`
`Nucleic A(:z'(1.v Research, 2001, Vol. 29, No. 7e38
`
`Manufacturing DNA microarrays of high spot
`homogeneity and reduced background signal
`
`Frank Die-hl*, Susanne Grahlmann, Markus Beier and Jorg D. Hoheisel
`
`Functional Genome Analysis, Deutsches Krebsforschungszentrum, lm Neuenheimer Feld 506, D-69120 Heidelberg,
`Germany
`
`Received January 11. 2001; Flevised and Accepted February 13, 2001
`
`ABSTRACT
`
`Analyses on DNA mlcroarrays depend considerably
`on spot quality and a low background signal of the
`glass support. By using betalne as an additive to at
`spotting solution made of saline sodium citrate, both
`the binding efficiency of spotted PCR products and
`the homogeneity of
`the DNA spots is improved
`significantly on aminated surfaces such as glass
`slides coated with the widely used poly-L-lysine or
`aminosilane.
`in addition, non-specific background
`signal
`is markedly diminished.
`concomitantly,
`during the arraying procedure, the betalne reduces
`evaporation from the microtitre dish wells, which
`hold the PCR products. Subsequent blocking of the
`chip surface with sucoinic anhydride was improved
`considerably in the presence of
`the non-polar,
`non—aqueous solvent 1,2-dlchloroethane and the
`acylatlng catalyst N-methylimldazole. This procedure
`prevents the overall background signal that occurs
`with
`the
`frequently applied
`aqueous
`solvent
`1-methyl-2-pyrrolldone in borate buffer because of‘
`DNA that re-dissolves from spots during the blocking
`process, only to bind again across the entire glass
`surface.
`
`INTRODUCTION
`
`DNA micronrrnys are produced by in siru synthesis of oligo»
`nucleotides (1,2) or
`the immobilisution ol' prc.-fabricated
`molecules (3). Currently, glass slides are mainly used as
`support medium because of their favourable optical charactcn
`istics. Especially for trariscriptional profiling analyses (4.5),
`PCR products are spotted onto activated glass surfaces coated
`with poly~L-lysine or uminosilnnc, Since the efficiency of
`binding PCR products to glass slides still limits the sensitivity
`illld the dynamic range of such measurements, performance is
`directly inilucnccd by the amount of DNA that is attached to
`the surface. Also, DNA spots of high homogeneity arc beneficial,
`since they simplify image analysis and considerably enhance
`the accuracy of signal detection. One important factor in the
`spotting process is the chemical properties of the solution in
`which the DNA is dissolved. With the widely used saline
`sodium citrate (SSC) buffer, binding efficiency and spot
`
`uniformity are often poor. The problems are reduced by
`supplementing SSC with 50% dimethyl sulfoxitlc. This reaction
`buffer has the disadvantage, however, of being both toxic and
`at solvent for many Inatcrials, apart from its only limited effect,
`on spot appearance.
`Another critical part of microuiray manufacturing is the
`processing of the glass surface after spotting, during which the
`remaining, unrcacted amino residues of the poly—L-lysine
`polymer or aminosilanc are deactivated. This prevents subsc~
`qucnt binding oi‘ DNA, which increases the background signal
`upon hybridisation of a labelled target. Blocking is usually
`achieved by reacting the arrays with succinic anhydridc in
`aqueous, borute-buffered l-methyl-2-pyirolidinone (NMP),
`converting the amines into carboxylic moictics (3,5). During
`this process, however, the spotted DNA comes in Contact with
`the aqueous blocking solution,
`is partly re-dissolved and
`spread across the entire slide. To prevent this, we developed at
`robust processing protocol that makes use of a non-polar, non-
`aqucous solvent and accelerates the blocking reaction by the
`addition of a catalyst.
`
`MATERIALS AND METHODS
`
`Probe and target synthesis
`
`For the analysis, riorvhotnologous DNA inserts of ~50() bp in
`length were picked at random from a clone library generated
`by cDNA representational difference analysis (6). They wore
`PCR-amplified in 100 pl reactions with the universal primer
`d(AGGCAACTGTGCTATCCGAGGGAA), purified by an
`isopropanol precipitation and rcsuspcncied in water. The DNA
`concentration was determined by measuring the tlnoresccncc
`signal obtained in the presence of the dye Hocchst-33258.
`Purity of the fragments was checked by agarosc gel electro-
`phoresis.
`lior the generation of complementary hybridisation
`targets, a Cyfi-labelled oligonuclcotidc primer of identical
`sequence was used for amplification.
`
`Fabrication of niicroarrays
`
`Poly«L«lysine~contcd glass slides of 75 X 25 mm were prepared
`as described (3) (hltp://cmgrn.stani‘ord.cdu/pbrown/MGuidc).
`Slides with nminosilanc
`surface
`(CMT~GAPS'”") were
`purchased from Corning (Corning, USA). The DNA spotting
`solution was adjusted to either 45 mM sodium citrate pH 7.0,
`450 mM NuCl
`(3>< SSC) or the same composition supple
`mcntcd with 1.5 M bctninc (N,N,N~trimcthylglycine; Sigma,
`
`*To whom corrcspotidcncc should he addressed. Tel: +49 622i 424680; Fax: +49 6221 424682; Email: f.dichl@dkl'z.dc
`
`Page 1 of 5
`
`BD Exhibit 1021
`
`
`
`PAGE 2 on 5
`
`e38 Nucleic Acids Research, 200], Vol. 29, No. 7
`
`Gemiany). DNA spotting was done with an SDDC-2 DNA
`Micro~Arrayer
`from Engineering Services
`Inc.
`(Toronto,
`Canada). A single SMP3 pin (’l‘eleChem International Inc.,
`Sunnyvale, USA) was used to avoid differences between pins.
`The DNA samples were printed in quadruplicate at a 200 um
`centre-to-centre spacing. Slides were left at room temperature
`ovemight and then heat—treated on a metal block at 80°C for
`5 s. The DNA was crosslinked to the support by UV irradiation
`with a total energy of 60 ml in a Hoefer UV-crosslinker (Amer~
`sham Pharmacia Biotech, Freiburg, Germany). For the blocking
`process,
`1 g succinic anhydride (Fluka, Deiscndort‘, Germany)
`was freshly dissolved in 200 ml anhydrous 1,2—dichloroethane
`(DCE; Fluka). To this solution, 2.5 ml of N-methylimidazol
`(Fluka) was added and immediately poured into the slide
`chamber. Incubation was for l h, placed on an orbital shaker
`for slight agitation. Subsequently,
`the slides were briefly
`washed in 2(X) ml of fresh DCE and incubated in boiling water
`for 2 min for DNA denaturation. After a brief rinse in 95%
`ethanol, they were left to dry at room temperature. Blocking
`with succinic anhydride in boratebuffered NMP was carried out
`according to the protocol published by Eisen and Brown (5).
`
`Hybridisation of labelled samples
`
`For each hybridisation, 0.2 ttg of Cy5—labelled and L8 ug of
`unlabelled PCR product were mixed and precipitated with
`ethanol. The pellet was taken up in 15 ul hybridisation buffer
`of 50% formamide, 3x SSC, l% SDS, Sx Denhardt’s reagent
`and 5% dextran sulfate (7). The sample was denatured at 80°C
`for 10 min, applied to a microarray and spread evenly by a
`covcrslip of 22 X 22 mm. Hybridisation was carried out for
`
`a humidified hybridisation chamber
`at 42°C in
`16 h
`(TeleChem Ilntemational lnc.). The slides were washed in 2x
`SSC, 0.1% SDS for 2 min, then in ix SSC for 2 min, rinsed
`briefly in 0.2>< SSC and dried by centrifugation at 500 r.p.rn.
`for 5 min. Detection of the fluorescence signals was performed
`on a ScanArray5000 unit and analysed with the QuantArrayl.()
`software package (GSI Lumonics, Billerica, USA).
`
`R ESU LTS
`
`Effectiveness of DNA binding
`
`One critical factor in microarray analyses is the amount of
`probe material attached to the support that is available for
`hybridisation. This factor can quickly become limiting to the
`signal intensities detectable on glass arrays and thus directly
`influences the sensitivity and dynamic range of measurements.
`In order to dctemiinc how the buffer condition of the spotting
`solution affects the binding efficiency oi‘ the spotted DNA,
`PCR products of ~500 bp in length were produced from
`individual clone inserts, which had been randomly picked from
`a subtractive human clone library. The DNA was diluted to
`concentrations of 500, 250, 100, 50 and 25 ng/ul and applied to
`glass slides in four replica-spots each. Spotting solution
`without DNA was also deposited. Parallel to 3x SSC and the
`same buffer supplemented with 1.5 M betaine, the commercial
`ArrayIt"'M micro-spotting solution ('1‘eleChem International
`Inc.) was tested.
`In hybridisations, labelled PCR products were used as target
`DNA. Figure 1 shows a typical image of fluorescence signal
`
`0
`
`25
`
`50
`
`100
`
`250
`
`500 DNA eonc. lnglulj
`SSC
`53C.|'iJI.'l.iJlnu
`.I'|u|Iu1,rIt‘“ nululitslt
`SSC
`55 Ctbelalne
`
`t~'.”_4rH.'“w'i=_='°'I
`
`
`
`
`
`SSC
`
`Ssclbataine
`
`Arrayttm
`solution
`
`no signal N» '1’ saturation
`
`Figure 1. Signal intensities produced upon hybridisation of Cy5~labelled DNA to increasing amounts of spotted PCR product. Spots made with each DNA
`concentration and buffer system were present in quadruplicate. (A) The background of non-specific binding to a norhcompleinentary sequence. (B) The signals
`obtained on a fully complementary probe. Enlargements that display in detail (C) the background signal collected in absence of DNA and (D) the homogeneity of
`signal at spots produced with IOO ng/p.i DNA.
`
`Page 2 of 5
`
`
`
`Nucleic Acids Research, 2001, Vol. 29, No. 7938
`
`PAGE 3 or 5
`
`50
`
`'5 _ 40
`9.2 is’
`‘- =1
`30
`ii"
`“E
`2-
`5 3-
`g
`
`20
`10
`Q
`
`" “
`
`‘
`
`I
`“
`
`'
`
`3
`/I
`/
`.
`Jr. §/ -I’ Ssclbetalne
`2&4
`-9- sec
`/,3
`-L- Arraylt“‘aolution
`‘ _..__
`O
`300
`400
`100
`200
`500
`
`DNA concentration [ng/pl]
`
`Figure 2. Effect of probe concentration and spotting solution on hybridisation
`efficiency. The mean signal intensities produced in the experiments shown in
`Figure l are plottetl versus the DNA concentration of the spotted DNA. The
`error bars indicate standard deviation.
`
`intensities obtained from such experiments. Irrespective of the
`buffer, hybridisation was specific to the complementary probe
`molecule. Also,
`in all cases the signal intensities increased
`with increasing concentration of the spotted DNA probe
`solution. However, quantification reveals that, at a DNA
`concentration in the spotting solution of up to 100 ng/pl, the
`signal intensities were ~2.5—fold higher if bctainc was present
`in the spotting buffer (Fig. 2). Correspondingly, the binding
`capacity of the glass surface is nearly saturated at a DNA
`concentration of 250 rig/til, while without betainc this level is
`reached only at a concentration >500 ng/til.
`
`Spot homogeneity
`
`Spot homogeneity is dependent on the variation of the DNA
`concentration across a spot. There are distinct, frequently
`occurring patterns that can be observed upon hybridisation,
`such as a higher DNA concentration at the edges ( ‘doughnut’
`effect) or the aggregation of the DNA at few points within a
`spot. The former effect was seen on slides printed with DNA in
`pure SSC buffer, while the latter occurred when the Arrayltw
`micro~spotting solution was used (Fig. 1). Supplementing SSC
`with 1.5 M betaine yielded much more homogenous spots.
`This effect was evaluated by calculating the variation
`coefficient of signal intensity across all pixels that represent a
`spot. At a DNA concentration of 100 ng/til during spotting
`(Fig. 1D), for example, the variation coefficient was found to
`be 7% with the commercial buffer, 14% if SSC was used and
`only 5% for SSC supplemented with betaine.
`
`Spot-specific background signal
`
`The choice of spot.ting solution also has a noticeable effect on
`the background signal produced at the spots in absence of a
`complementary target DNA. In Figure 1C, typical results are
`presented where buffer
`lacking DNA has been spotted.
`Particular care had been taken to avoid any carry—over of DNA
`from other samples by extensive washing steps and spotting
`the buffer probe first before proceeding to samples containing
`DNA. The signaltnoise ratio of each feature was calculated by
`dividing the mean signal intensity of the four spot areas by the
`mean of the background signal in between spots. A ratio of 0.7
`(;tt').2) was found for 3X SSC supplemented with l .5 M betainc,
`
`while much higher ratios of 5.1 (250.8) and 10.5 (i1.5) were
`determined for SSC without bctaine and the TeleChem
`ArrayIt"‘M micro-spotting solution, respectively.
`
`Suppression of overall background
`
`The protocol of slide post—processing with succinic anhydridc
`was introduced "by Schena er al. (3) and is widely used for the
`blocking of aminated surfaces by acylating the unreactcd
`primary amines. In this process, succinic anhydride is first
`dissolved in NM? before sodium borate buffer pH 8 is added;
`the final concentrations are 164 mM suceinic anhydride, 96%
`(v/v) NMP and 4% (v/v) aqueous sodium borate buffer. We
`suspected that an incubation in this solution re-dissolves part
`of the DNA deposited on the glass surface, which could then
`spread across the slide, causing additional background. In an
`effort to avoid this effect, we substituted the non»polar, non-
`aqueous solvent DCE for NMP. The concentration of succinic
`anhydride was decreased to 50 mM. Also, no aqueous buffer was
`added to the solution. Instead, the acylating catalyst N-methyl-
`imidazol was added for acceleration of the process. We did
`comparisons of slides produced and processed in parallel but
`acylated by either the NM? method or our DCE protocol. With
`the latter blocking reaction, an overall significantly reduced
`background is achieved (Fig. 3). Since using the DCE-based
`process as our routine blocking procedure, we have not
`encountered any background problems that could be attributed
`to the blocking, whereas before, when using the NMP method,
`we experienced all commonly known problems, such as
`inverted signal phenomena or a higher background around
`DNA spots.
`
`DISCUSSION
`
`The results described above suggest that binding of DNA to
`poly-11.-lysine slides in the presence of betaine is a different
`reaction from spotting DNA in SSC alone. Betainc is a
`naturally occurring substance that serves as an osmoprotcctnnt
`factor in. bacteria (8).
`l.t is known to alter DNA and protein
`stability and to reduce the difference in stability of A:T and
`G:C base pairs (9,l(l). Because of these effects, it has been
`introduced as an additive in sequencing reactions and different
`PCR strategies (11,12). In physical terms, betaine increases the
`viscosity of a solution and reduces the rate of evaporation,
`dependent on its concentration (Fig. 4). However, surface
`tension is less affected (data not shown). These characteristics
`are likely to account for its effects as an additive to spotting
`solution. The increased binding efficiency and spot homo-
`geneity is most likely due to the reduced evaporation rate. Only
`very small volumes in the nanolltrc range are deposited on the
`microarray surface during spotting, Because of the swift
`evaporation of such small volumes, the electrostatic binding of
`DNA on the positively charged surface must occur within a
`very short period. Also,
`the quickly receding liquid film
`dictates where binding takes place. If spots stay humid for
`longer, however, the DNA is more likely to bind at equal rates
`across the entire surface. As a side effect, betaine reduces the
`evaporation of the DNA samples in the microtitcr plates during
`the microarray manufacturing process. Varying the para-
`meters, we found that a. concentration of 1.5 M betaine had the
`overall best effect on the quality of DNA microarrays.
`
`Page 3 of 5
`
`
`
`PAGE 4 OF 5
`
`e38 Nuc:Ieir:Acids Research, 2001, Vol. 29, No. 7
`
`-Indian
`
`11!!!! 1145-
`I'll-I III‘
`
`Figure 3. Comparison of blocking reactions. Two microarray slides were produced simultaneously before being subjected to the blocking procedures. Acylution
`was performed using (A) 164 mM succinic nnhydridc in boratc-bufl‘erc<l NM!’ or (B) 50 mM succinic auhydride and 150 mM Nnnethylimidazol in DCE. The slides
`were hybridised in parallel with a Cy5~labelletl, complementary PCR product, washed briefly and scanned under identical conditions. The slight DNA ‘tails’ scan
`in (B) are caused by target DNA left after the brief washing. Such features occur on both types of slides. as could be detcmtined by radioactive hybridisutions (not
`shown), but are submerged in the background signal of (A).
`
`A
`
`r:
`.§
`8
`2
`E
`8,
`:3
`
`100
`80
`
`60
`
`40
`
`20
`
`O
`
`
`
`0
`
`25
`
`50
`
`7'5
`
`100
`
`125
`
`time [h]
`
`'0"
`0.25M
`"' 0-00”
`+ 0.75M
`4-
`0.5051
`+ mom
`-0-
`1.26M
`-0-
`zoom
`-06-
`1.50M
`0-
`3.00M
`«Ir
`4.00M
`concentration
`otbotalno
`
`8 § 100 W”
`E 80
`""r'|"‘:‘:.,
`'4!" ,
`V
`S
`60
`V
`‘I
`E
`v ow J
`
`40
`
`;
`
`‘
`
`.
`
`I
`
`20
`0
`
`...V. I
`I
`-
`1
`2
`
`0
`
`0- -
`’r
`3
`
`-+- 125h
`-'r-
`50h
`.
`-v-
`33h
`Q»
`on
`tncubabon
`time
`
`- — _
`
`
`
`at
`
`‘I’
`I
`-1
`
`concentration 01 betaine [M]
`
`Figure 4. Effect of betaine on evaporation. Spotting solution (l ml) was supplemented
`with different concentrations of betalnc in u 1.5 ml Eppcndorf tube, which was
`incubated with an open lid at 30°C. (A) The percentage of evaporation is
`presented. Note that by the increase in hetaine concentration ttt
`the liquid
`surface the evaporation eventually stops. From this data. it can be extrapolated
`that u concentration oi‘ 6.8 M butuinc prevents further evaporation (B),
`
`The substitution of DCE for the NMP solution during the
`blocking of the glass surface subsequent to DNA spotting and
`the addition of an acylution catalyst improved the background
`considerably. In most published reports, NMP has been used as
`solvent of the acylating succinic anhydride. In this procedure,
`sodium borate buffer is added to keep the pH at 8,
`thus
`enhancing deprotonation of the charged amines. Deprotonation
`leaves a free pair of electrons on the amine, which can undergo
`a nucleopliilic attack on the carbon of succinic anhydride. We
`chose DCE because of its non-polar, non-aqueous nature,
`while nevertheless being a solvent of succinic anhydride and
`N-methylimidazol. N-methylimidazol is a tertiary amine, which is
`used as a standard acylation catalyst in organic chemistry. Since it
`not only acts as a coupling activator but also has a basic
`character, there is no need for the use of other bul't'cr compo-
`nents.
`
`In combination, the modifications in the compositions of the
`spotting solution and the blocking reagent led to a significant
`improvement in the quality of microarrays, affecting sensi-
`tivity and accuracy of measurements,
`thereby moving such
`analyses another step toward more quantitative performance.
`
`ACKNOWLEDGEMENTS
`
`We are grateful to Achim Stephan for the preparation of slides
`and Philipp Angencnclt for technical help. This work was
`funded by the German Ministry oi’ Education and Research
`(BMBF).
`
`REFERENCES
`
`l . Mosl<os,U. and Southcm,E.M. (i992) Oligonnclcotide hybridisations on glass
`supports: a novel linker for oligonuclcotidc synthesis and hybridisation
`
`Page 4 of 5
`
`
`
`Nucleic Acids Research, 200], Vol. 29, No. 7938
`
`PAGE 5 Oi? 5
`
`pmpertit-:4 of oligonuclcotides synthesised in mu. Nucleic Acidt Res., 20,
`1679-1684.
`Fodor.S.P.A., Rava,R.P,, Huang,X.C., Pease,A.C., l-lolmc.r,C.P. and
`Adams,C.L. ( i993)MultipIexed biochemical assays with biological chips.
`Nature, 364, 555-556.
`. Schena,Mt, Shalon,D., Davitt,R.W. and Brown,P.(). (1995) Quantitative
`monitoring of gene expression patterns with a complementary DNA
`microamty. Science, 270, 467-470.
`The Chipping Fomcast (1999) Nature Geneh. 21 (suppl.), l-60.
`Eisen,M.B. and Btown,P.0. (1999) DNA~arrays fur analysis of gene
`expression. Methods Enzymal., 303. 179-205.
`Hubank,M. and Schat1.,D.G. (1994) Identifying differencex in mRNA
`expression by representational difference analysis of cDNA. Nucleic
`Acids Reta, 22, 5640-56484
`. Welt"nrd,S.M.. Gregg.J., Chcn,E., Garrist:m,D., Sorensen,P,H.,
`Dcnny,C.T. and Nclson,S.F. (1998) Detection of ditiorcntially expressed
`genes in primary tumor tissues using reprenentutiottal differences analysis
`coupled to micronrray hybridisation. Nucleic‘/lcid.s' R¢'.5‘., 26, 3059-3065.
`
`':":“
`
`. Csonka,l..N., Ikeda,T.P,, Fletcher,S.A. and Kustu.S. (1994) The
`accumulation of glutamate is necessary for optimal growth of Salmonella
`typhitnttriutn in media of high osmolality but not induction of the proil
`operon. J. Bz:cIarioI., 176, 6324-6333.
`Santor0,M.M., Liu,Y., Khan,S.M., Hou,L.X. and Bolcn.D.W. (1992)
`increased thermal stability of proteins in the presence of naturally
`occurring osmolytes. Biochemistry, 16, 5278-5283.
`Rees,W.A., Yagcr.T,D., Korte,J. and Hippel,P.H. (1993) Betaine can
`eliminate the base pair composition dependence of DNA melting,
`Bt'ocItemt‘.irr;y, 32, 137-144.
`Mytelka,D.S. and Chambcrlin,M.J. ([996). Analysis and suppression of
`DNA polymerase pauses associated with a trinucleotitle consensus.
`Nucleic Acids R551, 24, 2774-2781.
`. Henkc,W.. Herdel,l(., Jung,K., Schtmr.r,D. and l..aening,S.A. (i997)
`Betainc improves the PCR. amplification of GC~rich DNA sequences.
`Nucleic Acids Ram, 25, 39574958.
`
`11.
`
`Page 5 of 5