Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`0022-3565/04/3092-758–768
`THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
`U.S. Government work not protected by U.S. copyright
`JPET 309:758–768, 2004
`
`Vol. 309, No. 2
`62828/1143287
`Printed in U.S.A.
`
`Immune Cell Regulation and Cardiovascular Effects of
`Sphingosine 1-Phosphate Receptor Agonists in Rodents Are
`Mediated via Distinct Receptor Subtypes
`
`M. Forrest, S.-Y. Sun, R. Hajdu, J. Bergstrom, D. Card, G. Doherty,1 J. Hale,
`C. Keohane, C. Meyers, J. Milligan, S. Mills, N. Nomura, H. Rosen,2 M. Rosenbach,
`G.-J. Shei, I. I. Singer, M. Tian, S. West, V. White, J. Xie, R. L. Proia, and S. Mandala
`Departments of Immunology and Rheumatology, Pharmacology, and Medicinal Chemistry, Merck Research Laboratories,
`Rahway, New Jersey; and National Institutes of Health, Bethesda, Maryland (R.L.P.)
`Received November 11, 2003; accepted January 26, 2004
`
`ABSTRACT
`Sphingosine 1-phosphate (S1P) is a bioactive lysolipid with
`pleiotropic functions mediated through a family of G protein-
`coupled receptors, S1P1,2,3,4,5. Physiological effects of S1P
`receptor agonists include regulation of cardiovascular function
`and immunosuppression via redistribution of lymphocytes from
`blood to secondary lymphoid organs. The phosphorylated
`metabolite of the immunosuppressant agent FTY720 (2-
`amino-2-(2-[4-octylphenyl]ethyl)-1,3-propanediol) and other
`phosphonate analogs with differential receptor selectivity
`were investigated. No significant species differences in com-
`pound potency or rank order of activity on receptors cloned
`from human, murine, and rat sources were observed. All
`synthetic analogs were high-affinity agonists on S1P1, with
`IC50 values for ligand binding between 0.3 and 14 nM. The
`correlation between S1P1 receptor activation and the ED50
`for lymphocyte reduction was highly significant (p ⬍ 0.001)
`
`In contrast to S1P1-
`and lower for the other receptors.
`mediated effects on lymphocyte recirculation, three lines of
`evidence link S1P3 receptor activity with acute toxicity and
`cardiovascular regulation: compound potency on S1P3 cor-
`related with toxicity and bradycardia; the shift in potency of
`phosphorylated-FTY720 for inducing lymphopenia versus
`bradycardia and hypertension was consistent with affinity for
`S1P1 relative to S1P3; and toxicity, bradycardia, and hyper-
`⫺/⫺ mice. Blood pressure effects
`tension were absent in S1P3
`of agonists in anesthetized rats were complex, whereas hy-
`pertension was the predominant effect in conscious rats and
`mice. Immunolocalization of S1P3 in rodent heart revealed
`abundant expression on myocytes and perivascular smooth
`muscle cells consistent with regulation of bradycardia and
`hypertension, whereas S1P1 expression was restricted to the
`vascular endothelium.
`
`Sphingosine 1-phosphate (S1P) is a bioactive lipid derived
`from metabolism of sphingomyelin (Pyne and Pyne, 2000).
`S1P has been implicated in the regulation of many cellular
`functions including proliferation, apoptosis, survival, adhe-
`sion, differentiation, and migration (Hla et al., 2001). The
`diverse signaling has been attributed, in part, to the activa-
`tion of a family of G protein-coupled receptors called S1P or
`edg receptors that are differentially expressed and coupled to
`Gi/o, Gq, and G12/13 proteins (Chun et al., 2002).
`Few pharmacological tools with in vivo activity have
`
`1 Present address: Array BioPharma, Boulder, CO.
`2 Present address: The Scripps Research Institute, La Jolla, CA.
`Article, publication date, and citation information can be found at
`http://jpet.aspetjournals.org.
`DOI: 10.1124/jpet.103.062828.
`
`been described for the S1P receptors, but functions of the
`individual receptors are beginning to be elucidated. S1P1/
`edg1 has a widespread distribution and is highly abundant
`on endothelial cells where it works in concert with S1P3/
`edg3 to regulate cell migration, differentiation, and barrier
`function (Lee et al., 1999; Garcia et al., 2001). Although
`these receptors stimulate some pathways in common, they
`are not redundant. The S1P1 null embryos are defective in
`the migration of smooth muscle cell pericytes that are
`required to support vascular maturation and the embryos
`die at day 13.5 from hemorrhage (Liu et al., 2000). In
`contrast, the S1P3 null mouse is phenotypically normal
`(Ishii et al., 2001). S1P2/edg5 is a potent activator of the
`Rho pathway and inhibits cell migration, whereas S1P1
`and S1P3 stimulate chemotaxis of many cell types (Oka-
`
`ABBREVIATIONS: S1P, sphingosine 1-phosphate; IK.Ach, inwardly rectifying K⫹ currents; CHO, Chinese hamster ovary; MAP, mean arterial
`[35S]GTP␥S, guanosine 5⬘-O-(3-[35S]thio)triphosphate; FTY720, 2-amino-2-(2-[4-octylphenyl]
`pressure; DAPI, 4,6-diamidino-2-phenylindole;
`ethyl)-1,3-propanediol; PECAM, platelet-endothelial cell adhesion molecule.
`
`758
`
`Apotex v. Novartis
`IPR2017-00854
`NOVARTIS 2009
`
`

`

`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`Immune Cell Regulation and Cardiovascular Effects of S1P Receptor Agonists
`
`759
`
`moto et al., 2000; Graeler and Goetzl, 2002). Much less is
`known about the function of S1P4/edg6, which is restricted
`to hematopoietic and lymphoid tissues (Graeler et al.,
`1999), and S1P5/edg8, which is predominant in rodent
`brain (Im et al., 2000) but more broadly expressed in
`human tissues (Niedernberg et al., 2002).
`A novel physiological role for S1P in immune regulation
`has been discovered recently by elucidating the mechanism
`of FTY720 (Brinkmann et al., 2002; Mandala et al., 2002), an
`immunosuppressive agent with activity in many models of
`transplantation and immune-based disease (Dumont, 2000;
`Brinkmann et al., 2001). FTY720 depletes peripheral blood
`lymphocytes and sequesters them in secondary lymphoid
`organs (Chiba et al., 1998). We discovered that FTY720 is
`phosphorylated in vivo to become a high-affinity ligand
`(Compound A) for S1P1,3,4,5 but not S1P2 (Mandala et al.,
`2002). A non-hydrolyzable phosphonate analog (Compound
`B) with similar S1P receptor selectivity was also able to alter
`lymphocyte recirculation (Mandala et al., 2002). Close ana-
`logs of FTY720, such as the (S) enantiomer of 2-amino-4-(4-
`heptyloxyphenyl)-2-methylbutanol, that were not substrates
`for phosphorylation did not have immunosuppressive activ-
`ity, thus providing additional evidence that the phosphory-
`lated metabolite is the active species (Brinkmann et al., 2002;
`Mandala et al., 2002). The receptor(s) responsible for im-
`mune modulation has not been determined, although both
`S1P1 and S1P4 have been implicated based on their roles in
`regulating lymphocyte chemotaxis (Brinkmann et al., 2001;
`Dorsam et al., 2003).
`Clinical studies with FTY720 have identified dose-depen-
`dent transient asymptomatic bradycardia in stable renal
`transplant patients (Budde et al., 2002). Although there are
`no published reports on the effects of FTY720 on heart rate in
`rodents, S1P decreased heart rate in anesthetized rats (Sug-
`iyama et al., 2000a). Bradycardia is consistent with previous
`reports of S1P activation of muscarinic receptor-activated
`inwardly rectifying K⫹ currents (IK.Ach) and concomitant
`slowing of sino-atrial node pacemaker activity (Bunemann et
`al., 1995; Guo et al., 1999). In contrast to observations in rats,
`S1P administration to a canine isolated heart preparation
`evoked a sinus tachycardia (Sugiyama et al., 2000b). The
`effects of S1P receptor agonists on vascular tone and mean
`arterial pressure (MAP) are similarly complex. FTY720 has
`not been reported to have any effects on MAP in man. How-
`ever, FTY720 has been shown to either decrease or increase
`MAP in anesthetized rats (Tawadrous et al., 2002). On iso-
`lated vascular preparations, S1P induced relaxation at low
`concentrations (10–100 nM) (Dantas et al., 2003) and vaso-
`constrictor effects at higher concentrations (100 nM to 100
`␮M) (Bischoff et al., 2000; Tosaka et al., 2001). The complex
`cardiovascular effects of S1P receptor agonists are likely due
`to differential effects on S1P receptor subtypes. S1P2 contrac-
`tion of coronary smooth muscle cells was implicated using a
`selective antagonist (Ohmori et al., 2003) but antisense to
`S1P3, not S1P2, inhibited contraction of rat basilar arteries
`(Salomone et al., 2003). The availability of S1P subtype re-
`ceptor-selective agonists with in vivo activity that are de-
`scribed in this paper and S1P3 receptor knockout mice allows
`for a more detailed investigation of the cardiovascular and
`lymphocyte trafficking effects of S1P agonists.
`
`Materials and Methods
`Synthesis of S1P Receptor Agonists. The syntheses of Com-
`pounds A and B have been described previously (Mandala et al.,
`2002). Compound C was prepared in seven steps from 2-acetylamino-
`2-(2-(4-octylphenyl)ethyl)propane-1,3-dicarboxylic acid, diethyl ester
`(Durand et al., 2000). Compounds D to F were prepared by reductive
`amination of the appropriate aryl aldehyde with 3-aminopropylphos-
`phonic acid [Na(CN)BH3, MeOH, 50°C]. All compounds were char-
`acterized by 1H NMR, mass spectroscopy, and high-pressure liquid
`chromatography and were judged to be ⬎95% pure. Detailed proce-
`dures are provided in patents WO 03074008 and WO 03062252.
`Mouse Lymphocyte Reduction Assay. Mice (three per group)
`were dosed intravenously with 0.1 ml of test compound dissolved in
`vehicle [2% (w/v) hydroxypropyl-␤-cyclodextrin (Cerestar, Cedar
`Rapids, IA) and 0.12 M NaCl], and peripheral blood lymphocyte
`counts were assessed 3 h later. Mice were euthanized via CO2 inha-
`lation, the chest was opened, 0.5 ml of blood was withdrawn via
`direct cardiac puncture into EDTA, and hematology was evaluated
`using a clinical hematology AutoAnalyzer calibrated for performing
`murine differential counts (H2000; CARESIDE, Culver City, CA).
`Toxicity was observed upon administration of some of the test com-
`pounds. Severe signs included death, seizure, paralysis, or uncon-
`sciousness. Milder signs were also noted and included ataxia, la-
`bored breathing, ruffling, or reduced activity relative to normal. To
`assess lymphopenic activity with these compounds, upon noting
`symptoms in the first animal, the dosing solution was diluted in the
`same vehicle and administered to a second mouse for observation.
`The process was repeated until a dose was reached that produced
`only brief, mild symptoms. This was considered the maximum toler-
`ated dose. All procedures were performed in accordance with the
`highest standards for the humane handling, care, and treatment of
`research animals and were approved by the Merck Institutional
`Animal Care and Use Committee.
`Receptors and Cell Lines. CHO cells stably expressing human
`S1P1,2,3,4,5 were as previously described (Mandala et al., 2002). cDNA
`sequences encoding rodent S1P receptors were cloned from genomic
`DNA by polymerase chain reaction using the following primers for
`each respective receptor: 5⬘-GAACCCGGGTGTCCACTAGCATC-
`CCGG and 5⬘-CCCGAATTCTTAGGAAGAAGAATTGACGTTTCC
`(mouse S1P1), 5⬘-GAACCCGGGCGGCTTATACTCAGAGTACC and
`5⬘-GGCGAATTCTCAGACCACTGTGTTACCCTC (mouse S1P2), 5⬘-
`GAACCCGGGCAACCACGCATGCGCAGG and 5⬘-GTCGAATTCT-
`CACTTGCAGAGGACCCCG (mouse S1P3), 5⬘-GAACCCGGGAA-
`CATCAGTACCTGGTCCACGC and GCGGAATTCTAGGTGCTGC-
`GGACGCTGG (mouse S1P4), 5⬘-GAACCCGGGCTGCTGCGGCCGG
`and 5⬘-CGCGAATTCAGTCTGTAGCAGTAGGCACC (mouse S1P5),
`5⬘- GTAGGATCCGTGTCCTCCACCAGCATC and 5⬘-GGCCGAAT-
`TCTTAAGAAGAAGAATTGACGTTTC (rat S1P1), and 5⬘- GAAC-
`CCGGGCATCCACGCATGCGCAG and 5⬘-GCCGAATTCTCACTT-
`GCAGAGGACCCCATTCTG (rat S1P3). The polymerase chain
`reaction products were inserted in frame after a FLAG tag using
`vector pCMV-Tag2 (Stratagene, La Jolla, CA). Stable lines were
`established by transfecting plasmids into CHO cells using lipo-
`fectamine reagent, selecting for neomycin resistance, and screen-
`ing single cell cultures for increased [33P]S1P-specific binding.
`Membranes were prepared from positive clones and confirmed in
`[33P]S1P and [35S]GTP␥S binding assays.
`S1P Receptor Assays. Binding assays were conducted as previ-
`ously described (Mandala et al., 2002). In brief, [33P]S1P was soni-
`cated with fatty acid-free bovine serum albumin, added to test com-
`pounds diluted in dimethyl sulfoxide, and mixed with membranes in
`200 ␮l in 96-well plates with assay concentrations of 0.1 nM [33P]S1P
`(22,000 dpm), 0.5% bovine serum albumin, 50 mM HEPES-Na (pH
`7.5), 5 mM MgCl2, 1 mM CaCl2, and 0.3 to 0.7 ␮g of membrane
`protein. Binding was performed for 60 min at room temperature and
`terminated by collecting the membranes onto GF/B filter plates with
`a Packard Filtermate Universal Harvester. Filter bound radionu-
`
`

`

`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`760
`
`Forrest et al.
`
`clide was measured on a PerkinElmer 1450 MicroBeta. Specific
`binding was calculated by subtracting radioactivity that remained in
`the presence of 1000-fold excess of unlabeled S1P.
`To measure functional activation of the S1P receptors, [35S]GTP␥S
`binding was measured. Membranes (1–4 ␮g of protein) were incu-
`bated in 96-well plates with test compounds diluted in dimethyl
`sulfoxide in 100 ␮l of buffer containing 20 mM HEPES (pH 7.4), 100
`mM NaCl, 10 mM MgCl2, and 2 to 10 ␮M GDP, depending on the
`expressed receptor. The assay was initiated with the addition of 100
`␮l of [35S]GTP␥S (1200 Ci/mmol; PerkinElmer Life and Analytical
`Sciences, Boston, MA) for an assay concentration of 125 pM. After 60
`min of incubation at room temperature, membranes were harvested,
`onto GF/B filter plates and bound radionuclides were measured as
`described for ligand binding. S1P was subject to significant dephos-
`phorylation in the [35S]GTP␥S binding assay as measured with
`[33P]S1P or [3H]S1P. EC50 values are not reported for S1P. Degra-
`dation of S1P was less than 10% in the [33P]S1P binding assay, and
`[3H]-Compound A was not metabolized under either assay condition.
`Assessment of Cardiovascular Function. Cardiovascular
`function was assessed in anesthetized and conscious rats and in
`conscious mice. Anesthetized rats were used to evaluate the dose-
`dependent profile of cardiovascular responses to S1P receptor ago-
`nists of differing S1P receptor selectivity. Conscious rats were used
`to verify data from anesthetized animals and to allow a longer period
`of observation (4 h) that included a concurrent assessment of the
`induction of lymphopenia. The use of conscious mice allowed a com-
`parison of compound effects in wild-type animals and mice with
`genetic deletion of the S1P3 receptor.
`Anesthetized Rat Cardiovascular Assay. For the assessment
`of cardiovascular function in anesthetized rats, male Sprague-Daw-
`ley rats (300–350 g. b.wt.) with surgically implanted femoral artery
`and vein catheters were obtained from Charles River Laboratories
`(Raleigh, NC). Animals were anesthetized with Nembutal (55 mg/kg,
`i.p.), and a DTX pressure transducer (TNF-R; BD Biosciences, San
`Jose, CA) was attached to the arterial catheter and subsequently to
`a Gould ACQ-7700 data acquisition system using Po-Ne-Mah soft-
`ware (PNM-P3P) (Gould Instrument Systems, Valley View, OH).
`Heart rate was derived from the arterial pulse wave. Following an
`acclimation period, baseline values were determined (approximately
`20-min duration); subsequently, compounds were administered in-
`travenously (bolus injection of approximately 10 s). Cardiovascular
`data were recorded continuously and are reported as average values
`over 1-min intervals.
`Conscious Rat Cardiovascular Assay. For the assessment of
`cardiovascular function in conscious rats, male Sprague-Dawley rats
`(300–350 g. b.wt.) with surgically implanted femoral artery and vein
`catheters were obtained from Charles River Laboratories. The cath-
`eters were connected to a tether (CIH95) and swivel (375/20; Instech
`Laboratories, Inc., Plymouth Meeting, PA), allowing the animal to
`move freely around the cage. Animals were allowed a minimum
`2-day acclimation prior to further experimentation. On the day of
`study, a BD Biosciences DTX pressure transducer (TNF-R) was
`attached to the arterial catheter and subsequently to a Gould ACQ-
`7700 data acquisition system using Po-Ne-Mah software. Heart rate
`was derived from the arterial pulse wave. Heart rate and arterial
`pressure were measured for between 30 and 60 min to establish
`baseline values. Subsequently, compound or vehicle was adminis-
`tered as a continuous intravenous infusion of 25 ␮l/min for 4 h. Blood
`samples, for the evaluation of circulating leukocytes, were obtained
`from the arterial catheter 30 min prior to dosing and 1 and 4 h post
`initiation of the infusion. Cardiovascular data were recorded contin-
`uously and are reported as average values over 1-min intervals.
`Mouse Cardiovascular Assay. For the assessment of cardiovas-
`cular function in conscious mice, the S1P3 receptor was genetically
`deleted (R. L. Proia, manuscript submitted for publication) and bred
`⫺/⫺
`at Taconic Farms Inc. (Germantown, NY). Male (B6.129) S1P3
`⫹/⫹ mice (20–30 g b.wt.) were anesthetized with ketamine
`and S1P3
`(80–100 mg/kg, i.p.) and xylazine (10 mg/kg, i.p.), and catheters were
`
`placed in a carotid artery (PE-50, with tip modified) and Jugular vein
`(PE-10). The catheters were tunneled subcutaneously to the nape
`and exteriorized. The catheters were connected to a tether (CIH62)
`and swivel (375/25P; Instech Laboratories, Inc.), allowing the animal
`to move freely around the cage. Following surgery, animals were
`allowed an overnight recovery period prior to further experimenta-
`tion. On the day of study, a BD Biosciences DTX pressure transducer
`was attached to the arterial catheter and subsequently to a Gould
`ACQ-7700 data acquisition system using Po-Ne-Mah software. Heart
`rate was derived from the arterial pulse wave. Heart rate and arte-
`rial pressure were measured for between 30 and 60 min to establish
`baseline values. Subsequently, compound or vehicle was adminis-
`tered intravenously as a bolus of 10-s duration. Cardiovascular data
`were recorded continuously and are reported as average values over
`10-s intervals.
`Immunohistochemical Localization of S1P1 and S1P3 in Rat
`Heart. Peptides to the N terminus of mouse S1P3 (ATTHAQGHQPV-
`LGNDTLREHYDYVGKLAGRLRDPPEGGTL) and mouse S1P1 (VST-
`SIPEVKALRSSVSDYGNYDIIVRHYNYTGKLNIGAEKDHGIK) and
`the C terminus of S1P1 (EGDNPETIMSSGNVNSSS) were synthesized
`(SynPep Corp., Dublin, CA), conjugated to KLH, and used to immunize
`rabbits (Covance Research Products, Denver, PA). Specific IgG frac-
`tions were affinity purified using the immunizing peptides. The result-
`ing antisera were tested by Western blot across a panel of human,
`mouse, and rat S1P receptors. MS2031 to S1P3 was specific for the
`rodent S1P3 receptors. For the S1P1 antisera, MS2029 to the N termi-
`nus was specific for rodent S1P1, whereas the C-terminal antisera,
`MS1766, recognized human and rodent S1P1. Staining by Western and
`immunohistochemistry was blocked by incubation with the relevant but
`not the irrelevant peptide.
`For histochemical studies, blocks of atrium or ventricle from rats
`or mice treated with a lethal dose of sodium pentobarbital were
`rapidly dissected out and immediately placed in cryomolds (catalog
`no. 4557; TissueTek, Torrance, CA) filled with O.C.T. Compound
`(TissueTek catalog no. 4583), frozen in liquid nitrogen, and stored at
`⫺80°C. Frozen sections were cut (5-␮m thickness) on a Bright Model
`OTF cryotome (Hacker Instruments, Fairfield, NJ) and mounted on
`coated slides (catalog no. CFSACS; Instrumedics, Inc., Hackensack,
`NJ). To block nonspecific labeling, sections were treated with 5%
`donkey serum in PBS for 20 min, then with a clarified solution of 5%
`nonfat dry milk for 30 min, and finally with Fc blocker (Accurate
`Chemical, Westbury, NY) for 20 min. Sections were labeled for 1 h
`with affinity-purified primary antibodies or appropriate IgG controls
`(5 ␮g/ml): rabbit anti-mouse S1P1, rabbit anti-human S1P1, rabbit
`anti-mouse S1P3, and mab anti-rat PECAM (CD31 Pharmingen,
`catalog no. 555025; BD PharMingen, San Diego, CA). All nonimmune
`IgG controls were obtained from Jackson ImmunoResearch Labora-
`tories Inc. (West Grove, PA). Slides were washed and incubated with
`affinity-purified F(ab⬘)2 donkey anti-rabbit or rat Cy2 (green fluores-
`cence) or Cy3 (red fluorescence) conjugated secondary antibodies (5
`␮g/ml, 30 min) from Jackson ImmunoResearch Laboratories Inc. For
`double labeling studies, two primary antibodies raised in different
`species or corresponding species-specific fluorescent secondary anti-
`bodies were mixed together and incubated simultaneously on each
`slide. Nonimmune IgG controls also were run in this fashion. Spec-
`ificity also was demonstrated by pre-incubating each primary anti-
`body at staining concentrations with its relevant or irrelevant pep-
`tide at 5 ␮g/ml for 1 h and centrifugation for 1 h at 13,500g at 4°C
`(Beckman Microfuge 11; Beckman Coulter, Fullerton, CA). After
`staining, the slides were fixed for 30 min in 4% formaldehyde freshly
`generated from paraformaldehyde in phosphate buffer (pH 7.4; cat-
`alog no. 04042500; Fisher Scientific Co., Pittsburgh, PA). Coverslips
`were mounted on the slides with Vectashield plus DAPI nuclear
`stain (catalog no. H1200, Vector Laboratories, Burlingame, CA).
`Sections were photographed and analyzed with an Everest imaging
`system from Intelligent Imaging Innovations (Denver, CO) equipped
`with an Axioplan 2 microscope (Carl Zeiss, Go¨ttingen, Germany).
`This system allows the viewer to visualize two different fluoro-
`
`

`

`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`Immune Cell Regulation and Cardiovascular Effects of S1P Receptor Agonists
`
`761
`
`Fig. 1. Chemical structures of S1P and synthetic
`S1P receptor agonists.
`
`chrome conjugated secondary antibodies individually or in combina-
`tion on the same section in double labeling experiments.
`
`with an ED50 of 2.2 mg/kg. No toxicity was observed with
`Compounds E and F.
`To investigate S1P receptor selectivity of the analogs, they
`
`Results
`Lymphopenia, Toxicity, and in Vitro Activity of S1P
`Receptor Agonists. The phosphonate analog (Compound B)
`of the phosphate-ester metabolite of FTY720 (Compound A)
`was found previously to deplete peripheral blood lympho-
`cytes with a 15-fold right shift in potency relative to FTY720
`(Mandala et al., 2002). The shift in potency was consistent
`with its reduced affinity for S1P receptors. In an effort to
`identify more potent immunosuppressive compounds and ex-
`plore structure activity relationships, additional analogs
`were synthesized (Fig. 1). Using a 3-h murine assay, Com-
`pound C and several analogs in the secondary amine phos-
`phonate series were found to reduce circulating blood lym-
`phocytes (Fig. 2). Compound D was 2-fold less active than
`Compound A and was the most potent phosphonate analog
`tested. However, efficacy could only be assessed within a
`narrow concentration range due to toxicity. Doses higher
`than 0.05 mg/kg of Compound D induced symptoms of ataxia
`and paralysis, and 0.25 mg/kg was lethal. Compounds C and
`E were 5- to 10-fold less active than D in reducing peripheral
`blood lymphocytes, and compound F had the weakest activity
`
`Fig. 2. Dose response of S1P receptor agonists in peripheral blood lym-
`phocyte depletion. Compounds were administered as an intravenous bo-
`lus to mice (n ⫽ 3), and total blood lymphocytes were determined 3 h
`later.
`
`

`

`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`762
`
`Forrest et al.
`
`were tested against human receptors expressed in CHO cells
`in competitive ligand binding assays using [33P]S1P as the
`ligand and functional assays of G protein coupling using
`[35S]GTP␥S binding (Table 1). As previously determined for
`Compounds A and B, none of the phosphonates had signifi-
`cant activity against S1P2. All compounds were agonists on
`the other four S1P receptors, and maximal efficacy in
`[35S]GTP␥S binding was similar to that observed with Com-
`pound A. Compound D was the most potent phosphonate on
`S1P1 with an IC50 of 0.9 nM that was only 2- to 3-fold less
`active than S1P or Compound A. Compound D was also the
`most active synthetic analog on S1P3, with an IC50 of 7.9 nM
`that was equivalent to Compound A but less potent relative
`to S1P. The 2-bromo and 5-methoxy substitutions to the
`phenyl ring found in Compounds E and F resulted in modest
`decreases in affinity for S1P1 and a substantial loss in activ-
`ity on S1P3, which was further reduced by shortening the
`alkyl chain length in Compound F. All of the phosphonates
`had similar activity on S1P4, making this receptor unlikely to
`account for the differential effects of the analogs on lym-
`phopenia or toxicity. Likewise, S1P5 did not appear to be a
`probable candidate for either in vivo effect given the equiva-
`lent potency of all three of the secondary amine compounds
`and the 20-fold reduced activity of Compound C on S1P5
`relative to Compounds D to F.
`Correlations between rodent in vivo pharmacological ef-
`fects and human in vitro receptor assays can be misleading
`unless there is a high degree of conservation in the ligand
`binding pocket of the receptors. To address this issue, we
`cloned mouse S1P1,3,4,5 and rat S1P1,3 receptors and estab-
`lished stable CHO lines and assays that were comparable to
`those used to assess the human receptors. The overall homol-
`ogy between rodent and human S1P receptors ranged from
`80% to 93%, with S1P1 being the most conserved protein.
`Ligand binding assays using the rodent receptors (Table 2)
`revealed that the natural ligand and the synthetic com-
`pounds maintained similar potency and the same rank order
`of activity, thus indicating that there were no significant
`differences between rodent and human structure activity
`relationships. As was deduced previously from the human
`receptors, the correlation between S1P1 receptor activation
`
`and the ED50 for lymphopenia was highly significant (p ⬍
`0.001) and much lower for the other receptors. All of the
`compounds had low or sub-nanomolar potency on S1P1, and
`the rank order of activity was Compound A ⬎ D ⬎ C ⬎ E ⬎ F.
`Intravenous administration of some of the compounds
`evoked toxicity with symptoms that ranged from transient
`ruffling and paralysis to lethality. Compound D was the least
`tolerable compound tested and the most potent synthetic
`analog on mouse S1P3 with an IC50 of 1.8 nM. The other two
`compounds in the secondary amine series (E and F) had
`considerably reduced potency at mouse S1P3 with IC50 val-
`ues of 0.6 and 6.6 ␮M, respectively, and did not induce any
`adverse symptoms in mice. Only mild, transient toxicity was
`observed with Compound C, which had intermediate activity
`on S1P3. Compound A induced transient signs of toxicity in
`mice but was not lethal up to 10 mg/kg, whereas S1P was
`highly toxic and was the most potent ligand for S1P3. To test
`whether toxicity was mediated via S1P3, as suggested by the
`correlation of in vitro receptor potency with the maximal
`tolerated dose (Table 2), the severely toxic compounds were
`⫺/⫺ mice, S1P and Com-
`studied in S1P3 null mice. In S1P3
`pound D did not induce any toxic symptoms at 25 and 5
`mg/kg, respectively, whereas they were rapidly lethal in their
`wild-type litter mate controls at doses of 5 and 0.25 mg/kg,
`⫺/⫺ mice were fully susceptible to agonist-
`respectively. S1P3
`mediated lymphocyte depletion; peripheral blood lymphocyte
`counts from Compound D treated mice were 1.6 ⫻ 106/ml
`compared with 5.0 ⫻ 106/ml for vehicle-treated mice (p ⬍ 0.01).
`Effects of S1P Receptor Agonists in Anesthetized
`Rats. Administration of either S1P (Fig. 3A) or the S1P1,3,4,5
`agonist, Compound A (Fig. 3B), to anesthetized rats evoked
`an immediate decrease in heart rate, reaching a nadir within
`1 to 2 min of compound administration and returning toward
`baseline values within 10 min. The effects on mean arterial
`pressure were more complex. Initially, a rapid hypotension
`was observed that reversed concomitantly with an increase
`in heart rate. In some instances, an overshoot to a transient
`hypertension was observed before returning to baseline. Sub-
`sequently, a gradually developing somewhat variable hyper-
`tension was seen that peaked approximately 10 min post-
`compound administration before resolving within 20 min.
`
`TABLE 1
`Activity of compounds on human S1P receptors
`Compounds were tested in 关33P兴S1P binding assays to determine IC50 values and 关35S兴GTP␥S binding assays to determine EC50 values using membranes prepared from CHO
`cells expressing human S1P receptors. Values are the mean of two to six measurements performed in duplicate. S1P is subject to extensive metabolism under standard
`关35S兴GTP␥S binding assay conditions, and EC50 values are not shown.
`
`S1P
`
`0.5
`ND
`
`0.3
`ND
`
`0.2
`ND
`
`55
`ND
`
`0.5
`ND
`
`A
`
`0.3
`0.3
`
`⬎1000
`⬎1000
`
`5.0
`3.0
`
`5.9
`4.3
`
`0.6
`1.0
`
`C
`
`3.2
`2.9
`
`⬎1000
`⬎1000
`
`125
`109
`
`160
`45
`
`108
`171
`
`nM
`
`D
`
`0.9
`1.2
`
`⬎1000
`⬎1000
`
`7.9
`7.3
`
`114
`ND
`
`5.0
`1.3
`
`E
`
`2.4
`1.9
`
`⬎1000
`⬎1000
`
`1424
`1145
`
`77
`83
`
`7.5
`4.4
`
`F
`
`12.0
`12.8
`
`⬎1000
`⬎1000
`
`9265
`⬎10,000
`
`380
`ND
`
`6.8
`5.6
`
`S1P1
`IC50
`EC50
`S1P2
`IC50
`EC50
`S1P3
`IC50
`EC50
`S1P4
`IC50
`EC50
`S1P5
`IC50
`EC50
`ND, not determined.
`
`

`

`Immune Cell Regulation and Cardiovascular Effects of S1P Receptor Agonists
`
`763
`
`TABLE 2
`Lymphopenic and toxic effects of compounds in mice compared with binding activity on rodent S1P receptors
`ED50 values (⫾S.E.) are the dose (in milligrams per kilogram) that produces 50% of the maximum reduction in peripheral blood lymphocytes at 3 h. Toxicity is the maximum
`tolerated dose (milligrams per kilogram) as defined under Materials and Methods. Compounds were tested in vitro in 关33P兴S1P binding assays to determine IC50 values
`(nanomolar) using membranes prepared from CHO cells expressing mouse and rat S1P receptors.
`
`PBL ED50
`Toxicity
`mS1P1 IC50
`rS1P1 IC50
`mS1P3 IC50
`rS1P3 IC50
`mS1P4 IC50
`mS1P5 IC50
`ND, not determined.
`
`S1P
`
`ND
`0.4
`0.3
`0.3
`0.3
`0.3
`40
`0.3
`
`A
`
`0.03 (0.01)
`1.0
`0.3
`0.3
`2.7
`3.1
`28
`0.5
`
`C
`
`0.32 (0.08)
`4.0
`2.5
`2.1
`71
`74
`99
`29
`
`D
`
`0.063 (0.007)
`0.05
`0.9
`0.8
`1.8
`2.6
`130
`2.8
`
`E
`
`0.7 (0.4)
`⬎10
`4.1
`4.2
`605
`825
`109
`7.1
`
`F
`
`2.2 (0.8)
`⬎30
`14.6
`6.4
`6576
`7172
`200
`4.2
`
`Downloaded from
`
`jpet.aspetjournals.org
`
` at ASPET Journals on May 1, 2017
`
`ated for their ability to evoke bradycardia in the anesthetized
`rat. The extent of bradycardia, expressed as the peak decrease
`in heart rate as a percentage change from the average baseline
`value recorded for 20 min prior to compound administration, is
`shown in Fig. 4. The rank order of potency of S1P agonists for
`producing bradycardia in the anesthetized rat was Compound
`A ⱖ D ⬎ E ⬃ S1P ⬎⬎ Compound F. The reduced effects of
`Compounds E and F on heart rate are consistent with their
`reduced IC50 values against S1P3 in vitro.
`Effects of S1P Receptor Agonists in Conscious Rats.
`Administration of Compound A by continuous intravenous
`infusion to conscious rats produced time- and dose-dependent
`lymphopenia, bradycardia, and hypertension. At a dose of 10
`␮g/kg/min, bradycardia (Fig. 5A) and hypertension (Fig. 5B)
`were evident within 15 to 30 min postinitiation of infusion,
`with slower onset of effects at lower doses of compound (data
`not shown). Similarly, upon cessation of infusion, cardiovas-
`cular parameters returned to baseline values within 15 to 30
`min. The decrease in circulating leukocytes was also dose
`dependent (Fig. 6). The dose dependence for the pharmaco-
`logical effects of Compound A in conscious rats (Fig. 6) indi-
`cates that maximal lymphopenia was obtained at an infusion
`dose of less than 0.1 ␮g/kg/min, whereas significant changes
`in heart rate and mean arterial pressure were not evident
`until doses of 1 ␮g/kg/min or greater were administered.
`Effects of S1P Receptor Agonists in Conscious Mice.
`Toxicity of S1P and Compound D were abrogated in mice
`with a genetic deletion of the S1P3 receptor. In accordance,
`the cardiovascular effects of S1P receptor agonists were eval-
`
`Fig. 3. The effects of S1P (A) and Compound A (B) on mean arterial
`pressure (MAP) and heart rate (HR) were evaluated in barbiturate-
`anesthetized rats (three per group). HR and MAP were recorded contin-
`uously and are expressed as average values at 1-min intervals. Error bars
`have been omitted for the sake of clarity. Compounds were administered
`(arrow) as an intravenous bolus of approximately 10-s duration at 0.2 (A)
`or 0.05 (B) mg/kg. Significant differences from baseline control values are
`shown as: ⴱ, p ⬍ 0.05 for HR; and c, p ⬍ 0.05 for MAP.
`
`This late hypertension attained statistical significance in
`animals administered S1P but not in those administered
`Compound A.
`The effects of S1P receptor agonists with varying in vitro
`potency for activation of S1P1 and S1P3 receptors were evalu-
`
`Fig. 4. The effects of S1P receptor agonists on heart rate (HR) were
`evaluated in barbiturate-anesthetized rats. HR was determined for