AmpUftcation of a Novel v~rbB-Related Gene In a
`Human Mammary Carcinoma
`
`Abstract. The cellular gene encoding the receptor for epidermal growth factor
`(EGF) has considerable homology to the oncogene of avian erythroblastosis virus. In
`a human mammary carcinoma, a DNA sequence was identified that is related to v(cid:173)
`erbB but amplified in a manner that appeared to distinguish it from the gene for the
`EGF receptor. Molecular cloning of this DNA segment and nucleotide sequence
`analysis revealed the presence of two putative exons in a DNA segment whose
`predicted amino acid sequence was closely related to, but different from, the
`co"esponding sequence of the erbBIEGF receptor. Moreover, this DNA segment
`identified a 5-kilobase transcript distinct from the transcripts of the EGF receptor
`gene. Thus, a new member of the tyrosine kinase proto-oncogene family has been
`identified on the basis of its amplification in a human mammary carcinoma.
`
`C. RICHTER ICING
`MATTHIAS H. KaAvs
`STVAJtT A. AARONSON
`Laboratory of Cellular and
`Molecular Biology,
`National Cancer Institute,
`Bethesda, Maryland 20205
`
`The oncogenes of the acute transform(cid:173)
`ing retroviruses have counterparts, des(cid:173)
`ignated proto-oncogenes, that arc con(cid:173)
`served within the human genome (1).
`The human sis prot<K>ncogenc encodes
`one major polypeptide chain of platclct(cid:173)
`dcrivcd growth factor (POOF) (2), and
`the erbB prot<K>ncogcnc appears to en(cid:173)
`code the receptor for epidermal growth
`factor (EGF) (3). A number of other
`proto-oncogenes, like erbB, share nucle(cid:173)
`otide sequence homology with the tyro(cid:173)
`sine kinase-encoding src gene (4). The
`fact that cellular receptors for several
`growth factors or hormones, including
`the EGF receptor, possess this enzymat(cid:173)
`ic activity suggests that other prot<K>n(cid:173)
`cogcnes may encode growth factor re(cid:173)
`ceptors as well.
`Genetic alterations affecting prot<K>n(cid:173)
`cogencs of the tyrosine kinase family can
`play a role in spontaneous tumor devel(cid:173)
`opment. A specific translocation affect(cid:173)
`ing the c-abl locus, for example, is asso(cid:173)
`ciated with chronic myclogcnous leuke(cid:173)
`mia (5). Several recent studies have also
`documented amplification or rearrange(cid:173)
`ment of the gene for the EGF receptor in
`certain human tumors (6) or tumor cell
`lines (7). We now report the detection
`and partial isolation of a gene that is a
`new member of the tyrosine kinase fam(cid:173)
`ily and is amplified in a human mammary
`carcinoma. This gene is closely related
`to, but distinct from, the EGF rcuptor
`gene.
`The identification of additional mem(cid:173)
`bers of some proto-oncogcne families
`has emerged from findings of related
`sequences amplified sufficiently in a par(cid:173)
`ticular tumor to allow detection (8). Be(cid:173)
`cause of our interest in genes coding for
`
`974
`
`growth factor receptors, we used the v(cid:173)
`erbB gene to probe for related genes that
`might be candidates for other receptor
`coding sequences. We selected moderate
`stringency hybridization conditions un(cid:173)
`der which different oncogenes of the
`tyrosine family did not cross-hybridize.
`Thus, any gene detected might be ex(cid:173)
`pected to have a closer relationship to v(cid:173)
`erbB than to other members of the tyro(cid:173)
`sine kinase family.
`DNA prepared from tissue of a human
`
`A
`!!
`c:
`•
`•
`0
`i
`
`~
`
`..
`..
`
`u
`c
`2
`
`B
`
`• .. c: • 0 • i
`
`~ .. .. u
`
`c
`2
`
`..
`" .,
`
`c
`
`..
`.,
`"
`c
`
`kb p
`
`........
`-~ .......
`
`..,. a.s
`.... 2.0
`
`J . .
`
`Fia. l. Detection of v-erbB- and pMAC 117-
`specific sene frqments in normal human pla(cid:173)
`centa, A431 cells, or human mammary carci(cid:173)
`noma MAC117. DNA (15 M ) was cleaved
`with Eco RI, separated by electrophoresis in
`&prose sels, and transferred to nitrocellulose
`paper (18). Hybridization to the >lP-labeled
`probe (20) was conducted in a solution of 40
`percent formamide, 0.15M NaCl, O.C175M so(cid:173)
`dium citrate, at 42°C (19). The v-erbB probe
`(A) was a mixture of the 0.5-kbp Bam Hl(cid:173)
`Bam HI fraament and 0.5-kbp Bam HI-Eco
`RI fragment of avian erythroblastosis proviral
`DNA. The pMACl 17 probe (B) WU a 1-kbp
`Bal 1-Bam HI fragment . After hybridization,
`the blots were washed first in 0.3M NaCl plus
`0.03M sodium citrate at room temperature,
`and then in 0.015M NaCl, 0.0015M sodium
`citrate, and 0.1 percent sodium dodec:yl sul(cid:173)
`fate at 42"C (A) or at S2"C (B). Hybridization
`was detected by autoradiography.
`
`mammary carcinoma, MAC I I 7, showed
`a pattern of hybridization (Fig. IA) that
`differed both from that observed with
`DNA of normal human placenta and
`from that observed with the A43 I squa(cid:173)
`mous-cell carcinoma line, which con(cid:173)
`tains amplified EGF receptor genes (7).
`In A43I DNA, four Eco RI fragments
`were detected that had increased signal
`intensities compared to those of corre(cid:173)
`sponding fragments in placenta DNA
`(Fig. IA). In contrast, MACI I7 DNA
`contained a single 6-kilobasc pair (kbp)
`fragment, which appeared to be ampli(cid:173)
`fied compared to corresponding frag(cid:173)
`ments observed in both A43 l and placen(cid:173)
`ta DNA's (Fig. IA). These findings were
`consistent with the possibility that the
`MACI I7 tumor contained an amplified
`DNA sequence related to, but distinct
`from, the cellular erbB proto-oncogene.
`To clone the 6-kbp fragment, we di(cid:173)
`gested DNA from MAC117 with Eco RI,
`ligated it into bacteriophage >.gtWES,
`packaged it in vitro, and transferred it to
`Escherichia coli strain BNN45 by infec(cid:173)
`tion. A library of 4 x 1<>5 bactcriophages
`was screened by plaque hybridization
`with radioactive v-erbB DNA. Ten of 14
`hybridizing phages contained a 6-kbp
`Eco RI fragment. Figure 2 shows the
`physical map of one of these pbqcs,
`AMACI 17, and pMACI I7, a pUC12 sub(cid:173)
`clone containing a 2-kbp Barn HI frag(cid:173)
`ment of >.MACl 17 that hybridized with
`v-erbB probes. The region of pMAC117
`to which v-erbB hybridized most in(cid:173)
`tensely was flanked by Ace I and Nco I
`sites. Human repetitive sequences were
`also localized (Fig. 2, region demarcated
`by arrows).
`By digestion of pMAC117 with Bgl I
`and Barn HI, it was possible to generate
`a single-copy probe homologous to v(cid:173)
`erbB. This probe detected a 6-kb Eco RI
`fragment that was amplified in MAC117
`DNA and possibly increased in A431
`cellular DNA relative to normal DNA
`(Fig. lB). The sizes of the fragments
`corresponded to the amplified 6-kb Eco
`RI fragment detected in MACl 17 DNA
`by means of v-erbB (Fig. IA). Hybrid(cid:173)
`ization to Southern blots containing seri(cid:173)
`al dilutions of MAC117 genomic DNA
`indicated an approximate amplification
`of 5- to l 0-fold when compared to human
`placenta DNA.
`The nucleotide sequence of the por(cid:173)
`tion of pMACll7 located between the
`Nco I and Ace I sites contained two
`regions of nucleotide sequence homolo(cid:173)
`gous to v-erbB separated by 122 nucleo(cid:173)
`tides (Fig. 3). These regions shared 69
`percent nucleotide sequence identity
`with both the v-erbB and the human
`EGF receptor gene. The predicted amino
`
`SCIENCE, VOL. 229
`
`1 of 3
`
`Celltrion, Inc., Exhibit 1041
`
`

`

`acid se4uence of:.theie regions" was 85
`percent homologous to two regions that
`are contiguous in the EGF receptor se(cid:173)
`quence (7). Furthermore, these two pu(cid:173)
`tative coding regions of the MAC117
`sequence were each flanked by the AG
`and GT dinucleotides that border the
`exons of eukaryotic genes (9). These
`findings suggest that the $CQuence shown
`in Fig. 2 represents two exons, separated
`by an intron, of a gene related to the
`erbBIEGF receptor gene.
`The predicted amino acid sequence of
`the AMACl 17 putative exons is homolo(cid:173)
`gous to the corresponding sequences of
`several members of the tyrosine kinase
`family. The most striking homology was
`observed with the human EGF receptor
`or erbB (Fig. 3). In addition, we ob(cid:173)
`served 42 percent to 52 percent homolo(cid:173)
`gy with the predicted amino acid se(cid:173)
`quences of other tyrosine kinaso-cncod(cid:173)
`ing genes. At 25 percent of the positions
`there was identity among all the se(cid:173)
`quences analyzed (Fig. 3). A tyrosine
`residue in the AMAC117 putative coding
`sequence, conserved among the tyrosine
`kinases analyzed, is the site of autophos(cid:173)
`phorylation of the src protein (10).
`. The availability of cloned probes of
`the MAC117 gene made it possible to
`investigate its expression in a variety of
`cell types. The MACl 17 probe detected
`a single 5-kb transcript in A431 cells
`(Fig. 4). Under the stringent conditions
`of hybridization utilized, this probe did
`not detect any of the three RNA species
`recognized by EGF receptor comple(cid:173)
`mentary DNA. Thus, MAC117 repre(cid:173)
`sents ~ new functional gene within the
`tyrosine kinase family, closely related
`to, but distinct from , the gene encoding
`the EGF receptor.
`There is precedent for the identifica(cid:173)
`tion of genes related to known onco(cid:173)
`genes on the basis of their amplification
`in human tumors. For example, the high
`degree of amplification of N -myc in cer(cid:173)
`tain malignancies made it detectable by
`means of the myc gene as a molecular
`probe (8). In the present study, a five- to
`tenfold amplification of a v-erbB-related
`gene in the MAC117 mammary carcino(cid:173)
`ma made it possible to identify this se(cid:173)
`quence against a complex pattern of
`EGF receptor gene fragments. Analysis
`of DNA from ten additional mammary
`carcinomas has not revealed amplifica(cid:173)
`tion of the MAC117 gene. However,
`extensive studies will be required to de(cid:173)
`termine the frequency of MAC117 gene
`amplification in different human malig(cid:173)
`nancies.
`The MAC117 coding sequence, as de(cid:173)
`termined by nucleotide and predicted
`amino acid sequence, was most closely
`6 SBPTEMBER 1985
`
`related tO the nbBJEGF rectPtor 1UDOD1
`known members of the tyrosine kinase
`family. The two genes are distinct, on
`the basis of sequence diversity and tran(cid:173)
`script size. Detailed structural analysis
`of the complete coding sequence should
`give insights into the possible functions
`
`of-tbi& v:.em~ ~- Neverthe(cid:173)
`less, because of its close relationship to
`the sequence of the EGF receptOr, it is
`possible to speculate that the MAC117
`coding sequence may also be derived
`from a gene encoding a growth factor
`receptor. An oncogene in a chemically
`
`B BXbR
`B
`BXh
`B
`AMAC117~~f~--+i~l--~)l------~l-, +l~l-ll---
`
`I
`I
`I
`
`pMAC117
`
`B/
`I
`
`N BgANN
`.,_._.. : :
`
`I I I I
`
`I
`
`' ' ' \ B
`
`I
`
`1 kb -
`
`0.5 kb
`1----1
`
`...
`
`.-·
`
`v-erbB
`related
`
`...
`
`. . .
`
`•o
`ao
`so
`o
`10
`60
`10
`20
`10
`GTCT ACA TGOOTGCTTCCCA TTCCM;GOOATGAGCT ACCTGGAGGA TGTGCGGCTCGT ACACAGOOACTTGGCCGCTCGOUCGTGCTGGTCUGAGTCC
`01 yM.t s.,. T y,.l euOluA•pYa l A.rqL euYa l Hi aArQA.spl.evA. l • Al a A.rqAM\ V • 1l.uVa 1 l y .SerP,.
`
`CAA.CCA. TGTCA.AAA. TT ACA.GACTTCGGGCTGGCTCGGCTCCTGGACA TTGACOA.GACAGAGT A.CCA TOCA.GA. TGGGGGCAAGGT T A.GGTGAA.GGACCA.A.0
`oA.M\Hi • Y•ll y d l e ThrA•pPMCl yleuA.l a A.r ql4".1L euA.spl l •A•pGlt.tThrGl uTyrH; s Ala A•.,.01 vG1 yl v• -
`
`GAGCAGAGGAGGCT GOOTGGAGTGGTGTCT AGCCCA TGGGAGAACTCTGAOTGGCCACCTCCCCACAACACACAGTTGGAGOACTTCCTCT TCTGCCCTC
`
`cc~ rc;cccA TCU OTGGA TGOOGC TGGAO f CCA T TCTCCGCCGGCGGTTCACCCACCAGAGTOATGTGTGGAOT TA f GGT2JGTGA TGGOGGGTGTTO
`Y•l Pro 11 e l y sT rpMet Al •leuGluS•r J l •I. 9t.IAr qAr QArQtht!ThrH\ sGlnS•rA•pYa l T r pSe rTyr Gl y
`
`t 00
`
`200
`
`l OO
`
`4 00
`
`GGAGGGGTGGGTGAGGAGCCA TOO
`
`Fig. 2. Restriction-site map of~MAC117 and plasmid pMAC117. A, Ace I; 8, Barn HI; Bg, Bgl
`I; N, Nco I; R, Eco RI; X, Xba I; Xh, Xho I. The sites were located by electrophoretic analysis
`of the products of single and double digestion. Regions homologous to v-erbB or human
`repetitive sequences (region flanked by arrows) were located by Southern blot hybridization
`(18) with the v-erbB probe or total human DNA made radioactive by nick translation (20).
`Hybridization conditions were as described in Fig. IA. The nucleotide sequence of pMACll7
`between the Ace I site and the Nco I sites and regions of encoded amino acid sequence
`homologous to the EGF receptor are shown. The AG or GT dinucleotides flanking the putative
`coding regions are underlined. To determine the sequence, Nco I, Hinf I, and Sau 96 I
`fragments were labeled at the 3' termini by means of the large fragment of E. coli DNA
`polymerase, separated into single strands by gel electrophoresis, and chemically degraded (21).
`
`*** * *
`
`* ***
`
`...
`....
`...
`0
`<
`::E
`CL
`
`...
`
`0
`
`~ ..
`
`OCL
`w~
`~
`
`pMAC117
`H111111n EGF Receptor 85
`v-erb8
`85
`v-m
`52
`v-ibf
`51
`v-1iS
`50
`H-.n lnsu11n
`42
`Receptor
`
`pMAC117
`
`Himan EGF Receptor EIKI
`
`* * * *
`•
`•
`DETEfHA-DG-GK--YPIK114ALESILRRR
`a
`E
`v-erbB
`v-m
`EDll
`-
`ITYT
`v-ibf
`v-liii
`K
`llO
`H11111n I nsu11 n Receptor YI Y K
`Fig. 3 Oeft). Comparison of the putative encoded amino acid sequence in pMAC 117 with known
`tyrosine kinase sequences. Black regions represent homologous amino acids. Dift'ering amino
`acid residues are shown in one-letter code (22). Amino acid positions conserved in all sequences
`are denoted by•. The tyrosine homologous to that autophosphorylated by the v-src protein (J(J)
`is shown by an arrow. The v-abl sequence contains a tyrosine residue in this region displaced by
`two positions. The amino acid sequences of human EGF re«ptor (7), v-erbB (4), v-src (23), v(cid:173)
`abl (24), v-fms (4), and human insulin re«ptor (25) were aligned by the computer program
`described (26). The homology observed with the predicted amino acid sequences ofv-yes and v(cid:173)
`fes was SI percent and 48 percent, respectively.
`Fig. 4 (right). Detection of distinct
`messenger RNA species derived from the >.MAC117 gene and the human EGF re«ptor gene.
`Polyadenylated messenger RNA of A431 cells was separated by denaturing gel electrophoresis
`in formaldehyde (23), transferred to nitrocellulose (18). and hybridized under stri~ent
`conditions (SO percent fonnamide, 0.01SM NaCl, 0.15M sodium citrate, at 42"C) with 2P(cid:173)
`labeled probe from pMACl 17(Bgl1-Bam HI fragment) or human EGF receptor complementary
`DNA (PE7: 2-kb Cla I inserted fragment) . Filters were washed under conditions of high
`stringency (0.015M NaCl plus O.OOISM sodium citrate at SS"C). Hybridization was detected by
`autoradiograpby with exposure times of 4 hours for the pMACI 17 probe and I hour for the
`human EGF receptor probe.
`
`ii
`,,
`~ II
`
`•
`
`** * *
`
`•
`
`•28S
`
`• 18S
`
`975
`
`2 of 3
`
`Celltrion, Inc., Exhibit 1041
`
`

`

`induced rat neuroblastoma has been de(cid:173)
`tected by DNA transfection analysis
`(11). This oncogene, designated neu, ap(cid:173)
`pears to encode a protein immunologi(cid:173)
`cally related to the EGF receptor (12).
`Whether the MACl 17 coding sequence
`and neu represent the same or different
`cellular genes awaits further character(cid:173)
`ization.
`Overexpression of proto-oncogenes
`can cause cell transformation in culture
`and may function in the development of
`human tumors. Amplification of a nor(cid:173)
`mal ras gene or its increased expression
`under the control of a retroviral long
`terminal repeat (L TR) induces transfor(cid:173)
`mation of NIH 3T3 cells (13). Expression
`of the normal human sis/PDGF-2 coding
`sequence in NIH 3T3 cells, which do not
`normally express their endogenous sis
`proto-oncogene, also leads to transfor(cid:173)
`mation (14). In Burkitt lymphoma, a
`chromosomal
`translocation
`involving
`myc places its normal coding sequence
`under the control of an immunoglobulin
`gene regulatory sequence (15) . The re(cid:173)
`sulting alteration in myc expression is
`likely to be causally related to tumor
`development (16). The observation of
`amplification of myc or N-myc in more
`malignant phenotypes of certain tumors
`has supported the idea that overexpres(cid:173)
`sion of these genes can contribute to the
`progression of such tumors (8, 17). The
`erbBIEGF receptor gene is amplified or
`overexpressed in certain tumors or tu(cid:173)
`mor cell lines (6). The five- to tenfold
`amplification of our v-erbB-related gene
`in a mammary carcinoma suggests that
`increased expression of this gene may
`have provided a selective advantage to
`this tumor. The isolation of a new mem(cid:173)
`ber of the tyrosine kinase gene family
`amplified in a human mammary carcino(cid:173)
`ma provides an opportunity to investi(cid:173)
`gate the potential role of this gene in
`human malignancy.
`Note added in proof. Recently, Semba
`et al. (28) independently detected a v(cid:173)
`erbB-related gene that was amplified in a
`human salivary gland adenocarcinoma.
`Nucleotide sequence analysis of this
`gene indicates its identity to the MACl 17
`gene in the regions compared.
`
`Reterenas and NoCa
`I. J. M. Bishop, An/IU. Rev. Biochem. 52, 301
`(1983); P. H. Duesbcrg, Nature (London) 394,
`219 (1983).
`2. R. F. Doolittle et al., Science 221, 275 (1983);
`M. D. Waterfield et al. , Nature (London) 394, 35
`(1983).
`3. J. Downward et al. , Nature (London) Je'1, 521
`(1984).
`4. A . HamJ>C, I. Laprevotle, F. Galibcn, L. A.
`Fedele, C. J . Sherr, Cell 3t, ns (1982); N.
`Kitamura, A . Kitamura, K . Toyoshima, Y. Hir(cid:173)
`ayama, M. Yoshida, Nature (London) m . 205
`(1982); M. Shibuya and H . Hanafusa, Cell 30,
`787 (1982); T. Yamamoto et al., ibid. 35, 71
`(1983).
`
`976
`
`S. A . de Klein et al., Nature (London) 311, 765
`(1982); S. J. Collins and M. T. Groudine, Proc.
`Natl. Acad. Sci. U.S.A. . 88, 4813 (1983).
`6. T. A. Libermann et al., Nature (London) 313,
`144 (1985).
`7. A . Ullrich et al. , ibid. 309, 418 (1984); Y. Xu et
`al., ibid., p. 809; C. R. Lin et al. , Science 224,
`843 (1984).
`8. M. Schwab Nature (London) 305, 245 (1983); N.
`E. Kohl et al., Ce/135, 349 (1983).
`9. R. Breatbnach and P. Cbambon, Annu. Rev.
`Biochem. se, 349 (1981).
`10. J.E. Sman et al. , Proc. Natl. Acad. Sci. U.S.A .
`78, ()013 (1981 ).
`11. Alan L. Schechter et al. , Nature (London) 312,
`513 (1984).
`12. J. A. Drebin, D. F. Stem, V. C. Link, R. A.
`Weinberg, M. I. Greene, ibid., p. 545.
`13. E. H. Chang, M. E. Funh, E. M. Scolnick, D.
`R. Lowy, ibid. 291, 479 (1982).
`14. A. Gazit et al., Ce/139, 89 (1984); M. F. Clarke
`et al. , Nature (London) 308, 464 (1984).
`IS. R. Taub et al .. Proc. Natl. Acad. Sci. U.S.A .
`79, 7837 (1982).
`16. K. Nisbikura et a/., Science 224, 399 (1984).
`17. M. Schwab et al., Proc. Natl. Acad. Sci. U.S.A.
`81, 4940 (1984).
`18. E. M. Southern, J. Mo/. Biol. 98, 503 (1975).
`19. G. M. Wahl, M. Stem, G. R. Stark, Proc. Natl.
`Acad. Sci. U.S.A. 1', 3683 (1979).
`
`20. P. W. 1. Rigby, M. Dieckmann, C. Rhodes, P.
`Berg, J. Mo/. Biol. 113, 237 (1977).
`21. A. M. Maxam and W. Gilben, Proc. Natl.
`Acad. Sci. U.S.A.. 74, S<iO (1977).
`22. The following abbreviations were used for ami(cid:173)
`no acids: A , alanine ; C , cysteinc, D, aspartic
`acid; E, glutamic acid; F . phenylalanine; G,
`glycine; ff, histidine; I, isoleucinc: K , lysine; L ,
`leucine; M, methionine; N. asparaginc; P, pro(cid:173)
`line; Q, glutamine; R, arginine; S, serine; T,
`threonine; V, valine; W, tryptophan: Y, tyro(cid:173)
`sine.
`23. H . D. Lcbrach, D. Diamond, J.M. Wozney, H.
`Bocdtker, Biochemistry 16, 4743 (1977).
`24. A. P. Czemilofsky et al., Nature (London) 281.
`193 (1980).
`25. E. P. Reddy, M. J. Smith, A. Srinivasan, Proc.
`Natl. Acad. Sci. U.S.A. . 80, 3623 (1983).
`26. A. Ullrich et al. , Nature (London) 313, 756
`(1985).
`27. D. J. Lipman and W. R. Pearson, Science 227,
`1435 (1985).
`28. K. Semba, N. Kamala, K . Toyshima, T. Yama(cid:173)
`moto, Proc. Natl. Acad. Sci. U.S.A.., in press.
`29. We thank I. Pastan and G . Merlino for providing
`the human EGF complementary DNA clone
`PE7 and P. di Fiore for the polyadenylated A431
`RNA.
`
`22 April 1985; accepted 3 June 1985
`
`The neu Gene: An erbB-Homologous Gene Distinct from and
`Unlinked to the Gene Encoding the EGF Receptor
`
`Abstract. The neu oncogene, identified in ethylnitrosourea-induced rat neuroglio(cid:173)
`blastomas, had strong homology with the erbB gene that encodes the epidermal
`growth factor receptor. This homology was limited to the region of erbB encoding the
`tyrosine kinase domain. It was concluded that the neu gene is a distinct novel gene,
`as it is not coamplified with sequences encoding the EGF receptor in the genome of
`the A431 tumor line and it maps to human chromosome 17.
`
`ALAN L. ScHECHTER
`MIEN-CIDE HUNG
`LALITHA VAJDYANATHAN
`ROBERT A. WEINBERG
`Whitehead Institute for Biomedical
`Research and Department of Biology,
`Massachusetts Institute of Technology,
`Cambridge 02142
`TEREsA L. YANG-FENG
`UTA FRANCKE
`Department of Human Genetics,
`Yale University School of Medicine,
`New Haven, Connecticut 06510
`AxEL ULLRICH
`LISA COOS.SENS
`Department of Molecular Biology,
`Genentech, Inc.,
`San Francisco, California 94080
`
`Rat neuroglioblastomas induced by
`exposure in utero to ethylnitrosourea
`frequently carry an oncogene detectable
`upon transfection into NIH 3T3 mouse
`cells (1) . This oncogene (which we have
`termed neu) was found to be related to c(cid:173)
`erbB (2), a gene that encodes the recep(cid:173)
`tor for epidermal growth factor (EGF-r)
`(3). The neu oncogene induces the syn(cid:173)
`thesis of a tumor antigen, p185, which is
`serologically related to the EGF-r (2).
`Southern blot analysis of rat DNA
`after Eco RI digestion revealed at least
`two erbB-homologous segments, one of
`
`which contained the neu oncogene in a
`biologically active form (2). It remained
`unclear whether the same or other DNA
`segments encode the EGF-r. Other anal(cid:173)
`ysis uncovered differences between the
`products of the two genes. While poly(cid:173)
`clonal sera to the EGF-r recognized
`pl85, monoclonal antibodies to p185 did
`not react with the EGF-r. Moreover,
`there was an apparent molecular weight
`difference of 15,000 daltons between the
`two proteins (2).
`These data raised several possibilities
`regarding the relationship between the
`neu and c-erbB genes. The neu oncogene
`might be a mutated allele of the normal c(cid:173)
`erbB gene, or it might be derived from a
`normal gene, the sequences of which
`overlap with those of c-erbB. Alterna(cid:173)
`tively, the neu oncogene might have aris(cid:173)
`en from a gene that is totally separate
`and distinct from erbB.
`We used three subclones of human c(cid:173)
`erbB complementary DNA (cDNA) (4)
`and a 0.7-kilobase (kb) subclone of the v(cid:173)
`erbB oncogene that had been transduced
`by the genome of avian erythroblastosis
`virus (5) for these studies. All of the neu
`oncogene lies within a 34-kb Eco RI
`segment that is present in the genomes of
`normal and tumor rat cells as well as in
`mouse NIH 3T3 cells that have acquired
`a neu oncogene via transfection (2). We
`
`SCIENCE, VOL. 229
`
`3 of 3
`
`Celltrion, Inc., Exhibit 1041
`
`