 1ulhrG1uTyrHisA1 a.AspG l)G lylys
`1201 CCCAACCATGTCAAAATTACAGACTTCGGGCTGGC~CATTGAC~CAGAGTACCATGCAGATGGGGGCAAGGTTAGGTGMGGACCMGGAGCAGAGGAGGCTGGGT
`H; __ TGC!j-=A.,J@
`
`884
`V.1ProJ lel.yslr"pHetA hleuGluSerl le-Lev
`1321 GGAGTGGTGTCTAGCCCATGGGAGAACTCTGAGTGGCCACTCCCACAACACACAGTTGGAGGACTTCCTCTTCTGCCCTCCCCAGTGCCCATCAAGTGGATGGCGCTGGAGTCCATTCTC
`
`lltlyr
`910
`H1s
`1441 ~~~~~~c~~~srr~m~~~~~rr~m~TGATGGGGGGTGTTGGGAGGGGTGGGTGAGGAGCCATGGCTGGAGGGAGGATGAGAGCTGGGATGGGGAGAATTA
`1561 CGGGGCCACCTCAGCATGTGAAGGGAGGGMGGGGCTGCCTGTGCCCCACCTTGCAGGGTCTGTGCACTTCCCAGGATTA£GGAAA6ACCGGGTAGGGTCTGTCTCCTGGCATCACATCT
`
`1681 CCCCCIGCTACCTGCCATGATGCTAGACTCCTGAGCAGAACCTCTGGCTCAGTACACTMAGCTCCCTCTGGCCCTCCCACTCCTGACCCTGTCTCTGCCTTAGGTGTGACTGTGTGGGA
`
`1801 GCTGATGACTTTTGGGGCCAMCCTTACGATGGGATCC
`
`Fig. I. Partial sequence of the HER2 gene. A partial Hae III-Alu I genomic library (14) of human
`fetal DNA in ~ Charon 4A was screened using a radiolabeled 2.5-kb Pvu II fragment of pAEV
`(13) containing coding sequences for the tyrosine kinase domain. Hybridization was as
`described elsewhere (3/), except that 30 percent formamide was used at 42°C. Three
`independent clones were isolated which shared a 1.8-kb hybridizing Barn HI fragment. This
`fragment and subsets thereof were isolated, subcloned into M13mpl0 and M13mpll, and
`sequenced (32). The intron-exon organization was determined by comparison with v-erbB
`sequences (JO). Amino acid numbering is based on the complete cDNA sequence shown in Fig.
`3. Nucleotide sequence differences with the human EGF receptor sequence are shown in the
`regions that were used for the design of synthetic oligonucJeotide probes I (30 nucleotides) and
`2 (21 nucleotides). Amino acid sequence differences with the EGF receptor are shown above the
`HER2 sequence.
`
`1133
`
`2 of 8
`
`Celltrion, Inc., Exhibit 1043
`
`
`
`extracellular EGF binding domain of the
`EGF receptor. This homology includes
`two cysteine-rich subdomains of 26 and
`21 regularly organized cysteine residues
`(Figs. 4a and 2c, subdomains 2 and 3), all
`of which are conserved in the EGF re(cid:173)
`ceptor. The cysteine residue spacing in
`this region is also homologous with the
`single cysteine-rich domain in the insulin
`receptor a subunit (19). In contrast,
`HER2 contains only eight potential N(cid:173)
`linked glycosylation target sites (Asn-X(cid:173)
`Thr or Ser) as compared to 12 in the
`corresponding region of the EGF recep(cid:173)
`tor. Only five of these are conserved
`with respect to their relative position in
`cacti polypeptide.
`The hydrophobic, putative membrane
`anchor sequence located between resi(cid:173)
`dues 653 and 676 (Fig. 4b, region 4) is
`flanked at its carboxyl terminus by a
`stretch of amino acids of predominantly
`basic character (KRRQQKIRKYTMRR)
`(21), as is found in the EGF receptor
`sequence (9) (Fig. 4b, region 5). This
`region of the EGF receptor contains
`Thr654, which plays a key role in protein
`kinase C-mediated receptor modulation
`(22). A homologous threonine residue is
`embedded in a basic environment in the
`HER2 sequence at position 685 (Fig. 4, a
`and b).
`The region of most extensive homolo(cid:173)
`gy (78.4 percent) between EGF receptor
`and HER2 (beginning at residue 687)
`extends over 343 amino acids and in(cid:173)
`cludes sequences specifying the adeno(cid:173)
`sine triphosphate (ATP) binding domain
`(23) and tyrosine kinase activity (Fig. 4b,
`region 6) (5). This region is also the most
`conserved between v-erbB and EGF re(cid:173)
`ceptor (95 percent) (9). The collinear
`homology between the EGF receptor(cid:173)
`erbB and HER2 ceases at position 1032,
`but introduction of gaps into the EGF
`receptor or HER2 sequences reveals
`continued, although decreased, related(cid:173)
`ness (Fig. 4b, region 7). This sequence
`alignment suggests that the two genes
`evolved by duplication of an ancestral
`receptor gene, and that subsequent nu(cid:173)
`cleotide sequence divergence in this car(cid:173)
`boxyl terminal domain led to diverged
`biological roles for the encoded polypep(cid:173)
`tides.
`terminal domain of
`The carboxyl
`HER2 is characterized by an unusually
`high proline content (18 percent) and
`predominant hydrophilicity (Fig. 4a).
`These general features are also found in
`the EGF receptor carboxyl terminal do(cid:173)
`main with a 10 percent proline content.
`The sequences in this region that are
`found to be conserved are almost exclu(cid:173)
`sively centered around five tyrosine resi(cid:173)
`dues, which include the major (Tyr1173)
`1134
`
`, Tyr1068) in vitro
`
`and two minor (Tyr1148
`autophosphorylation sites in the human
`EGF receptor (24) (Fig. 4, a and b).
`Three of these tyrosine residues of
`HER2 (positions 1139, 1196, 1248) are
`flanked by homologous
`sequences
`PQPEYV, ENPEYL, and ENPEYL .
`(21), respectively (Fig. 4b, region 7).
`HER2 chromosomal location. In situ
`hybridization of two 3H-labeled HER2
`probes (legend, Fig. 5a) to human chro(cid:173)
`mosomes resulted in specific labeling at
`bands ql2--+q22 of chromosome 17 (Fig.
`5a). Metaphase cells (100) were analyzed
`for each probe; 40 percent of cells scored
`for HER2 probe l (HER2-1) had silver
`grains over 17q12--+q22 (Fig. 5b). Of the
`209 grains observed, 42 (20 percent)
`were found at this specific region, with
`no other site labeled above background.
`For HER2 probe 2, 36 percent of cells
`had silver grains over the ql2--+q22
`bands of chromosome 17. Of all silver
`grains, 17 percent ( 42/246) were localized
`to this chromosomal region. A second(cid:173)
`ary site of hybridization with 3 .3 percent
`(8/246) of silver grains was detected at
`bands p13--+ql 1.2 of chromosome 7.
`To test whether this secondary site
`represented cross-hybridization with the
`EGF receptor gene, in situ hybridization
`was carried out with 3H-labeled EGF
`
`a 12 345 6 b
`
`l23 4 567
`
`Fig. 2. Northern blot hybridization analysis of
`normal and malignant human tissues. (a) Fetal
`tissues; (lane 1) term placenta, (lane 2) 20-
`week placenta, (lane 3) 20-week liver, (lane 4)
`20-week kidney, (lane 5) 20-week lung, (lane
`6) 20-week brain. (b) Embryonic tumors; (lane
`I) hepatoblastoma, (lanes 2 and 3) Ewing
`sarcoma, (lane 4) rhabdomyosarcoma, (lanes
`S and 6) neuroblastoma, (lane 7) Wilms • tu(cid:173)
`mor. Total poly(Ar RNA was isolated as
`described (JJ); 4 µg per lane was analyzed on
`a 1 percent formaldehyde-agarose gel. 32P(cid:173)
`Labeled HER2-1 and HER-2 (legend to Fig. 5)
`were used as hybridization probes under high
`stringency conditions (50 percent formamide,
`Sx Denhardt's solution, Sx standard saline
`citrate (SSC), sonicated salmon sperm DNA
`(SO µg/ml), SO µ.M sodium phosphate buffer
`(pH 6.8), I mM sodium pyrophosphate, and
`10 µM ATP at 42°C for 16 hours; filters were
`washed three times for 15 minutes at 45°C
`with 0.2x SSC]. The filters were exposed at
`-60°C with a Cronex Lightning Plus intensi(cid:173)
`fying screen (Dupont) for 7 days. Rat ribo(cid:173)
`somal RNA's were used as size standards
`(28S, 4.8 kb; 18S, 1.8 kb). RNA sizes are
`given in kilobases.
`
`receptor subclone 64-3. Of 100 cells ex(cid:173)
`amined, 30 had silver grains at bands
`pl3--+ql 1.2 of chromosome 7 and 3 per(cid:173)
`cent (5/166) of total grains were found
`over q12--+q22 of chromosome 17. With
`the other variant probe (HER2-1) no
`grain accumulation was observed at the
`EGF receptor site on chromosome 7.
`Southern blot analysis (25) of DNA
`extracted from nine somatic cell hybrids
`from human and rodent cells confirmed
`the localization of HER2 sequences to
`chromosome 17. 32P-labeled HER2-1
`and HER2-2 probes were hybridi.zed to
`the same set of Eco RI-digested DNA
`samples. With HER2-1, a 13-kb hybrid(cid:173)
`izing band was detected in human DNA
`(Fig. 5c, lane 1) and in DNA samples
`from hybrids containing human chromo(cid:173)
`some 17 (Fig. 5c, lanes 6, 8, 10, and 12).
`Likewise, hybridization of HER2-2 to a
`6.6-kb DNA fragment was observed in
`human control DNA (Fig. 5c, lane 1) and
`in hybrids containing human chromo(cid:173)
`some 17 (Fig. 5c, lanes 6, 8, 10, and 12).
`Chromosome 17 was the only chromo(cid:173)
`some with perfect concordant segrega(cid:173)
`tion; all other chromosomes were ex(cid:173)
`cluded by two or more discordant hy(cid:173)
`brids.
`Regional localization to chromosome
`17 was also confirmed by Southern blot
`analysis. In a mouse-human hybrid con(cid:173)
`taining a rearranged human chromo(cid:173)
`some 17 with region l7q21--+qter, the
`human HER2 restriction fragments were
`detected (Fig. 5c, lane 4). The HER2
`gene was therefore localized to region
`17q21--+qter, in agreement with the local(cid:173)
`ization made by in situ hybridization.
`Even though a low level of hybridiza(cid:173)
`tion with probe HER2-2 was seen at the
`site of the EGF receptor gene on chro(cid:173)
`mosome 7, we were able to show that
`this finding represented cross-hybrid(cid:173)
`ization. In a control experiment an
`EGF receptor probe cross-hybridized to
`the same extent with the HER2 site on
`17q.
`Taken together, the results of the in
`situ and Southern blot hybridizations
`permit the site of the HER2 sequences to
`be further narrowed down to bands
`17q21-q22, with the major peak of silver
`grains at band 17q21.
`HER2 expression in normal and malig·
`nant tissues. To obtain further clues re(cid:173)
`garding the function of this receptor both
`in normal cells and in neoplasms, North(cid:173)
`ern hybridization analyses (15) were car(cid:173)
`ried out with several normal human tis(cid:173)
`sues and randomly collected tumors. A
`hybridizing 4.8-kb mRNA was detected
`in all human fetal tissues analyzed, in(cid:173)
`cluding term placenta, 20-week placenta,
`liver, kidney, lung, and brain obtained
`
`SCIENCE. VOL. 230
`
`3 of 8
`
`Celltrion, Inc., Exhibit 1043
`
`
`
`1051
`
`1201
`
`1351
`
`1501
`
`1651
`
`1~1
`
`1951
`
`2101
`
`leuThr
`CTGACGT
`
`d
`
`MTTCTCSAGCTC6TCGACC6GTCGACGAGCTCWGGTC6AC&MiCTC&A66GCGC6CGCCC6GCCCCCACCCCTCGCAGCACCCCGCGCCCCGCGCCCTCCCAGCC666TCCMICC6GMlCCAT&GG6C~C6CACTCMCACC
`1
`10
`20
`30
`40
`50
`Met6 luleuA lM 1 aleu
`Trp61yLeuleuleuA1aleuleuProPro61yA1M1 aSer Thr&l nV a 1.
`ThrGlyThrAs!JlletlysleuArgl.euProA 1 &Serl'ro61 uThrH1 sleuA.spMetl~t sltuTyr
`151 AT66AliCTli&C6GCCTTS
`""'6CTCCTCCTC6CCCTCTTGCCCCCC$&AGCC6C6AGCACCCMGT61iACCG6CACAGACAT&M&CT6C66CTCCCT6CCASTC™CACCT6&ACAT6CTca;ccACCTCTM:
`~
`~
`~
`61n61~1nYa1Ya161n611Mnleu61uleuThrTyrll\IProThr
`euSer""-leu61nAspll~ln61uVa16ln6lyTyrValltulleAlaHlsAsll61nYalA1'96lnY1lProl~~tuArt
`a
`301 ~T66T6CAG66MACCTGGMCTCACCTACCTGCCCACCAATGCCAGCCT6TCCTTCCTGCA66ATATCCA&&A66T6CA666CTAC6TGCTCATCGCTCACAACCMGT&AS6CA66TCCCACT
`TQCQI
`110
`120
`130
`140
`150
`11eVa1 Arg61 yThrGl nleuPtte61 uAspAsn TyrA 1aleuA1aVa1 leuAspAsn61yA spProleUAsnAsn TllrThrProVa l Thr&lyA 11SerPl'o6 ly6lyLtuArg6l ultu61nleuArgSerleuThr61uJ1 eltul.11
`451 ATT6TGCliA&&CACCCA6CTCm6Mi&ACAACTATGCCCT6GCC6T6CTAGACMT66AGACCCGCTGMCMTACCACCCCT6TCACAGGGGCCTCCCCAGGA6GCCT6C666AGCT6CAGCTTCGMGCCTCACNMATCTT&MA
`160
`170
`l~
`200
`-1~
`6ly6lyY1lll\IJle6lnArgAsnPl'oGlnleu.TyrGlnAspThrlleleuTrplysAspllePheHlsLysAsnAsn6lnleuAlaleuThrleulleAspThrAsnArgSer=~~~tlmlft
`601 &GAG666TCTT6ATCCAGCGGMCCCCCAGCTC91TACCAGGACAC6ATTTT6TGGMGGACATCTTCCACA'l6,t'CAACCAGCT66CTCTCACACT6ATA&ACACCAACCCCTCT
`CCCJmTCTCC8AT69M;
`210
`220
`230
`240
`.
`250
`6lySerArglSrrp&ly61uSerSer61uAsc>mGlnSerll\IThrArgThrVa lllA la61y&l1'1A 1MrdllY$6lyProll\IPl'oThrAS!lllaus&lu61'9AlM la61 . • nwnyl'rolysHlsSer
`751 66CTCCCGC91T66'&AGAGA&TTCTGAGGA'19CAGA6CCT6ACGC6CACT6TC9CC6GT6'(9CCCGC . . •6666CCACTGCCCACT~T~CT
`270
`--26IL_
`280
`290
`JOO
`,Asollt.euA1.mLeuHts~61yJ1.61ull\IHts9roo\lal.euVa1ThrTyrAsnThrAspThrl'lleGluSertletProAsnPro61u61yArgT11"Thrl'he61yAlas.9Vall'llrA1 . . m
`901 6At9CT66CC9TCCACTTCAACCAr.N.TGGCATC9GAGCTliCACSCAGCCCT66TCACCTACMCACAGAC.AC6m6A6TCCATGCCCMTCCC6A66GCCG6TATACATT~~
`310
`320
`330
`340
`lSO
`TyrAsnTyrleuSerThrAspVa 161ySer9fhrleuVa 1.
`Pl'oleuHtsAsn61n61uYa 1ThrA la61uAsp61yThr61nArg·l~lnLL.rsProli4hArgYa 11Sryr&lyL"61Jfltt61uH1sltu
`TACAACTACcmCTACSGACGT66GATCC9ACCCTC&TCSCCCT~"6ASGT6ACAGCA6AG6A1li6MCACAGC66~CC9CCCGAG'f611TAT66TCT6"CA~
`360
`370
`380
`390
`400
`A1'961uVa1ArgA1aVa1ThrSerAlaAsnlltiln61uPW1a61&ysLystlePtte61ySerleuAlaPMl.euPro61uSerl'tleAsp61Jl\.spl'roA1&SerAsnThrAlaProl"61nPro61u61nleu61nYall'lle
`CGMiAGGTGA66GCMiTTACCA6TGCCMTATCCA66A6mGCTGGC9'16,t'16,tTCTTT666AliCCTGGCAmCTGCCG6A6AGCTTT6AT6666ACCCAGCCTCCAACACTGCCCCCCTCCAGCCA6ASCA&CTCCAA6TQm
`410
`420
`430
`440
`450
`61uThrleuG1u61u1 leThrGl yT yrleu Tyr I le Ser A 1 a TrpProAspSerleuProAspleuSerYa I Ph~ I nAsnleu61 nV a I J leArg6 lyArg I lell\IH I sAsn61yA 1 a T yrSerll\I Thrleu61 n61 yLluG lyJ le
`GA6ACTCT6GM6AGATCACA>TACCTATACATCTCAGCAT6GCC66ACAGCCTGCCT6ACCTCAGCGTCTTCCAGMCCTGCMGTMTCC61i66ACGMTTCTGCACMT6'CGCCTACTCGCT6ACC~lt
`460
`470
`490
`500
`~
`SerTrplt\16lyLeuArgSerLeuArg61uleu61ySerc:lyLeuAlal.eu!leHfsHtsAsnThrHtsl . . . PheV•IH1sThrVa1ProTrpAsp61nleuPheArgAsnPl"ollts61nAlal.euleuHtsThrA11AsnAraPro
`AGCT6'CTGGGGCTGC6CTCACTWGGMCTG66CAST66ACT6'CCCTCATCCACCATAACACCCACCTcmncsT&CACAC6&T6CCCT666ACCAGCTCTTTC66AACCCGCACCMGCTCTGCTCCACACT6CCAACC&CCCA
`520 ~ •
`510
`550
`1nPhel.tuArg61y61n61~a161u61~a1Llu61MllyLeu
`GluAsp6lumva1sly61u61yLeuA1Alts61nL..61-"1'9ArgAlaleultu61ySer61yProThr61 . . Yal
`WWW9f666CC'66ECCT66CC9ACCAGCT~CCGCA666CACT6CT666ETCA66GCCCACCCMi9T
`TTCCTTC6666CC!\6&' - ~ACT$CMll66Clt
`.
`560
`57~
`~
`590
`ProArgGluTyrV11AsnAl=•ri~fsPro61-~nl'ro61l;s;;:val~lyPrG&luAlaAsp61,.V1lAl~l1HtsT11"1.ysAsi>ProPr~alAl
`CCCA6611iA6TAT6TliMTGC
`GCC~&'S9AGCCCCAGMT66CTCA6TGAC~GACcA69T66Cc9cCCACTATMGGACCCTCCCTT
`T8EC
`610
`620 ~ 640
`650
`Hfs~Va1Aspl.euAspAsply$~.A~1~1nArgAl&Serl'ro
`ProSar61yYallysProAspleuSerTyrttetPro!leTrpLysPheProAsp61u61u61yA1am&lnl'ro9rotl
`CCCA6C66T6T6AAACCT6ACCTCTCCTACATGCCCATCT66MEmCCAGAT6AGGA666CGCAllCAGCCTSCCAT
`TC'9:t:G6AT6ACA'~CCMCCCT
`690
`690
`700
`1eWa1SerAlaVa1Va1Ely!leleuleuValV11Valleu61yYa1ValPtte6lyllft.eul1
`ArgArg61n61nlysJ11Ar9l1:STyr
`rtletArgArgleuleu61n61uThr61uleuYa1Elul'roleu
`TC6TCTCT&C66T66TT66CATTCTGCT66TCET66TtTT66E66T66TCTTT66GATCCTCAT
`C&6CMiCA6> 16'TCCEEMETACACGATGCEEA6ACTGCT6CAE6AMC66A6Tii6AGCC8CT6
`710
`720
`730
`740
`750
`ThrProSer61yA1aMttProAsn61nA1 a61nMetArgl1 eleuLys61u ThrGluleuArgt.ys Va 1LysVa1 leuG lySet"GlJI\ laPheGlyThrVa 1 TyrlY$61yl le Trp J l eProAsp61y61uAsnVa1lysJleProVa1
`ACACCTAGC66AGCGATGCCCAACCAGGCGCAGAT6C66ATCCT6AMSAGAC66A6CTGAE6M66TGM6ETGCTT66ATCT6'CGCTTTT66CACAGTCTACAA66ECATCT66ATCCCTGAT6666A&MT6TGMMTTCCAET6
`~ no
`eoo
`780
`790
`AlallelysV11leuArg61~Pl'olysA1aAsnlys61ulleleuAsp61uA11TyrV11MetAla61yVa161ySerPl'oTyrValSerArgleuleuGlyJ1 . . . euThrSerThrVa16lnleuVa1Thr61nleu
`6CCATCMA6T6TTGAG66'.J•~TCCCCCAMGCCAACA1 '6'1'TCTTA6ACGMGCATACST6AT6'CTG6T6TGEGCTCCCCATAT6TCTCCCGCCTTCT666CATC9;T&ACATCCAC66TGCAGCT66'T6ACACM1CTT
`6
`810
`830
`840
`850
`IWtPro l11"6IY9.euLeuAspH Is Ya IA1'96l uASftAr96 lyArgleu61ySer61 nAspleuleuAsn T~t61nIleA1 llys6 lJflttSerTyrleu61uAspVa1 ArQleuVa I Hi sArgAspleuA l IA 1 MrgAsn
`AT6CCCTAT66CSfCTT"6ACCATGTCC666ol•••CCGC66ACGCCT66GCTCCCAEEACCT6CTGAACT6'9ATGCAGATT6CCAM!,666ATGA&CTACCT&EMiEAT6TGCE6cTCET~CliCTCEEMC
`880 Li
`860
`810
`890
`toO
`Va lleuVa 1L~ProAsnH1 sVa lLys I leThrAspl'lleElyLeuA 1-"f'9lelll.euAspI leAsp61uThr61uTyrHt sAl aAsp61y61YLY$Ya 1mJ lelysT,,_tA 1 aleu&l uSer I lel~TIW
`GT6CT66TCMEAGTCCCAACCAT6TCAMATTACAGACTTC66GCT6GCTC66CTGCT66ACATTGAC6A6ACAGA6TACCATGCAGATQGIXSCMEGT6CCCATCMGTG6AT66C6CT""6TCCATT~CACC
`6
`910
`920
`930
`940
`KO
`Hls61nSerAspVa1TrpSerTyrGlyVa1ThrValTrp6luleulletWlyA11L,ysProTyrAsp6lylleProAl~luJleProAspl.eullu6luLys6ly6~leuPro6lnProl'roll.-nirt1eAsp
`CACCA6ASTSAT6T6T66AETTAT66T6T6ACT6T6T666AlieT6AT6ACTTTT6666CCAMCCTTACGAT66GATCCCAGCCC6iiSA6ATCCCTSACCTGC~•••&eGGG~CCCAGCCCCCCAfC9CtATTGAT
`6
`970
`980
`990
`1000
`ValTyrtletJlffletValLysmr,,...t1leAspSer6l~luleuV11Ser61uPheSerArglletA11ArgAspPro61nArgPheVa1Vallle61nAsn61uAsplMl~l&Serl'roleu
`6TCTACAT6ATCATG6TCAM9f66AT6ATT6ACTCT~CAMiATTCC6&SA6TT66T6TCTEAATTCTCCC&CAT66CCA&66ACCCCCAGCGCTTT6T6ETCATCCAGMT6AGGACTT966CCCAGCCAETCCCTTI
`1010
`1020
`1030
`1040
`10IO
`Asp Ser ThrPheT yrArgSerleuleuG 1 uAspAspAspMet61yAspleuVa IAspA la61u61uTyrleuVa1 Pro61 n61n6lyf'hePhdmProAspProAl1Pro6IJI\ 1 e61y61""l Ya 1 Ht sHt sArtH I sArt$erSer
`6ACA6CACCTTCTACC6CTCACTGCT66A66ACGATGACAT66GG6ACCT66TG6ATGCT6AGGAGTATCT66TACCCCAGCAG66CTTCTT<9CA6ACCCTGCCCCGEECGCT6666GCATGGTCCAC~
`1060
`1070
`1080
`1090
`1100
`SerThrAr9Ser61y61y61yAspleuThrleuSlyLeu61uProSer61u61u61uAlaProArgSerProleuAlal'roSer61u61)'1\la61ySerAspVall'lleAsp61yAspl.eu61Jfltt61yA11Alal.ys61yLeu61nSer
`TCTACCA66A6T66CE6T&SGGACCTSACACTA66GCT66A6CCCTCT6MGA66A66CCCC~TCTCCACT6GCACCCTCC6AA666GCT6'CTCC6AT6TAm6ATGGT6ACCT66GAAT6666GCMiCCAAGGGGCTGCAAAGC·
`lllO
`1120
`. 1130
`1140
`1150
`leuPn> ThrH I sAspProSerPl'oleu6 I nArg TyrSerG luAspPro ThrVa 1 ProleuProSerG I uThrAsp6lyTyrVa1A1 aProleu Th.ProEl nPro61uT11"Va1 Asn61nPToAspVa1 ArgPro61nl'rol'ro
`CTCCCCACACA TGACCCCA6CCCTCTACA6C66TACA6TSA66AC(CCACA6TACCCCTGCCCTCTGA6ACT6A T6GCTAC6TTGCCCCCCTGACC96CCCCCAGCCTWTATSTSAACCAGCCA&AT6TTCGGCCCCAGCCCCCT
`uoo
`1160
`1170
`u~
`11~
`Serl'roArg61u61yProleul'roA11A1-"f'9ProAla611'\1aThrleu6111ArgAlal.ysThrltuSerPro61YLysAsn61yVa1YalL.ysAspYa1PheA11Phe6ly6lyAlaValGluAsnPro6lwTyrleu~h1
`TCGCCCC6A&AG6GCCCTCTGCCT6CTGCCC6ACCT6CT66TGCCACTCTWWWCMGACTCTCTCCCCA6GUVJAT666ETCETCMA6ACETTTTT6CCTTTiiGGGGT6CC6T66MiAACCCACTTWACCCtAG
`lZlO
`1220
`1230
`1240
`1250
`V
`&ly61)'1\laA1aPl'o61nProHts~laPheSerl'roAlaPheAspAsnleuTyrTyrTl"pAsp61nAspProPro6111Ar961"'1aProl'roSerThrPhelys61yThrPn>ThrAl a61uAs11Pro6luTyrleuGly
`GGA&GAGCT6CCCCTCAGCCCCACCCTCCTCCTGCCTTCAGCCCA6CCTTCGACAACCTCTATTACTGGSACCA66ACCCACCAEA6Cli0066GCTCCACCCAGCACCTT"*'WWWCTAC6GCAEA6o''ICCCA&AGTACCTS85T
`1255
`leuAspVa I ProVa lEllO
`CT66ACGTGCCA6T6TWCCAG/''6GCCMGTCCGCA&MGCCCTGAT6T6TCCTCA666AECAGEGl'~6GCCT6ACTTCTGCT6GCATCMGA66TWCCTCC6ACCACTTCCA66GSAACCT6CCATGCCA68MCCTltTC
`CTMEGMCCTTCCTTCCT6CTT6A6TTCCCA6AT66CT66AAGG6ETCCAGCCTCGTTW'\6AE6'1CA6CACT66G6A6TCm6T66ATTCT6A6GCCCTGCCCMTGAGACTCTA666TCCA6T66ATGCCACAGCCCAGCTT811
`cccmcCTTCCA6ATCCT666TACTGMAGCCTTAE66AAGCT6'CC~6666A"6C6'CCCTMG66AET6TCTA'\6,t*CA••AGCGACCCATTCA6AGACTGTCCCTGAMCCTA6TACTGCCCCCCATSAWt,SGA•CNJU.
`ATGGT6TCA6TATCCA6GCm6TACA6A