Food Chemistry 211 (2016) 253–259
`
`Contents lists available at ScienceDirect
`
`Food Chemistry
`
`j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / f o o d c h e m
`
`Analytical Methods
`Specific PCR assays to determine bovine, porcine, fish and plant origin of
`gelatin capsules of dietary supplements
`Jae-Hwang Lee b,1, Mi-Ra Kim a,1, Cheon-Ho Jo a, Yoo-Kyung Jung a, Kisung Kwon a, Tae Sun Kang a,⇑
`
`a New Hazardous Substance Team, Food Safety Evaluation Department, National Institute of Food and Drug Safety Evaluation, Ministry of Food and Drug Safety,
`187 Osongsaengmyeong 2-ro, Osong-eup, Heungdeok-gu, Cheongju-si, Chungcheongbuk-do 28159, South Korea
`b Department of Food Science, Graduate School, Kyung Hee University, Yongin 17104, Republic of Korea
`
`a r t i c l e
`
`i n f o
`
`a b s t r a c t
`
`Article history:
`Received 2 September 2015
`Received in revised form 29 February 2016
`Accepted 10 May 2016
`Available online 11 May 2016
`
`Keywords:
`Species-specific primer
`Universal primer
`Food fraud
`Whole-genome amplification
`
`Gelatin, a purified protein derived mostly from pig skin and bovine tissue, is used widely in both food and
`pharmaceutical industries. Here, to determine the species of origin of capsule gelatin, we developed a
`sensitive and reliable test using the polymerase chain reaction (PCR) method, which included 1)
`species-specific or universal primer sets, designed to detect short 16S ribosomal RNA (rRNA) gene
`sequences from cow, pig, and fish (tilapia) as well as genes encoding the large subunit of plant
`ribulose-1,5-bisphosphate carboxylase oxygenase and 2) species-specific PCR coupled with whole-
`genome amplification. This method was used to verify manufacturing label claims of 28 gelatin capsule
`samples sold as dietary supplements. The results from 27 samples were consistent with gelatin-related
`information on the manufacturer label, while one sample that mentioned tilapia gelatin was found to
`contain only bovine DNA. This rapid method can therefore be used to verify the authenticity of gelatin
`capsules.
`
`Ó 2016 Elsevier Ltd. All rights reserved.
`
`1. Introduction
`
`According to the South Korean Food Code (Article 5), capsules
`are considered a type of food formulation containing additives
`such as gelatin, glycerin, and other materials. Gelatin is a major
`component of capsules and is mostly obtained by hydrolysis of col-
`lagen extracted from animal bone, hide, and skin procured from
`animal slaughterhouses (Karim & Bhat, 2008).
`In Europe, the
`majority of edible gelatin is derived from pig skin; however, a sig-
`nificant proportion originates from bovine hide and splits (Tasara,
`Schumacher, & Stephan, 2005). Gelatin is widely used as a gelling
`and thickening agent in a variety of foodstuff, including confec-
`tionary products and water-based desserts, as well as pharmaceu-
`tical medicine capsules. Several steps are involved in the
`production of gelatin, for example, acidic or basic hydrolysis of
`connective tissue raw material, high temperature and pressure
`extraction with water, sterilization, and drying. These processes
`are not standardized and affect the properties of the final gelatin
`product. As a result, the proteins and nucleic acids in the final gela-
`tin product are highly degraded and their levels are very low and
`often variable (Boran & Regenstein, 2010).
`⇑ Corresponding author.
`
`E-mail address: missa@korea.kr (T.S. Kang).
`1 These authors contributed equally to this work.
`
`http://dx.doi.org/10.1016/j.foodchem.2016.05.060
`0308-8146/Ó 2016 Elsevier Ltd. All rights reserved.
`
`Several attempts have been made to identify the origin of gela-
`tin. Fourier transform infrared (FTIR) spectroscopy is a rapid
`method that differentiates between raw bovine and porcine gelatin
`based on spectral intensity; however, this method requires high
`purity of the sample and cannot discriminate within a mixture of
`raw gelatin (Hashim et al., 2010). High-performance liquid chro-
`matography (HPLC) in conjunction with principal component anal-
`ysis (PCA) differentiates between raw bovine and porcine gelatins.
`However, this method also does not identify a mixture of gelatins
`due to similarities in their chemical properties (Nemati, Oveisi,
`Abdollahi, & Sabzevari, 2004). Enzyme-linked immunosorbent
`assay (ELISA) is a sensitive technique for detecting the origin of
`gelatin based on antibody and antigen reactions; however, due to
`high homology of collagen sequences among animals, this method
`is unlikely to be species-specific (Venien & Levieux, 2005). HPLC
`coupled with mass spectrometry is an alternative that differenti-
`ates the origin of gelatin on the basis of marker peptides within
`collagen sequences (Zhang et al., 2008, 2009). However, marker
`peptides may also be degraded during manufacturing.
`Therefore, DNA-based methods to verify the origin of gelatin
`materials have been considered a better alternative due to the
`greater stability of DNA in highly-processed food. In addition,
`DNA is present in most biological tissues and can be extracted from
`even a very small amount of sample. Therefore, polymerase chain
`reaction (PCR)-based methods are an ideal alternative for
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 1/7
`
`

`

`254
`
`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`identifying adulteration of material from other species (Linacero
`et al., 2016; Lockley & Bardsley, 2000). To date, PCR analyses using
`species-specific primers have been used for sensitive and specific
`detection of various meat, seafood, and dairy products (Dalmasso
`et al., 2004; Fumiere, Dubois, Baeten, von Holst, & Berben, 2006).
`However, a limited number of studies have been reported regard-
`ing identification of the origin of gelatin, gelatin-containing foods,
`and capsule shells.
`In this study, we designed species-specific primer sets for
`bovine, porcine, and fish (tilapia) and universal primer sets for fish
`and plants. We optimized species-specific and universal PCR condi-
`tions to assess the origin of gelatin capsules. This method was used
`to verify the manufacturing label claims of 28 commercially avail-
`able gelatin capsules sold via the internet as health supplement
`foods.
`
`2. Materials and method
`
`2.1. Samples
`
`For the isolation of DNA, which was used to optimize species-
`specific PCR conditions, samples of beef, pork, tilapia, and plant
`material (sweet potato) were purchased from local markets. Stan-
`dard capsules composed of blending (bovine and porcine) gelatin
`or gelatin of bovine, porcine, or fish origin, or hydroxypropyl
`methylcellulose (HPMC) material were obtained from Suheung
`Capsule Co. Ltd. (Osong, South Korea). A total of 28 different com-
`mercially available gelatin capsules, described as health supple-
`ments, were purchased via the internet.
`
`2.3. Whole genome amplification
`
`To obtain a larger quantity of DNA from gelatin capsules, DNA
`extracts were amplified using the GenomePlexÒ Whole Genome
`Amplification (WGA) kit (Sigma-Aldrich, St. Louis, USA) according
`to the manufacturer instructions, purified using AccuPrepÒ PCR
`Purification kit (Bioneer, Seoul, South Korea) according to the man-
`ufacturer instructions, and quantified using NanoDropÒ ND-1000
`UV–vis Spectrophotometer (Thermo Fisher Scientific, Delaware,
`USA). DNA concentration was determined by UV absorbance at
`260 nm (1 absorbance unit corresponds to 50 lg/mL dsDNA). The
`purity of the extract was determined by the ratio of the absorbance
`at 260 nm to that at 280 nm.
`
`2.4. Target gene selection and oligonucleotide primers
`
`The species-specific primers used in this study targeted bovine
`(accession No. HM045018), porcine (accession No. GU147934), and
`tilapia (accession No. NC_013663) mitochondrial 16S rRNA genes
`(Supplemental Fig. S1A and Table 1). For the identification of fish
`capsules, a universal primer set was designed based on 16S rRNA
`genes of sea bass (accession No. GU324142), cod (accession No.
`GU324163), and yellow-fin tuna (accession No. HM071029) (Sup-
`plemental Fig. S1B and Table 1). For the identification of vegetable
`capsules, a universal primer set was designed based on the chloro-
`plast ribulose 1,5-bisphosphate carboxylase oxygenase large sub-
`unit gene (rbcL) of potato (accession No. HF572814), sweet
`potato (accession No.
`JX139773), and tapioca (accession No.
`JX139772) (Supplemental Fig. S1C and Table 1). Multiple align-
`ment was constructed from the sequences of 16S rRNA genes or
`rbcL using BioEdit software, version 7.2.2.
`
`2.2. DNA extraction
`
`2.5. PCR amplification and DNA sequencing
`
`DNA was extracted from meat and plant samples (100 mg)
`using either DNeasyÒ Blood & Tissue or DNeasyÒ Plant kit
`(Qiagen, Hilden, Germany), according to the manufacturer
`instructions, with minor modifications as described below. To
`isolate DNA from the standard capsules, 200 mg empty capsules
`were minced using a pair of scissors and DNA was extracted
`with either the DNeasyÒ Blood & Tissue or DNeasyÒ Plant kit
`(Qiagen). For animal capsules, 200 mg homogenized sample
`was mixed with 360 lL ATL buffer and 40 lL protease K, and
`the mixture was incubated at 56 °C until complete lysis. The
`lysis solution obtained was mixed with 400 lL AL buffer and
`400 lL ethanol (96%–100%), and the lysate was transferred into
`a DNeasy Mini spin column. After centrifugation at 6000g for
`1 min,
`the column was washed twice with washing buffer
`(AW1 and AW2), and purified DNA was eluted by adding 50 lL
`Tris-EDTA (TE) buffer. For HPMC capsules, 200 mg homogenized
`sample was mixed with 800 lL AP1 buffer and 8 lL RNase A,
`and the mixture was incubated at 65 °C for 20 min. The lysis
`solution obtained was mixed with 260 lL P3 buffer, and the
`mixture was incubated in ice for 10 min. After centrifugation
`at 20,000g for 5 min,
`the lysate was transferred into a
`QIAshredder spin column. Flow-through solution was mixed
`with 1.5 volumes of AW1 buffer and transferred into a DNeasy
`Mini spin column. After centrifugation at 6000g for 1 min,
`the column was washed twice with AW2 buffer and purified
`DNA was eluted by adding 50 lL TE buffer. For DNA extraction
`from capsules containing commercial health supplements, the
`contents were removed completely and the empty capsules were
`washed well with distilled water. DNA was extracted as
`described above. To confirm the statistical significance of results
`from PCR amplification, DNA was extracted twice from gelatin
`capsules of each dietary supplement.
`
`Conventional PCR was conducted in a total volume of 20 lL con-
`taining 1–10 ng template DNA, 0.5 lM of each primer, 1 PCR Buf-
`fer, 0.2 mM deoxynucleoside triphosphates (dNTPs), 2.0 mM
`MgCl2, 1 U rTaq polymerase (TaKaRa Bio Inc., Otsu, Japan), and ster-
`ile distilled water. The reactions were performed in a thermal cycler
`C1000 TouchTM (Bio-Rad Laboratories, Hercules, USA) under condi-
`tions described in Table 2. The amplified fragments were analyzed
`by 2.0% agarose gel electrophoresis. In order to verify the sequences
`of short-length fragments produced by the species-specific and uni-
`versal primers, PCR products were eluted from agarose gels and
`cloned into the pGEMT-easy vector (Promega, Madison, USA). Plas-
`mid DNA was purified using the AccuPrepÒ PCR Purification kit (Bio-
`neer), and the samples were sent to Bioneer Corp. (Seoul, South
`Korea) to determine nucleotide sequences.
`
`3. Results and discussion
`
`3.1. Specificity and sensitivity of the PCR assays
`
`In general, gelatins are highly-processed products, resulting in a
`high degree of degradation of the extracted DNA. Mitochondrial
`genes such as these coding for 12S rRNA, 16S rRNA, 18S rRNA, cyto-
`chrome b, cytochrome oxidase II, and NAD dehydrogenase, are
`widely used for species identification, mainly due to their high
`copy number as compared to nuclear DNA (Ballin, Vogensen, &
`Karlsson, 2009). In addition, amplification of small fragments of
`the mitochondrial genes is recommended for analysis of degraded
`DNA extracted from highly-processed food samples. Therefore, in
`this study, the primers were designed to detect short sequences
`of 16S rRNA genes, which are highly abundant in cattle, pig, and
`tilapia fish species. Our strategy helped increase the sensitivity of
`species-specific PCR assay using fragmented DNA from gelatin
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 2/7
`
`

`

`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`255
`
`Table 1
`Primers used in this study.
`
`Species
`
`Bovine
`
`Porcine
`
`Tilapia
`
`Fish
`
`Plant
`
`Primer
`
`SFI11-Cow-F
`SFI11-Cow-R
`
`SFI11-Pig-F
`SFI11-Pig-R
`
`SFI11-Til-F
`SFI11-Til-R
`
`F16-F1
`F16-R1
`
`PR-F2
`PR-R2
`
`Target gene
`
`16S rRNA
`
`16S rRNA
`
`16S rRNA
`
`16S rRNA
`
`rbcL
`
`Sequence (50–30)
`TATCTTGAACTAGACCTAGCCCAATG
`GGTACTTTCTCTATAGCGCCGTAC
`
`CAACCTTGACTAGAGAGTAAAACC
`GGTATTGGGCTAGGAGTTTGTT
`
`TTTAAATTCTTTACCCCCATTGGC
`CTGCTTTTAGGCCCACTAGAACATTAG
`
`TAATAAACAAATAAGAGGTCCCG
`GGAGACAGTTAAGCCCTCGTCAT
`
`GATTCGCAAATCTTCCAGACG
`TCTTCTACTGGTACATGGACAACT
`
`Tm (°C)
`56.1
`54.6
`
`54.4
`57.7
`
`58.3
`58.9
`
`51.4
`57.4
`
`56.0
`51.3
`
`Size (bp)
`
`Sources
`
`131
`
`138
`
`167
`
`151
`
`255
`
`This study
`
`Table 2
`Optimized PCR conditions for the 4 species analyzed in this study.
`
`Amplification
`
`Program step
`
`Initial denaturation
`
`Denaturation
`Annealing
`Extension
`Cycle number
`Final extension
`
`Primers
`
`SFI11-Cow-F/
`SFI11-Cow-R
`94 °C (10 min)a
`94 °C (30 s)
`59 °C (10 s)
`72 °C (40 s)
`40
`72 °C (5 min)a
`
`a These conditions were the same for all primers.
`
`SFI11-Pig-F/
`SFI11-Pig-R
`
`94 °C (30 s)
`59 °C (10 s)
`72 °C (40 s)
`40
`
`SFI11-Til-F/
`SFI11-Til-R
`
`94 °C (30 s)
`60 °C (30 s)
`72 °C (30 s)
`40
`
`F16-F1/
`F16-R1
`
`PR-F2/
`PR-R2
`
`94 °C (30 s)
`60 °C (10 s)
`72 °C (1 min)
`35
`
`94 °C (30 s)
`60 °C (10 s)
`72 °C (1 min)
`35
`
`capsules. Vegetable capsules are mostly prepared from starch
`extracted from tapioca, potato, or corn, or from hydroxypropyl
`methylcellulose (HPMC), a synthetically modified form of cellulose
`(Stroud, 1996). Considering that various plant materials are used to
`prepare vegetable capsules, we designed plant universal primers
`based on the sequences of rbcL genes. This gene has been widely
`used as a marker for polygenetic analysis because it is highly con-
`served (Olmstead & Reeves, 1995). The identification of bovine,
`porcine, tilapia, fish, and plant materials was conducted using
`the species-specific or universal primers listed in Table 1.
`The specificity of the designed primers was tested against 4
`materials, that is, cattle, pig, tilapia, and plant materials, which
`are commonly used as raw material for gelatin. As shown in
`Fig. 1, each pair of primers could only produce the expected frag-
`ments (131 bp for cattle, 138 bp for pig, 167 bp for tilapia, 151 bp
`for fish, and 255 bp for plant) when the corresponding DNA for
`which they were designed was used as templates, suggesting no
`cross-reaction among the four materials.
`The sensitivity of our method was determined using the DNA
`extracted from each reference species, with concentrations starting
`from 10 ng/lL. The detection limit for each species was tested with
`decreasing concentration of reference DNA. DNA extracts from cat-
`tle, pig, tilapia, and sweet potato were diluted from 101 to 105, cor-
`responding to a DNA concentration of 1–0.0001 ng/lL. The
`detection limit for bovine and porcine species was 0.001 and
`0.01 ng/lL,
`respectively; however, a higher detection limit
`(0.1 ng/lL) was observed for tilapia-specific primers (Fig. 2A–C).
`In the case of the universal primers, the detection limit for fish
`0.0001 ng/lL,
`respectively
`and
`plants was
`0.01
`and
`(Fig. 2D and E), showing that the fish universal primer set had
`10-fold higher sensitivity than the tilapia-specific primer set.
`
`3.2. Whole genome amplification of extracted DNA
`
`DNA extracted from the standard capsules was subjected to PCR
`amplification under our optimized conditions. As reported in
`
`Fig. 3B and E, PCR products with very weak intensity were detected
`by the porcine-specific primer set and the plant universal primer
`set, likely due to low quantity of initial template DNA. Previous
`studies have reported that treatment with the WGA kit increases
`the quantity of DNA extracted from olive oil by 17- to 22-fold
`(Muzzalupo, Pellegrino, & Perri, 2007). Focke, Haase, and Fischer
`(2011) reported that the expected PCR products can be detected
`from WGA-enriched clove and all-spice DNA using species-
`specific primers.
`Therefore, we carried out WGA to increase the quantity of
`amplifiable DNA and consequently increase the ratio of DNA quan-
`tity versus inhibiting substances. DNA was extracted from the 5
`standard capsules and the extracted DNA was amplified using
`the WGA kit. Compared with untreated and WGA-treated DNA, vis-
`ible DNA fragments ranging from 100 to 1000 bp were obtained
`with WGA (data not shown). Species-specific PCR was conducted
`using the WGA products as a template under the optimized condi-
`tions. Thus, the expected PCR products for cattle (131 bp), pig
`(138 bp), tilapia (167 bp), fish (151 bp), and plant (255 bp) were
`detected only after WGA, by agarose gel electrophoresis (Fig. 3).
`Interestingly, as shown in Fig. 3E, the plant universal primers pro-
`duced unexpected PCR products of the same size as that of the
`plant-specific PCR product (255 bp) from blending (bovine and
`porcine), bovine, porcine, and fish gelatin capsules after WGA.
`To identify the origin of each amplicon, the 4 bands were eluted
`from the agarose gels, cloned into the pGEMT-easy vector, and
`sequenced using M13 sequencing primers. The NCBI BLAST data-
`base was screened with the sequences of each PCR product as a
`query using BLASTn. In our BLAST search, all PCR products showed
`high sequence identities of over 98% to rbcL from various plants,
`including Raphistemma pulchellum, Fallopia convolvulus, and
`Muehlenbeckia platyclada. In addition, we aligned the sequences
`of the 4 PCR products and potato rbcL that was used to design
`our plant universal primers, by using the BioEdit software and
`noted 90%–93% sequence identities (Supplemental Fig. S2). Higher
`sequence identities (93%–100%) were observed when alignment
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 3/7
`
`

`

`256
`
`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`Fig. 1. Selectivity of PCR assays using bovine (A)-, porcine (B)-, and tilapia (C)-specific primers and fish (D) and plant (E) universal primers. M: 100 bp ladder, Lane 1: bovine
`DNA, Lane 2: porcine DNA, Lane 3: tilapia DNA, and Lane 4: sweet potato DNA.
`
`Fig. 2. Detection limit of PCR assays using bovine (A)-, porcine (B)-, and tilapia (C)-specific primers and fish (D) and plant (E) universal primers. Bovine (A), porcine (B), and
`tilapia (C and D), sweet potato (E) DNA was used as a template for the assays. M: 100 bp ladder, Lane 1: 10 ng/lL DNA, Lane 2: 1 ng/lL DNA, Lane 3: 0.1 ng/lL DNA, Lane 4:
`0.01 ng/lL DNA, Lane 5: 0.001 ng/lL DNA, and Lane 6: 0.0001 ng/lL DNA.
`
`was performed with sequences of the 4 PCR products only, sug-
`gesting that these sequences could originate from plants other
`than potato. We also confirmed from the manufacturer (Suheung
`Capsule Co. Ltd.) that various plant-derived materials such as
`plasticizers had been added during the manufacturing process in
`order to produce the gelatin capsule shapes; however, exact
`amounts or types of plant materials used were not disclosed by
`the manufacturer as this was proprietary information. Therefore,
`PCR products as shown in Fig. 3E would originate from plant-
`derived materials in the gelatin capsules.
`
`3.3. Application of species-specific PCR assays to gelatin capsule
`samples
`
`As a next step, we used our method to assess the authenticity of
`gelatin capsules from commercial dietary supplements. The cap-
`sules from 28 commercial dietary supplements were subjected to
`DNA extraction and WGA. The optimized PCR conditions for each
`species were then applied to the sample extracts for identification
`of gelatin material and verification of labeling compliance. As
`shown in Table 3, we found that 25 capsules labeled as gelatin con-
`tained bovine material, 11 of which were of the blending type, con-
`taining both, bovine and porcine materials and these were also
`detected by the porcine-specific primer set. Regarding the
`tilapia-specific PCR assay, only 1 sample that was labeled as con-
`
`taining marine gelatin showed a positive result. In 1 sample
`labeled as vegetarian, a positive result was detected by the plant
`universal PCR assay only. Thus, these results were consistent with
`the labeling information provided by the manufacturers. However,
`the plant universal primers also produced positive results from
`both bovine and blending-type capsules. Thus, to confirm whether
`these PCR products were obtained from plant-derived material in
`the gelatin capsules or from the commercial dietary supplements
`contained therein (e.g., flax oil, L-ornithine, and inositol), we per-
`formed PCR assays with DNA extracted from the contents for com-
`parison, with the plant universal primer set. However, a detectable
`amount of DNA could not be obtained from the dietary supple-
`ments (data not shown). It is reported that excipients in dietary
`supplements can absorb DNA, hampering its extraction and further
`amplification; therefore, we conducted a spiking assay of the cap-
`sule contents with sweet potato DNA (50 ng), using the method
`previously described by Costa et al. (2015). When compared to
`the control (sweet potato DNA in water, 5 ng/lL), recovery of the
`spiked DNA was 40%, 60%, and 76% from flax oil, L-ornithine, and
`inositol, respectively, resulting in PCR amplification. However, no
`amplification occurred on using plant universal primers to amplify
`DNA extracted from the dietary supplements spiked with water
`(Supplemental Fig. S3). Therefore, our result demonstrated that
`the PCR products obtained using plant universal primers resulted
`from the plant-derived materials in the gelatin capsules. This was
`well explained by the results presented in Section 3.2. Additionally,
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 4/7
`
`

`

`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`257
`
`Fig. 3. Effect of whole genome amplification on species-specific PCR. The PCR assays were conducted with bovine (A)-, porcine (B)-, and tilapia (C)-specific primers and fish
`(D) and plant (E) universal primers and DNA extracted from capsules before and after WGA. M: 100 bp ladder, Lane 1: blending (bovine and porcine) capsule, Lane 2: bovine
`capsule, Lane 3: porcine capsule, Lane 4: fish capsule, Lane 5: plant (HPMC) capsule, Lane 6: positive control (each corresponding species DNA), Lane 7: negative control.
`
`1 sample that was labeled as tilapia gelatin showed a negative
`result with the tilapia-specific and fish universal PCR assays; how-
`ever, bovine DNA was detected for this sample. To further confirm
`the origin of gelatin from this sample (No. 28), we cloned the PCR
`product produced by bovine species-specific primers and
`sequenced it. In our BLAST search, this PCR product showed over
`98% sequence identity to 16S rRNA genes of bovine species. Thus,
`this observation suggested a possibly fraudulent substitution of
`tilapia gelatin with bovine gelatin.
`The issue of gelatin consumption has raised concerns for health
`safety as well as religious beliefs. The emergence of bovine spongi-
`
`form encephalopathy (BSE) has raised concerns about potential
`risks related to consumption of bovine gelatin (Cai, Gu, Scanlan,
`Ramatlapeng, & Lively, 2012). Because of religious concerns, Hindu
`customs do not permit consumption of gelatin of bovine origin,
`whereas consumption of gelatin of porcine origin is strongly pro-
`hibited by Muslim and Jewish kosher dietary laws (Van der
`Spiegel et al., 2012). As a result, great efforts have been made to
`replace mammalian gelatin, leading to the development of meth-
`ods
`for
`gelatin
`extraction
`and
`production
`from fish
`(Gudmundsson & Hafsteinsson, 1997; Karim & Bhat, 2009). In
`spite of appropriate labeling requirements, after the product is
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 5/7
`
`

`

`258
`
`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`Table 3
`PCR results of gelatin capsules using species-specific primers.
`
`No.
`
`Brief description of the capsule content
`
`Type of capsule
`
`Gelatin informationa
`
`Labelb
`
`Species-specific (or universal) primers
`
`1
`2
`3
`4
`5
`6
`7
`8
`9
`10
`11
`12
`13
`14
`15
`16
`17
`18
`19
`20
`21
`22
`23
`24
`25
`26
`27
`28
`
`Lutein
`Shark Cartilage
`Gamma Linoleic Acid
`Colostrum
`Apple pectin
`Primrose oil
`Probiotic
`Inositol
`Omega
`Estrogen
`Vitamin E
`White Kidney Bean
`Gamma-Aminobutyric Acid
`Devil’s claw
`ACAI
`L-Ornithine
`Vitamin B6, B12
`Taurine
`Ginger
`Thiamin
`Gamma Linoleic Acid
`Flax oil
`Glucosamine
`Collagen
`Essential enzymes
`Primrose oil
`Ho Shou Wu
`Omega
`
`Hard
`Hard
`Soft
`Hard
`Hard
`Soft
`Hard
`Hard
`Soft
`Hard
`Soft
`Hard
`Hard
`Hard
`Soft
`Hard
`Hard
`Hard
`Hard
`Hard
`Soft
`Soft
`Hard
`Hard
`Hard
`Soft
`Hard
`Soft
`
`Bovine
`Blending
`Bovine
`Bovine
`Blending
`Not confirmed
`Bovine
`Not confirmed
`Bovine
`Bovine
`Bovine
`Bovine
`Blending
`Blending
`Bovine
`Blending
`Bovine
`Blending
`Blending
`Blending
`Bovine
`Blending
`Bovine
`Tilapia
`Blending
`Bovine
`Blending
`Tilapia
`
`G
`G
`G
`G
`G
`G
`G
`P
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`G
`M
`G
`G
`G
`T
`
`Bovine
`
`+
`+
`+
`+
`+
`+
`+
`
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`+
`
`+
`+
`+
`+
`
`Porcine
`
`+
`
`
`+
`
`
`
`
`
`
`
`+
`+
`
`+
`
`+
`+
`+
`
`+
`
`
`+
`
`+
`
`
`Tilapia
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`+
`
`
`
`
`
`Plant
`
`+
`+
`
`+
`
`
`+
`+
`+
`+
`+
`+
`+
`+
`
`+
`+
`+
`
`
`+
`+
`+
`
`+
`
`+
`
`
`a Information regarding gelatin, as confirmed by the manufacturers. Blending indicates that the capsules were composed of both, bovine and porcine gelatin.
`b G: labeled as gelatin without specifying species, P: labeled as vegetarian gelatin capsules, M: labeled as marine gelatin capsules, and T: labeled as tilapia gelatin capsules.
`
`manufactured, purified, and sold, determining the origin of com-
`mercially available gelatin is a challenge. Therefore, it is important
`to develop analytical methods to verify the authenticity of pure
`and/or detect cross-contamination.
`The essential prerequisite for identification of gelatin material
`by conventional PCR is 1) developing high-efficiency primers for
`species identification and 2) extracting sufficient quantity of tem-
`plate DNA from highly-processed materials (Shabani et al., 2015).
`For optimum specificity and sensitivity of primers, we developed
`species-specific and universal primers wherein their binding sites
`were selected to amplify specific short fragments of high-copy-
`number genes, considering the highly-processed nature of gelatin.
`Under our optimized conditions, no cross reaction was observed
`among the 4 major gelatin materials (bovine, porcine, fish, and
`plant) analyzed in this study and high sensitivity was observed
`with all primer sets, detecting as low as 0.01 ng/lL DNA. For devel-
`opment of suitable extraction methods, we tested commercial kits
`including Stool kit (Qiagen), Magnetic bead kit (Promega), and
`DNeasyÒ Blood & tissue/DNeasyÒ Plant kits (Qiagen), and CTAB
`method for the comparison of repeatability, purity, and yield of
`DNA extraction (data not shown). The 2 DNeasy kits (Qiagen)
`showed the most satisfactory results for maximal recovery of short
`DNA fragments. After DNA extraction from gelatin capsules, WGA
`treatment was used to obtain sufficient template DNA. This combi-
`nation produced optimal results for preparation of template DNA
`to be used in our species-specific PCR assay. The WGA kit provides
`a non-specific pre-amplification step, where all DNA in the extract
`can be amplified. The main drawback of this technique is its vul-
`nerability for cross-contamination from other positive samples.
`To further validate our method, we sequenced the short fragments
`produced by bovine-specific PCR before and after WGA. The
`sequencing results showed the same bovine 16S RNA sequences
`(data not shown), suggesting that this method did not produce
`errors in bovine DNA sequences during the WGA step. In addition,
`any cross-contamination was not observed under our laboratory
`
`conditions. Thus, our PCR assay combined with WGA allows the
`identification of materials used in highly-processed gelatin
`capsules.
`
`4. Conclusion
`
`Fraudulent practices in the food industry cause concerns for
`consumers with regard to safety and authenticity as well as choice
`of food. Therefore, food control authorities require advanced detec-
`tion methods to combat fraudulent practices such as adulteration.
`In this study, we developed a species-specific PCR assay to assess
`the origin of gelatin capsules. In conjunction with WGA, our
`method overcomes some of the current limitations of qualitative
`techniques for testing highly-processed gelatin and successfully
`assesses the authenticity of gelatin capsules containing bovine-,
`porcine-, tilapia-, and plant-derived materials. Thus, our method
`can be efficiently utilized to verify the authenticity of the origin
`of gelatin in various foods, dietary supplements, and medicines.
`
`Conflict of interest
`
`The authors declare that they have no conflicts of interest.
`
`Acknowledgements
`
`This study was supported by a grant (15161MFDS073) from the
`Korean Ministry of Food and Drug Safety.
`
`Appendix A. Supplementary data
`
`Supplementary data associated with this article can be found, in
`the online version, at http://dx.doi.org/10.1016/j.foodchem.2016.
`05.060.
`
`Mylan v. Qualicaps, IPR2017-00203
`QUALICAPS EX. 2004 - 6/7
`
`

`

`J.-H. Lee et al. / Food Chemistry 211 (2016) 253–259
`
`259
`
`References
`
`Ballin, N. Z., Vogensen, F. K., & Karlsson, A. H. (2009). Species determination? Can we
`detect and quantify meat adulteration? Meat Science, 83(2), 165–174.
`Boran, G., & Regenstein, J. M. (2010). Fish gelatin. Advances in Food and Nutrition
`Research, 60, 119–143.
`Cai, H., Gu, X., Scanlan, M. S., Ramatlapeng, D. H., & Lively, C. R. (2012). Real-time
`PCR assays for detection and quantitation of porcine and bovine DNA in gelatin
`mixtures and gelatin capsules. Journal of Food Composition and Analysis, 25(1),
`83–87.
`Costa, J., Amaral, J. S., Fernandes, T. J. R., Batista, A., Oliveira, M. B. P. P., & Mafra, I.
`(2015). DNA extraction from plant food supplements: Influence of different
`pharmaceutical excipients. Molecular and Cellular Probes, 29(6), 473–478.
`Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati, S., & Bottero, M. T. (2004). A
`multiplex PCR assay for the identification of animal species in feedstuffs.
`Molecular and Cellular Probes, 18(2), 81–87.
`Focke, F., Haase, I., & Fischer, M. (2011). DNA-based identification of spices: DNA
`isolation, whole genome amplification, and polymerase chain reaction. Journal
`of Agricultural and Food Chemistry, 59(2), 513–520.
`Fumiere, O., Dubois, M., Baeten, V., von Holst, C., & Berben, G. (2006). Effective PCR
`detection of animal species in highly processed animal byproducts and
`compound feeds. Analytical and Bioanalytical Chemistry, 385(6), 1045–1054.
`Gudmundsson, M., & Hafsteinsson, H. (1997). Gelatin from cod skins as affected by
`chemical treatments. Journal of Food Science, 62(1), 37–39.
`Hashim, D. M., Man, Y. B. C., Norakasha, R., Shuhaimi, M., Salmah, Y., & Syahariza, Z.
`A.
`(2010). Potential use of Fourier transform infrared spectroscopy for
`differentiation of bovine and porcine gelatins. Food Chemistry, 118(3), 856–860.
`Karim, A. A., & Bhat, R. (2008). Gelatin alternatives for the food industry: Recent
`developments, challenges and prospects. Trends in Food Science & Technology, 19
`(12), 644–656.
`Karim, A. A., & Bhat, R. (2009). Fish gelatin: Properties, challenges, and prospects as
`an alternative to mammalian gelatins. Food Hydrocolloids, 23(3), 563–576.
`Linacero, R., Ballesteros, I., Sanchiz, A., Prieto, N., Iniesto, E., Martinez, Y., Pedrosa, M.
`M., et al. (2016). Detection by real time PCR of walnut allergen coding
`sequences in processed foods. Food Chemistry, 202, 334–340.
`Lockley, A. K., & Bardsley, R. G. (2000). DNA-based methods for food authentication.
`Trends in Food Science & Technology, 11(2), 67–77.
`Muzzalupo, I., Pellegrino, M., & Perri, E. (2007). Detection of DNA in virgin olive oils
`extracted from destoned fruits. European Food Research and Technology, 224(4),
`469–475.
`
`Nemati, M., Oveisi, M. R., Abdollahi, H., & Sabzevari, O. (2004). Differentiation of
`bovine and porcine gelatins using principal component analysis. Journal of
`Pharmaceutical and Biomedical Analysis, 34(3), 485–492.
`Olmstead, R. G., & Reeves, P. A. (1995). Evidence for the polyphyly of the
`Scrophulariaceae based on chloroplast rbcL and ndhF sequences. Annals of the
`Missouri Botanical Garden, 176–193.
`Shabani, H., Mehdizadeh, M., Mousavi, S. M., Dezfouli, E. A., Solgi, T., Khodaverdi, M.,
`Rabiei, M., et al. (2015). Halal authenticity of gelatin using species-specific PCR.
`Food Chemistry, 184, 203–206.
`Stroud, N.
`(1996). High amylose starch substituted gelatin capsules.
`US5554385 A.
`Tasara, T., Schumacher, S., & Stephan, R. (2005). Conventional and real-time PCR-
`based approaches for molecular detection and quantitation of bovine species
`material in edible gelati