`
`- - - - - - - - - - - - - - - -
`
`323
`
`different paths, and by ensuring that an azimuthally uniform
`coverage of stations is used in the averaging calculation. To
`compensate for other factors, such as focal depth, fault geometry
`and corner frequency would require such a detailed knowledge
`of the earthquake source that the M, measurement itself would
`be redundant.
`The results of this analysis can be summarized in five points.
`( 1) A global average moment-magnitude relationship Ms has
`been defined which can be used to predict M 0 over a wide range
`of magnitudes and scalar moments.
`(2) The variance of surface wave measurements for an event
`of a particular scalar moment is -0.2 magnitude units.
`
`(3) Large regional biases in M, exist.
`( 4) Differences in source scaling may explain some of the
`differences. Specifically, observations show that the transition
`from a slope of unity to a smaller value occurs at large moments
`for continental events than for ridge and fracture zone events,
`suggesting systematic differences in stress drop.
`(5) Other systematic factors affecting the calculation of M,
`also appear to contribute to the observed regional bias.
`We thank Professor J. H. Woodhouse for reading and correct(cid:173)
`ing the manuscript and Professor H. Kanamori for constructive
`criticism throughout our work on this subject. This work was
`supported by the NSF.
`
`Received 20 October 1987; accepted 4 February 1988.
`
`1. Richter. C. F. Bull. seism. Soc. Am. 25, 1-32 (1935).
`2. Vanek, J. et al. Izv. akad. Nauk. USSR, Ser. Geophys. 2, 153-158 (1962)
`3. Aki, K. Bull Earthqu. Res. Inst. Tokyo Univ. 44, 23-88 (1966).
`4 Agnew, D., Berger, J., Buland, R., Farrell, W. & Gilbert, F. Ens 57 0 280-288 (1976).
`5. Peterson, J., Butler, H. M., Holcomb, LG. & Hutt, C.R. Rull seism. Soc. Am. 66, 2049-2068
`(1976).
`6. Kanamori, H. & Given, J. W. Phys. Earth planet. Inter. 27, 8-31 (1981).
`7. Dziewonski. A. M., Chou, T. A. & Woodhouse, J. H.J. geophys. Res. 86, 2825-2852 (1981 ).
`8. Woodhouse, J. H. & Dziewonski, A. M. J. geophys. Res. 88, 3247-3271 (1983)
`9. Woodhouse, J. H. & Dziewonski, A. M. J. geophys. Res. 89, 5953-5986 ( 1984)
`10. Dziewonski, A. M., Franzen, J.E. & Woodhouse, J. H. Phys. Earth planet. Inter. 34, 209-219
`(1984).
`11 Dziewonski, A M., EkstrOm, G., Franzen, J. E. & Woodhouse, J. H. Phys. Earth planet
`Inter. 45, 11-36 (1987).
`
`12. Dziewonski, A. M., Ekstrom, G., Woodhouse, J. H. & Zwart, G. Phys. Earth planer. inter.
`(in the press).
`13. Kanamori. H.J. geophys. Res. 82, 2981-2987 (1977).
`14. Richter, C. F. Elementary Seismology (W. H. Freeman, San Fransisco, 1958).
`15. Lienkamper, J. J. Bull. seism. Soc. Am. 74, 2357-2378 (1984}.
`16. Kanamori, H. Anderson, D. L Bull. seism. Soc. Am. 65, 1073-1095 (1975).
`17. EkstrOm, G. & Dziewonski, A. M. Bull. seism. Soc. Am. 75, 23-39 (1985)
`18. Sipkin, S. A. Bull. seism. Soc. Am. 76, 1515-1541 (1986)
`19 Harkrider, D. G. Bull. seism. Soc. Am. 54, 627-679 (1964).
`20. Gutenberg, B. & Richter, C. F. Gerlands Beitr. z. Geophysik 47, 73-131 (1936).
`21. Gutenberg, B. Bull. seism. Soc. Am. JS, 3-12 (1945).
`22. Von Seggem, D. Bull. seism. Soc. Am. 60, 503-516 (1970).
`23. Nuttli, 0. Tectonophysics 118, 161-174 (1985).
`24. Kanamori, H. & Allen, C. R. in Maurice Ewing Series Vol. 6, Earthquake Source Mechanics
`(American Geophysical Union, Washington, DC, 1986).
`25 Zhuo, T. & Kanamori, H. Bull seism. Soc. Am. 77, 514-529 (1987).
`
`Reshaping human antibodies for therapy
`
`Lutz Riechmannt, Michael Clark*, Herman Waldmann* & Greg Winter*
`
`MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK
`* Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge CB2 lQP, UK
`
`A human lgGI antibody has been reshaped for serotherapy in humans by introducing the six hypervariable regions from
`the heavy- and light-chain variable domains of a rat antibody directed against human lymphocytes. The reshaped human
`antibody is as effective as the rat antibody in complement and is more effective in cell-mediated lysis of human lymphocytes.
`
`IN 1890 it was shown that resistance to diphtheria toxin could
`be transferred from one animal to another by the transfer of
`serum. It was concluded that the immune serum contained an
`anti-toxin, later called an antibody 1
`• For many years animal
`antisera were used in the treatment of microbial infections and
`for the neutralization of toxins in man2
`. More recently rodent
`monoclonal antibodies (mAbs) 3 have been used as 'magic bul(cid:173)
`6
`lets'4 to kill and to image tumours 5
`• The foreign immuno(cid:173)
`•
`globulin, however, can elicit an anti-globulin response which
`may interefere with therapy7 or cause allergic or immune com(cid:173)
`plex hypersensitivity2. Thus ideally human antibodies would be
`used. Human immunoglobulins are widely used as both prophy(cid:173)
`lactic and microbicidal agents 8
`, but it would be far better to
`have available human mAbs of the desired specificity. It has
`proven difficult, however, to make such mAbs by the conven(cid:173)
`tional route of immortalization of human antibody-producing
`cells9
`•
`There is an alternative approach. Antibody genes have been
`transfected into lymphoid cells, and the encoded antibodies
`expressed and secreted; by shuffling genomic exons, simple
`chimaeric antibodies with mouse variable regions and human
`12
`constant regions have been made 10
`. Such chimaeric antibodies
`-
`
`t Address from April 1988: Department of Molecular Biology, The
`Research Institute of Scripps Clinic, North Torrey Pines Road, La Jolla,
`California 02937, USA
`t To whom correspondence should be addressed.
`
`have at least two advantages over mouse antibodies. First, the
`effector functions can be selected or tailored as desired. For
`example, of the human IgG isotypes, IgG 1 and JgG3 appear to
`15
`be the most effective for complement and cell-mediated lysis 13
`-
`,
`and therefore for killing tumour cells. Second, the use of human
`rather than mouse isotypes should minimize the anti-globulin
`responses during therapy 16
`17 by avoiding anti-isotypic anti(cid:173)
`'
`bodies. The extent to which anti-idiotypic responses to rodent
`antibodies in therapy are dictated by foreign components of the
`variable versus the constant region is not known, but the use of
`human isotypes should reduce the anti-idiotypic response. For
`example, when mice were made tolerant to rat immunoglobulin
`constant-region determinants, administration of rat anti(cid:173)
`lymphocyte antibodies did evoke anti-idiotypic responses, but
`these were delayed and weaker than in animals that had not
`been made tolerant 18
`. Nevertheless, it is likely that a chimaeric
`antibody would provoke a greater immune response than a
`human mAb.
`We have attempted to build rodent antigen binding sites
`directly into human antibodies by transplanting only the antigen
`binding site, rather than the entire variable domain, from a
`rodent antibody. The antigen binding site is essentially encoded
`by the hypervariable loops at one end of the ,B-sheet framework.
`The hypervariable regions of the heavy chain of mouse anti(cid:173)
`bodies against a hapten 19 or a protein antigen47 were previously
`transplanted into a human heavy chain, and, in association with
`the mouse light chain, the antigen binding site was retained.
`
`1 of 5
`
`Celltrion, Inc., Exhibit 1069
`
`
`
`324
`
`-
`
`- · ---·(cid:173)
`
`NATURE VOL 332 24 MARCH 1988
`- - - - -
`
`------ARTICLES---
`h
`H ~ ':'d I I
`
`11.
`
`. ATGCAAATCCTCTGAATCTACATGGTAAATATAGGTTTGTCTATACC
`
`a
`Hindi 111
`5 ' ........... ATGCAAATCCTCTGAATCTACATGGTAAATATAGGTTTGTCTATACC
`1-----7 RNA starts ~RNA starts
`ACAAACAGAAAAACATGAGATCACAGTTCTCTCTACAGTTACTGAGCACACAGGACCTCA +50
`lSpl ice
`signal
`L U A T A T)
`I
`I
`L F
`(M G W S C
`CCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTAAGGGGCTCA + 120
`ATGAAGTTGTGGCTGAACTGGATTTTCCTTTTAACACTTTTAAAT
`(M K L W L N W
`I F
`L
`L
`T
`L
`L N)
`
`CAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAATGACATCCACTTTGCCTTT + 180
`Sp I i c:e I
`. oli9os 111, IV, VII
`-.J,.
`s 1 gna I
`10
`5
`1
`(G U H S)Q U Q L Q E S G P G L U R
`CTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGAGAGCGGTCCAGGTCTTGTGAGA +240
`GGTATCCAGTGTGAGGTGAAACTGTTGGAATCTGGAGGAGGCTTGGTACAG
`I Q C) E U K L
`(G
`L E S G G G L U
`0
`oli90 XIII
`oligo X
`15
`30 CDR 1
`25
`20
`s G s,. T F s* I D F v I
`T c T
`L s L
`s Q T
`P
`u
`CCTAGCCAGACCCTGAGCCTGACCTGCACCGTGTCTGGCAGCACCTTCAGCGATTTCTAC +300
`CCGGGGGGTTCTATGAGACTCTCCTGTGCAGGTTCTGGATTCACCTTCACTGATTTCTAC
`P G G S M R
`L
`S C A G S G F
`T F
`T lo F YI
`
`a
`52
`45
`50
`35
`oligo IX
`40
`p G R G L E w I G IF
`CB::::EJ w u R Q p
`I R DI
`ATGAACTGGGTGAGACAGCCACCTGGACGAGGTCTTGAGTGGATTGGATTTATTAGAGAC +350
`ATGAACTGGATCCGCCAGCCTGCAGGGAAGGCACCTGAGTGGCTGGGTTTTATTAGAGAC
`[}[]Dw
`1 Ro PA GK APE w L GIF
`1 R DI
`oligo XI
`c: 53
`b
`70
`55
`50
`CDR 2
`55
`y N
`I K A K G y
`T M L
`p
`u
`u K GI R
`s
`T E
`T
`AAAGCTAAAGGTTACACAACAGAGTACAATCCATCTGTGAAGGGGAGAGTGACAATGCTG +420
`AAAGCTAAAGGTTACACAACAGAGTACAATCCATCTGTGAAGGGGCGGTTCACCATCTCC
`I K A K G Y T
`T E Y N P S U K GI R F
`I S
`T
`
`c: 83
`b
`85
`82
`80
`75
`Cl
`UDTSKNQFSLRLSSUTAADT
`GTAGACACCAGCAAGAACCAGTTCAGCCTGAGACTCAGCAGCGTGACAGCCGCCGACACC +480
`AGAGATAATACCCAAAACATGCTCTATCTTCAAATGAACACCCTAAGAGCTGAGGACACT
`R D N T Q N M L Y
`L Q M N T
`L R A E D T
`oli90 XII
`100 a
`90
`95
`CDR 3
`b101
`105
`A u y y c R RI E G H T A A p F D YI w G Q
`GCGGTCTRTTATTGTGCAAGAGAGGGCCACACTGCTGCTCCTTTTGATTACTGGGGTCAA +540
`GCCACTTACTACTGTGCAAGAGAGGGCCACACTGCTGCTCCTTTTGATTACTGGGGCCAA
`F D YI w G Q
`01i9os v, VI, VII
`ls I.
`c A RI E G H T A A
`A T y y
`p
`I_
`,,lllamH I
`. .... 3 ' +500
`
`IC:e
`
`. . . . . . . . . . . . . . .
`
`113
`110
`G S L U T U S S
`GGCAGCCTCGTCACAGTCTCCTCAGGT.
`GGAGTCATGGTCACAGTCTCCTCA
`G U M U T U S S
`
`P
`
`Oli9onucleo\ides: I: 5'-GGC CAG TGG ATA GAC-3', 111: 5'-CAG TTT CAT CTA
`GAA CTG GAT A-3', IV: 5'-GCA GTT GGG TCT AGA AGT GGA CAC C-3',
`V: 5'-TCA GCT GAG TCG ACT GTG AC-3', VI: 5'-TCA CCT GAG TCG ACT GTG
`AC-3', VII: 5'-AGT TTC ACC TCG GAG TGG ACA CCT-3', VIII: 5'-TCA CCT GAG
`GAG ACT GTG AC-3'; IX: 5'-GGC TGG CGA ATC CAG TT-3', X: 5'-CTG TCT CAC
`CCA GTT CAT GTA GAA ATC GCT GAA GGT GCT-3', XI: 5'-CAT TGT CAC TCT
`CCC CTT C AC AG A TGG A TT GT A CTC TGT TGT GT A ACC TTT AGC TTt GTC
`TCT AAT AAA TCC AAT CCA CTC-3', XII: 5'-GCC TTG ACC CCA GTA ATC AAA
`AGG AGC AGC AGT GTG GCC CTC TCT TGC ACA ATA-3', XIII: 5'-AGA AAT
`CGG/C TGA AGG TGA AGC CAG ACA C-3'.
`
`~RNA starts
`~RNA starts
`ACAAACAGAAAAACATGAGATCACAGTTCTCTCTACAGTTACTGAGCACACAGGACCTCA +50
`ATGA
`([)
`
`signal
`L U A T A T)
`L F
`1-J S C
`I
`I
`( M G
`CCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTAAGGGGCTCA + 120
`TGGCTGCACTTCAACTCTTAGGGGTAGCTGCTAGCTCTGGCTCCCAG
`(M
`A A L Q L
`L G U A A S S G S Q)
`
`1spl ice
`
`CAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAATGACATCCACTTTGCCTTT + 180
`
`Sp 1 i c:ej, s i gna I
`10
`5
`1
`I Q M T Q S P S S
`(G U H S)D
`L S A
`CTCTCCACAGGTGTCCACTCCGACATCCAGATGACCCAGAGCCCAAGCAGCCTGAGCGCC +240
`GCCATGAGATGTGACATCAAGATGACCCAGTCTCCCTCATTCCTGTCTGCA
`I K M T Q S P S F
`(A M R C)D
`L
`S A
`oli90 XIV
`
`CDR 1
`30
`25
`20
`15
`I D K y LI
`T c IK A s Q N
`I
`T
`u
`u G D R
`s
`AGCGTGGGTGACAGAGTGACCATCACCTGTAAAGCAAGTCAGAATATTGACAAATACTTA +300
`TCTGTGGGAGACAGAGTCACTCTCAACTGCAAAGCAAGTCAGAATATTGACAAATACTTA
`s u G D R u T L N c IK A s Q N
`I D K y LI
`oli90 XV
`50
`CDR 2
`45
`40
`35
`[ill w y Q Q K
`I
`y IN T N NI
`L
`L
`p K
`p G K A
`AACTGGTACCAGCAGAAGCCAGGTAAGGCTCCAAAGCTGCTGATCTACAATACAAACAAT +350
`AACTGGTATCAGCAAAAGCTTGGAGAATCTCCCAAACTCCTGATATATAATACAAACAAT
`[ill w y Q Q K
`L G E
`I
`y
`s
`p K
`L
`L
`IN T N NI
`
`70
`55
`50
`55
`IL Q TIG up s RF s Gs Gs GT D FT F
`TTGCAAACGGGTGTGCCAAGCAGATTCAGCGGTAGCGGTAGCGGTACCGACTTCACCTTC +420
`TTGCAAACGGGCATCCCATCAAGGTTCAGTGGCAGTGGATCTGGTACTGATTTCACACTC
`IL Q Tl G
`I P S R F S G S G S G T D F
`T
`L
`oligo XVI
`CDR 3
`90
`85
`80
`75
`I A T y y c IL Q H
`I s I
`s L Q p E D
`I
`T
`s
`ACCATCAGCAGCCTCCAGCCAGAGGACATCGCCACCTACTACTGCTTGCAGCATATAAGT +480
`ACCATCAGCAGCCTGCAGCCTGAAGATGTTGCCACATATTTCTGCTTGCAGCATATAAGT
`A T y F c IL Q H
`L Q p E D
`I
`I
`T
`s
`s
`u
`s I
`
`108
`105
`100
`95
`IR P R Tl F G Q G T K U E
`I K R
`AGGCCGCGCACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGTGAGTAGAATTTAAAC +540
`AGGCCGCGCACGTTTGGAACTGGGACCAAGCTGGAGCTGAAACGG
`IR P R Tl F G T G T K
`L E
`L K R
`BamHI
`TTTGCTTCCTCAGTTGGATCC-3'
`
`Dligonucleo\ides: II: 5'-TGC AGC ATC AGC C-3', XIV: 5'-CTG CTG GTA CCA
`GTT T AA GT A TTT GTC AAT ATT CTG ACT TGC TTT ACA GGT GAT GGT-3',
`XV: 5'-GCT TGG CAC ACC CGT TTG CAA ATT GTT TGT ATT GTA GAT CAG
`CAG-3', XVI: 5'-CCC TTG GCC GAA CGT GCG CGG CCT ACT TAT ATG CTG CAA
`GC A GT A GT A GGT-3 '.
`
`Fig. 1 Heavy-chain (a) and light-chain (b) sequences of the variable domains of reshaped (upper line) or rat YTH 34.SHL (lower line)
`19
`antibodies. The reshaped heavy-chain variable domain HuVHCAMP was based on the HuVHNP gene 12
`, with the framework regions of
`•
`human NEW (see note) alternating with the hypervariable regions of rat YTH 34.SHL. The reshaped light-chain variable domain HuVLCAMP
`is a similar construct, except with the framework regions of the human myeloma protein REI, with the C-terminal and the 3' non-coding
`sequence taken from a human J.-region sequence36
`. The sequences of oligonucleotide primers are given and their locations on the genes are
`marked.
`Methods. Messenger mRNA was purified37 from the hybridoma clone YTH 34.SHL ( y2a, Kb). First strand cDNA was synthesized by priming
`with oligonucleotides complementary to the 5' end of the CHl (oligonucleotide I) and the CK exons (oligonucleotide II), and then cloned
`39
`and sequenced as described previously38
`. Two restriction sites (Xbal and Sall) were introduced at each end of the rat heavy-chain variable
`•
`region RaVHCAMP cDNA clone in M13 using mutagenic oligonucleotides III and V respectively, and the XbaI-Sall fragment was excised.
`The corresponding sites were introduced into the MI3-HuVHNP gene using oligonucleotides IV and VI, and the region between the sites
`was then exchanged. The sequence at the junctions was corrected with oligonucleotides VII and VIII, and an internal Barn HI site removed
`using the oligonucleotide IX, to create the Ml3-RaVHCAMP gene. The encoded sequence of the mature domain is thus identical to that of
`YTH 34.SHL. The reshaped heavy-chain variable domain (HuVHCAMP) was constructed in an M13 vector by priming with three long
`19
`oligonucleotides simultaneously on the single strand containing the M13-HuVHNP gene 12
`• Each oligonucleotide (X, XI and XII) was
`•
`designed to replace each of the hypervariable regions with the corresponding region from the heavy chain of the YTH 34.SHL antibody.
`Colony blots were probed initially with the oligonucleotide X and hybridization positives were sequenced: the overall yield of the triple mutant
`was 5%. The (Ser27 .... Phe) and (Ser27 .... Phe, Ser30 .... Tur) mutants of M13mp8-HuVHCAMP were made with the mixed oligonucleotide
`XIII. The reshaped light-chain variable domain (HuVLCAMP) was constructed in M13 from a gene with framework regions based on human
`REI (J. Foote, unpublished data). As above, three long oligonucleotides (XIV, XV and XVI) were used to introduce the hypervariable regions
`of the YTH 34.SHL light chain.
`Note: There are discrepancies involving the first framework region and the first hypervariable loop of the NEW heavy chain between the
`published sequence 27 used here and the sequence deposited in the Brookhaven data base (in parentheses): Ser27 ( .... Thr), Thr28 ( .... Ser) and
`Ser30 (~Asp). Neither version is definitive (R. J. Poljak, personal communication) and the discrepancies do not affect our interpretations.
`
`2 of 5
`
`Celltrion, Inc., Exhibit 1069
`
`
`
`NATURE VOL. 332 24 MARCH 1988
`
`ARTICLES--~ - - - - -
`
`325
`
`HuVHCAMP-RaigG2b
`
`HuVLCAMP-1-lulgK
`
`1~ v H"VllCAMP-H"lgGI
`v ~ "'"""'""'"''" J . : (
`~f
`
`rat
`
`human
`
`Fig. 2 Strategy for reshaping a human antibody for therapy.
`Sequences of rat origin are marked in black, and those of human
`origin in white. The recombinant heavy and light chains are also
`marked using a systematic nomenclature. See text for description
`of stages I, 2 and 3. The genes encoding the variable domains were
`excised from the M13 vectors as HindlII-BamHI fragments, and
`recloned into pSV2gpt29 (heavy chains) or pSV2neo30 (light
`chains), expression vectors containing the immunoglobulin en(cid:173)
`hancer12. The human yl (ref. 40), y2 (ref. 41), y3 (ref. 42), y4
`(ref. 41) and K (ref. 36) and the rat y2b (ref. 43) constant domains
`were introduced as BamHI fragments. The following plasmids
`were constructed and transfected into lymphoid cell lines by
`electroporation44
`• In stage 1, the pSVgpt plasmids HuVHCAMP(cid:173)
`RalgG2B, HuVHCAMP(Ser-> Phe)-RalgG2B, HuVHCAMP(cid:173)
`(Ser27-> Phe, Ser30-> Thr)-RalgG2B were introduced into the
`heavy chain loss variant of YTH 34.5HL. In stage 2, the pSVgpt
`plasmids
`RaVHCAMP-RaigG2B,
`RaVHCAMP-HulgGl,
`RaVHCAMP-HulgG2, RaVHCAMP-HuigG3, RaVHCAMP(cid:173)
`HulgG4 were transfected as above. In stage 3, the pSV-gpt plasmid
`Hu(Ser27-> Phe, Ser30-> Thr)VHCAMP-HuigGl was co-trans(cid:173)
`fected with the pSV-neo plasmid HuVLCAMP-HulgK into the rat
`myeloma cell line YO (Y B2/3.0 Ag 20 (ref. 31). In each of the
`three stages, clones resistant to mycophenolic acid were selected
`and screened for antibody production by ELISA assays. Clones
`secreting antibody were subcloned by limiting dilution (for YO) or
`the soft agar method (for the loss variant) and assayed again before
`1 litre growth in roller bottles.
`
`Since, to a first approximation, the sequences of hypervariable
`regions do not contain characteristic rodent or human motifs,
`'reshaped' antibodies should be indistinguishable in
`such
`sequence from human antibodies.
`There are mAbs to many cell-type-specific differentiation anti(cid:173)
`gens, but only a few have therapeutic potential. Of particular
`interest is a group of rat mAbs directed against an antigen, the
`'CAMPATH-1' antigen, which is strongly expressed on virtually
`all human lymphocytes and monocytes, but is absent from other
`blood cells including the haemopoietic stem cells20
`• The
`CAMPATH-1 series contains rat mAb oflgM, IgG2a and lgG2c
`isotypes21
`, and more recently lgGl and lgG2b isotypes which
`were isolated as class-switch variants from the IgG2a-secreting
`cell line YTH 34.5HL22
`. All of these antibodies, except the rat
`IgG2c isotype, are able to lyse human lymphocytes efficiently
`with human complement. Also the lgG2b antibody YTH
`34.5HL-G2b, but not the other isotypes, is effective in antibody(cid:173)
`dependent cell-mediated cytotoxicity (ADCC) with human
`effector cells22
`• These rat mAbs have important applications in
`problems of immunosuppression: for example control of graft(cid:173)
`versus-host disease in bone-marrow transplantation20
`the
`;
`management of organ rejection23
`; the prevention of marrow
`rejection; and the treatment of various lymphoid malignancies
`(ref. 24 and M. J. Dyer, Hale, G., Hayhoe, F. G. J. and
`Waldmann, H., unpublished observations). The lgG2b antibody
`YTH 34.5HL-G2b seems to be the most effective at depleting
`lymphocytes in vivo but the use of all of these antibodies is
`limited by the anti-globulin response which can occur within
`two weeks of the initiation of treatment24
`• Here we describe the
`reshaping of human heavy and light chains towards binding the
`
`Table 1 Reshaping the heavy-chain variable domain
`
`Jieavy chain variable domain
`
`Concentration of antibody
`in µ.g ml- 1 at
`50%
`50%
`complement
`antigen
`lysis
`binding
`
`RaVHCAMP
`HuVHCAMP
`HuVHCAMP (Ser27-> Phe)
`HuVHCAMP (Ser 27->Phe, Ser 30->Thr)
`
`0.7
`27.3
`1.8
`2.0
`
`2.1
`
`16.3
`17.6
`
`Antibodies with the heavy-chain variable domains listed above, rat
`IgG2b constant domains and rat light chains were collected from super(cid:173)
`natants of cells at stationary phase and concentrated by precipitation
`with ammonium sulphate, followed by ion exchange chromatography
`on a Pharmacia MonoQ column. The yields of antibody were measured
`by an enzyme-linked immunosorbent assay (ELISA) directed against
`the rat IgG2b isotype, and each was adjusted to the same concentration35
`.
`To measuring binding to antigen, partially purified CAMPATH-1 anti(cid:173)
`gen was coated onto microtitre wells and bound antibody was detected
`via a biotin-labelled anti-rat IgG2b mAb 35
`, developed with a strep(cid:173)
`tavidin-peroxidase conjugate (Amersham). Complement lysis of human
`lymphocytes was with human serum as the complement source21 . For
`both binding and complement assays, antibody titres were determined
`by fitting the data to a sigmoid curve by at least squares iterative
`procedure21 .
`*Complement lysis with the HuVHCAMP variable domain was too
`weak for the estimation of lytic titre.
`
`CAMPATH-1 antigen and the selection of human effector func(cid:173)
`tions to match the lytic potential of the rat lgG2b isotype.
`Strategy
`The amino-acid sequences of the heavy- and light-chain variable
`domains of the rat IgG2a CAMPATH-1 antibody YTH 34.5HL
`were determined from the cloned complementary DNA (Fig. 1),
`and the hypervariable regions were identified according to
`Kabat25
`. In the heavy-chain variable domain there is an unusual
`feature in the framework region. In most known heavy-chain
`sequences Pro41 and Leu45 are highly conserved: Pro41 helps
`turn a loop distant from the antigen binding site and Leu45 is
`in the f3 bulge which forms part of the conserved packing
`between heavy- and light-chain variable domains 26
`• In YTH
`34.5HL these residues are replaced by Ala41 and Pro45 and
`presumably this could have some effect on the packing of the
`heavy- and light-chain variable domains. Working at the level
`of the gene and using three large mutagenic oligonucleotides
`for each variable domain, the rat hypervariable regions were
`mounted in a single step on the human heavy- or light-chain
`framework regions taken from the crystallographically solved
`proteins NEW27 and REI 28 respectively (Fig. 1). The REI light
`chain was used because there is a deletion at the beginning of
`the third framework region in NEW. The reshaped human
`heavy- and light-chain variable domains were then assembled
`with constant domains in three stage (Fig. 2). This permits a
`step-wise check on the reshaping of the heavy-chain variable
`domain (stage 1), the selection of the human isotype (stage 2),
`and the reshaping of the light-chain variable domain and the
`assembly of human antibody (stage 3). The plasmid construc(cid:173)
`tions were genomic, with the sequences encoding variable
`domains cloned as HindIII-BamHI fragments and those encod(cid:173)
`ing the constant domains as Barn HI- Barn HI fragments in either
`pSVgpt (heavy chain) 29 or pSVneo (light chain) 30 vectors. The
`heavy-chain enhancer sequence was included on the 5' side of
`the variable domain, and expression of both light and heavy
`chains was driven from the heavy-chain promoter and the heavy(cid:173)
`chain signal sequence.
`Heavy-chain variable domain
`In stage 1,
`the
`reshaped heavy-chain variable domain
`(HuVHCAMP) was attached to constant domains of the rat
`
`3 of 5
`
`Celltrion, Inc., Exhibit 1069
`
`
`
`326
`
`---!-
`----------~ARTICLES--
`
`NATURE VOL. 332 24 MARCH i 988
`- - - - - - - - - - - - - - - - - - - - - - -
`
`Fig. 3 Loop Phe27 to Tyr35 in the heavy-chain variable
`domain of the human myeloma protein KOL, which has
`been solved crystallographically45
`• The backbone of the
`hypervariable region according to Kabat25 is highlighted,
`and a 200% van der Waal surface is thrown around Phe 27
`to show the interactions with Tyr 32 and Met 34 of the
`Kabat hypervariable region. In the rat YTH 34.SHL heavy
`chain, these three side chains are conserved in character,
`but in HuVHCAMP, Phe27 is replaced by Ser.
`
`We therefore selected the human lgG 1 isotype for the
`reshaped antibody. Other recent work also favours the use of
`IgGl isotype for therapeutic application. When the effector
`functions of human isotypes were compared using a set of
`chimaeric antibodies with an anti-hapten variable domain, the
`IgG 1 isotype appeared superior to the lgG3 in both complement
`and cell-mediated lysis 15
`• Also, of two mouse chimaeric anti(cid:173)
`bodies with human IgGI or lgG3 isotypes directed against cell
`surface antigens as tumour cell markers, only the IgGl isotype
`14
`mediated complement lysis 13
`•
`.
`
`a 60
`
`50
`
`40
`
`"'
`~
`c 30
`~
`20
`<;
`a.
`
`10
`
`1 o
`.1
`100
`.01
`Antibody concentration, µ,g ml •1
`
`1,000
`
`b
`
`"' ·;;;
`~
`c
`" "' <;
`
`a.
`
`50
`
`40
`
`30
`
`20
`
`10
`
`.0001
`
`.001
`
`.01
`
`.1
`
`10
`
`100
`
`Antibody concentration, µ,g ml •1
`
`Fig. 4 a, Complement lysis and b, ADCC for antibodies with rat
`light-chain and rat heavy-chain variable domain attached to human
`IgGl (0), IgG2 (0), IgG3 (•),or IgG4 (V) isotypes. Lysis with
`the YTH 34.SHL antibody (e) is also shown.
`Methods. Antibody was collected from cells in stationary phase,
`concentrated by precipitation with ammonium sulphate and desal(cid:173)
`ted into phosphate buffered saline (PBS). Antibodies bound to the
`CAMPATH-1 antigen-coated on microtitre plates, were assayed
`in ELISA directed against the rat K light chain35
`, and each adjusted
`to the same concentration. The antibodies were assayed in comple(cid:173)
`ment lysis (Table 1) and ADCC with activated human peripheral
`46
`blood mononuclear cells35
`. Briefly, 5 x 104 human peripheral
`•
`blood cells were labelled with 51Cr and incubated for 30 min at
`room temperature with different concentrations of antibody. Excess
`antibody was removed and a 20-fold excess of activated cells added
`as effectors. After 4 h at 37 °C cell death was estimated by 51 Cr
`release.
`
`isotype IgG2b and transfected into a heavy-chain loss variant
`of the YTH 34.5 hybridoma. This variant carries two light chains,
`one derived from the Y3 fusion partner31
`• The cloned rat heavy(cid:173)
`chain variable domain (RaVHCAMP) was also expressed as
`above, and the antibodies were purified and quantified (Table
`1). The HuVHCAMP and RaVHCAMP antibodies, each of the
`rat IgG2b isotype, were compared to the CAMPATH-1 antigen
`in a direct binding assay and in complement lysis of human
`lymphocytes (Table I). Compared with the original rat antibody,
`or the engineered equivalent, the antibody with the reshaped
`heavy-chain domain bound poorly to the CAMPATH-1 antigen
`and was weakly lytic. This suggested an error in the design of
`the reshaped domain.
`There are several assumptions underlying the transfer of
`hypervariable loops from one antibody to another47
`, in particular
`the assumption that the antigen binds mainly to the hypervari(cid:173)
`able regions. These are defined as regions of sequence25 or
`structural 32 hypervariability, the locations of hypervariable
`regions being similar by both criteria except for the first hyper(cid:173)
`variable loop of the heavy chain. By sequence the first hyper(cid:173)
`variable loop extends from residues 31-35 (ref. 25) whereas by
`structure it extends from residues 26-32 (ref. 32). Residues 29
`and 30 form part of the surface loop, and residue 27, which is
`phenylalanine or tyrosine in most sequences, including YTH
`35.5HL, helps pack against residues 32 and 34 (Fig. 3). Unlike
`most human heavy chains, in NEW (see note in Fig. 1) the
`phenylalanine is replaced by serine, which would be unable to
`pack in the same way. To restore the packing of the loop, we
`made both a Ser 27 ~ Phe mutation, and a Ser 27 ~ Phe, Ser
`30~ Thr double mutation in HuVHCAMP. These two mutants
`showed a significant increase in binding to CAMPA TH-1 antigen
`and lysed human lymphocytes with human complement (Table
`I). Thus the affinity of the reshaped antibody could be restored
`by a single Ser 27 ~ Phe mutation, possibly as a consequence of
`an altered packing between the hypervariable regions and the
`framework. This suggests
`that alterations
`in the
`'Kabat'
`framework region can enhance the affinity of the antibody and
`extends previous work in which an engineered change in the
`hypervariable region yielded an antibody with
`increased
`affini ty3 3
`•
`Heavy-chain constant domains
`In stage 2 (Fig. 2), the rat heavy-chain variable domain was
`attached to constant domains of the human isotypes IgG I, 2, 3
`and 4, and transfected into the heavy-chain loss variant of the
`YTH 34.5 hybridoma. In complement lysis (Fig. 4a), the human
`lgGl isotype proved similar to the YTH 34.5HL-G2b, with the
`human lgG3 isotype being less effective. The human IgG2
`isotype was only weakly lytic and the lgG4 isotype was non-lytic.
`In ADCC (Fig. 4b) the human lgGI was more lytic than the
`YTH 34.5HL-G2b antibody. The decrease in lysis at higher
`concentrations of the rat IgG2b and the human IgGl antibody
`is due to an excess of antibody, which causes the lysis of effector
`cells. The human lgG3 antibody was weakly lytic, and the IgG2
`and IgG4 isotypes were non-lytic.
`
`4 of 5
`
`Celltrion, Inc., Exhibit 1069
`
`
`
`NATU RE VO L. 332 24 M_A_R_C _H_1_98_8 _____
`
`_ ______ ARTICLES----- -
`
`- - ---
`
`327
`
`a 60
`
`so
`
`40
`
`30
`
`"' "' >-
`c 20
`~
`Qi
`0..
`
`10
`
`.01
`
`.1
`
`10
`
`100
`
`Antibody concentration, µ.g m1·1
`
`b 60
`so
`
`"' "' >-
`c
`~
`Qi
`"-
`
`40
`
`30
`
`20
`
`10
`0001
`
`.001
`
`.01
`
`.1
`
`10
`
`100
`
`Antibody concentration , µ.g m1· 1
`Fig. S a, Complement lysis and b, ADCC of the reshaped human
`(~) and rat YTH 34.SHL (e) antibodies. Antibody HuVHCAMP
`(Ser27-> Phe, Thr30-> Ser)-Hu!GGI, HuVLCAMP-HulGK was
`purified from supernatants of cells in stationary phase by affinity
`chromatography on protein-A Sepharose. The yield (about
`IO mg 1- 1
`) was measured spectrophotometrically. Complement and
`ADCC assays were performed as in Fig. 4.
`Light chain
`In stage 3 (Fig. 2), the reshaped heavy chain was completed by
`attaching the reshaped HuVHCAMP (Ser27--> Phe, Ser30--> Thr)
`domain to the human IgGl isotype. The reshaped light-chain
`domain HuVLCAMP was attached to the human CK domain.
`The two clones were co-transfected into the non-secreting rat
`YO myeloma line. The resultant antibody, bound to CAMPATH-
`1 antigen (data not shown), and proved almost identical to the
`YTH 34.SHL-G2b antibody in complement lysis (Fig. Sa). In
`cell-mediated lysis the reshaped human antibody was more
`effective than the rat antibody (Fig. Sb). Similar results were
`
`obtained with three different donors of target and effector cells
`(data not shown). Also, the antibody was as effective as YTH
`34.SHL-G2b in killing leukaemic cells from three patients with
`B-cell lymphocytic leukaemia by complement-mediated lysis
`with human serum. Thus, by transplanting the hypervariable
`regions from a rodent to a human antibody of the lgG 1 subtype,
`we have reshaped the antibody for therapeutic application.
`Prospects
`The availability of a reshaped human antibody with specificity
`for the CAMPATH-1 antigen should permit a full analysis of
`the in vivo potency and immunogenicity of an anti-lymphocyte
`antibody with wide therapeutic potential. Even if anti-idiotypic
`responses are eventually observed, considerable therapeutic
`benefit could be derived from an extended course of treatment.
`Also, it should be possible to circumvent an anti-globulin
`response restricted to idiotype by using a series of antibodies
`with different idiotypes 34
`• In principle, the idiotype of the
`reshaped CAMPATH-1 could be changed by altering the hyper(cid:173)
`variable regions or the framework regions-evidence from a
`reshaped antibody specific for the hapten nitrophenyl acetate
`suggests that recognition by anti-idiotypic antisera and anti(cid:173)
`idiotypic mAbs is influenced by residues in the framework
`region 19
`. Thus, recycling the hypervariable regions on different
`human framework regions should change the idiotype, although
`ultimately it might focus the response directly onto the binding
`site for the CAMPATH-1 antigen . Although such focusing would
`be undesirable for CAMPATH-1 antibodies, it could be an
`advantage for the development of anti-idiotypic vaccines. It is
`likely that the answers to some of these questions will emerge
`from the use of this reshaped antibody in therapy.
`We thank J. Foote for the synthetic gene encoding the frame(cid:173)
`work regions of a human light chain; P. Leder, T. R. Rabbitts,
`T. Honjo, M. P. Lefranc respectively for clones encoding the
`constant regions of human K chain, human IgG2 and IgG4,
`human IgGl , human IgG3 ; G. Hale for CAMPATH-1 antigen
`and for advice; M. Bruggemann and M. S. Neuberger for sub(cid:173)
`clones of the heavy-chain constant regions 15 and for advice ; M.
`Frewin for technical assistance and C. Milstein for encourag