`
`•
`
`Nucleic Acids Research, 2003, Vol. 31, No.l6 e87
`DO/: 10.1093/narlgng086
`
`Impact of surface chemistry and blocking strategies
`on DNA microarrays
`Scott Taylor\ Stephanie Smith\ Brad Windle2 and Anthony Guiseppi-Eiie1
`
`3·*
`•
`
`1Center for Bioelectronics, Biosensors and Biochips (C3B), 2Department of Medicinal Chemistry and 3Department
`of Chemical Engineering, Virginia Commonwealth University, PO Box 843038, 601 West Main Street, Richmond,
`VA 23284·3038, USA
`
`Received March 24, 2003; Revised May 15, 2003; Accepted June 2, 2003
`
`ABSTRACT
`The surfaces and immobilization chemistries of
`DNA microarrays are the foundation for high quality
`gene expression data. Four surface modification
`chemistries, poly-L-Iysine· (PLL), 3-glycidoxypropyl(cid:173)
`trimethoxysilane
`(GPS),
`DAB-AM-poly(propyl(cid:173)
`eminime l:!exadecaamine) dendrimer (DAB) and· 3-
`aminopropyltrimethoxysilane (APS), were evaluated
`using eDNA and oligonucleotide sub-arrays. Two
`un-silanized glass surfaces, RCA-cleaned and
`immersed in Tris-EDTA buffer were also studied.
`DNA on amine-modified surfaces was fixed by UV
`(90 mJ/cm2), while DNA on ·GPS-modified surfaces
`was immobilized by covalent coupling. Arrays were
`blocked with either succinic anhydride (SA), bovine
`serum albumin (BSA) or left unblocked prior to
`hybridization with labeled PCR product. Quality fac(cid:173)
`tors evaluate~ were surface affinity for eDNA versus
`oligonucleotides, spot and background intensity,
`spotting concentration and blocking chemistry.
`Contact angle measurements and atomic force
`microscopy were preformed to characterize surface
`wettability and morphology. The GPS surface exhib-
`. ited the lowest background intensity regardless of
`blocking method. Blocking the arrays did not affect
`raw spot intensity, but affected background inten(cid:173)
`sity on amine surfaces, BSA blocking being the
`lowest. Oligonucleotides and eDNA on unblocked
`GPS-modified slides gave the best signal (spot-to(cid:173)
`background intensity ratio) .. under the conditions
`evaluated, the unblocked GPS surface along with
`amine covalent coupling was the most appropriate
`for both eDNA and oligonucleotide microarrays.
`
`INTRODUCTION
`· The DNA microarray enables researchers to survey the entire
`transcriptome of virtually any cell population. This capability
`produces unprecedented quantities of raw data and enables the
`investigation of gene expression, functional genomics and
`
`genetic complexity with potentially many more applications
`(1-4). Although production capabilities and use of micro(cid:173)
`arrays are becoming increasingly well established, significant
`differences exist with regard to fabrication techniques and end
`user protocols. Such differences make it difficult to compare
`results across platforms and present data management ch!ll·
`Ienges for the integration of databases. Fabrication parameters
`that may vary include: surface chemistry of slides (5-9), type
`and length of printed DNA (2,9) and immobilization or fixing
`strategies for the spotted DNA. Various end user protocols
`include: pre-hybridization surface blocking (3), mRNA label(cid:173)
`ing protocols, hybridization protocols, post-hybridization
`wash stringency and data analysis techniques (4,10,11). An
`· additional area of great concern is the implementation
`(placement and type) of appropriate controls aimed at quality
`assurance and quality control. The absence of approaches that
`are based on 'best practices' for design, fabrication, and end
`use of microarrays makes comparative data analysis between
`groups problematic. Although some work has been recently
`published that addresses several of these issues, (2-7,9-13)
`there is still little consensus about which design features and
`end user protocols are optimum for highest quality microarray
`data. In a recent attempt to develop microarray standards, the
`authors of the MIAME (minimum information about a
`microarray experiment) protocol have introduced guidelines
`for establishing standards concerning the information require(cid:173)
`ments for a more effective comparative analysis of microarray
`data between groups (10):The emphasis on these guidelines is
`however on documentation and not on engineering guidance.
`This paper aims at providing engineering guidance in the
`fabrication of eDNA and oligonucleotide microariays.
`The glass surfaces of DNA microarrays have been modified
`in various ways to immobilize DNA (oligonucleotides and/or
`eDNA) (5-9). Common surface modifications for printing and
`affixing DNA onto glass slides are: poly-L-lysine (PLL) (14),
`3-aminopropyltrimethoxysilane (APS) (3,5,9), 3-glycidoxy(cid:173)
`propyltrimethoxysilane (GPS) (7,9) and aldehyde or car(cid:173)
`boxylic acid (5). DNA has also been directly printed onto
`unmodified glass (9). Amine-terminated eDNA and amine(cid:173)
`terminated oligonucleotides may be covalently coupled to
`epoxide, isothiocyanate and aldehyde activated glass surfaces
`(7). Non-terminated DNA has also been spotted onto amine(cid:173)
`functionalized surfaces such as PLL, APS and surfaces that
`
`*To whom correspondence should be addressed at Center for Bioelectronics, Biosensors and Biochips (C3B), Virginia Commonwealth University, PO Box
`843038,601 West Main Street, Richmond, VA 23284-3038, USA. Tel: +I 804 827 7016; Fax: +I 804 827 7029; Email: guiseppi@vcu.edu
`
`Page 1 of 19
`
`BD Exhibit 1017
`
`
`
`••
`
`e87 Nucleic Acids Research, 2003, Vol. 31, No.J6
`
`were functionalized and derivatized with polyamidoamine
`dendrimer (PAMAM) (6).
`·
`One possible advantage of GPS, APS and PAMAM over
`PLL is that the former are covalently immobilized to the
`silicon bearing hydroxide functional groups on the surface of
`glass, while PLL is immobilized by adsorption, the result of
`acid-base
`interactions and hydrogen bonding with
`the
`amphoteric glass surface (15). Moreover, it has been reported
`that aminosilanes and PAMAM surfaces offer- a more
`consistent surface than PLL, with lower background and
`higher overall fluorescent signal intensities. (6). Given that
`there are -5.0 silanol groups/nm2 on a fully hydroxylated
`silica surface that is supplemented by a few layers of surface
`bound water, and given that the APS molecule could pack to a
`limit of -5 molecules/nm2 (perfect hydrocarbon chain pack(cid:173)
`ing, e.g. c-axis of polyethelene crystals packs at -5.2-5.4),
`then it is likely that a well-packed APS layer would typically
`present in the range 3.5-4.0 amine groups/nm2 (16,17), while
`PAMAM derivatized surfaces present -66 amines/nm2 (18). In
`addition, PLL surfaces generally require an induction period
`of -2 weeks before they .can produce consistent microarray
`results (3). PLL, APS and PAMAM all present amine
`functional groups suitable for interaction with DNA via
`hydrogen bonding and, potentially, via electrostatic inter(cid:173)
`actions (9) under the appropriate pH conditions. DNA is
`commonly 'cross-linked' on these surfaces by exposure to UV
`light, however this process is poorly understood bl!t is
`believed to involve the creation of radicals' that induce inter(cid:173)
`chain cross-lih.k..ing. GPS, in contrast, allows amine-terminated
`DNA to be covalently immobilized to the surface (19) via an
`amine-initiated nucleophilic ring opening reaction that leads
`to covalent bond formation between the GPS and the amine(cid:173)
`terminated DNA.
`Blocking reactions are typically employed to prevent
`labeled reverse transcription product from adsorbing to the
`surface of the printed microarray during the hybridization
`reaction. Blocking methods provide the added advantage of
`washing away unbound DNA from the surface that would
`. otherwise compete with the labeled species (3). Two of the
`most common blocking methods to address non-specific
`adsorption on amine-modified microarrays involve blocking
`with succinic anhydride (SA) (3,14) or bovine serum albumin
`(BSA) (3). Both are intended to block the unreacted functional
`groups of the printed microarray with chemistries that have
`low affinity for DNA.
`In this paper, we report an evaluation of spotting concen(cid:173)
`tration, surface chemistries and blocking strategies for their
`combined role in the performance of oligonucleotide and
`eDNA microarrays. Our goal was to establish optimum
`protocols for manufacturing, spotting, hybridization and
`scanning of microarrays. eDNA and oligonucleotide micro(cid:173)
`arrays were therefore spotted on six different surfaces. These
`surfaces evaluated were: APS, GPS, DAB-AM-16-poly(pro(cid:173)
`pyleminime hexadecaamine) (DAB), and PLL. DAB is a
`generation 3 dendrimer that was linked to the glass surface via
`covalent coupling following surface modification with GPS.
`In addition, two unmodified blank slides: (i) RCA-cleaned, but
`not surface modified (RCA); and (ii) cleaned and immersed in
`Tris-EDT A buffer (TEB) were also evaluated. Microarrays
`were blocked with either SA (SA-blocked), BSA (BSA(cid:173)
`blocked) or left unblocked. These surfaces represent a broad·
`
`•
`
`PAGE 2 OF 19
`
`range of available surface chemistries. The GPS presents the
`reactive glycidoxy functional group to which amine-termin(cid:173)
`ated oligonucleotides and eDNA, derived from amine-termin(cid:173)
`ated primers. could be covalently affixed. The APS, PLL and
`DAB surfaces present varying densities of amine functional(cid:173)
`ities for hydrogen-bonding interactions with DNA. The RCA(cid:173)
`cleaned glass slides served as a reference surface while the
`TEB immersion deliberately introduced surface contamin- .
`ation to otherwise cleaned glass slide. surfaces. The non(cid:173)
`blocked surface served as the control for blocking. These
`surfaces and blocking strategies were evaluated by fabricating
`microarrays of eDNA and 30mer oligonuclotides prepared
`using the human GAPDH gene sequence. The oligonucleo(cid:173)
`tides and eDNA were spotted at five different concentrations
`and hybridized to Alexaflour 555-labeled GAPDH PCR
`product. Wettability of the surfaces was determined by contact
`angle measurements with hexadecane and ultrapure water.
`Surface morphology was characterized by atomic force
`microscopy (AFM).
`
`MATERIALS AND METHODS
`Cleaning, preparation and surface modification of
`microarray slides
`In a class 1000 clean room, 50 VWR brand glass microscope
`slides (VWR 48300-025) were solvent cleaned by immersion
`for 1 min in boiling acetone followed by 1 min in boiling
`isopropanol. The slides were then washed in ultrapure H20 (18
`MOhm) for 1 min and dried with filtered nitrogen. Next, the
`slides were UV/ozonated for 15 min on one side using a
`Boeke! UV Clean Model 135500 followed by ultrasonication
`in a Branson 1510 ultrasonicator in isopropanol for 5 min. The
`slides were then washed in diH20 and dried using filtered
`nitrogen. Finally, the slides were activated by immersion in a
`(5: 1: 1) solution of diH20:hydrogen peroxide:ammonium
`hydroxide (RCA) at 60°C for 1 min, followed by diH20
`wash, placed in glass slide carriers and dried in a convection
`oven for 30 min at 80°C. After this step, RCA-cleaned slides
`were stored for subsequent spotting.
`The cleaned slides were then partitioned into six groups.
`One group of nine slides was modified by immersion in a
`solution of y-APS 0.1% v/v in anhydrous toluene for 30 min at
`40°C, washed three times in anhydrous toluene, placed in a
`glass staining dish and cured in a convection oven for 20 min
`at 11 0°C. The slides were then stored until needed for printing.
`Twenty-four slides were chemically modified by immersion in
`a solution of GPS 0.1% v/v in anhydrous toluene for 30 min at
`40°C, washed three times in anhydrous toluene, placed in a
`glass staining dish and cured in a convection oven for 20 min
`at 11 0°C. Nine of these slides were stored for printing, and the
`remaining slides were subsequently modified by immersion in
`a solution of DAB 1.0% v/v in absolute ethanol overnight at
`room temperature. After the overnight incubation, the slides
`were washed three times in ethanol, placed in a glass staining ·
`dish and cured in a convection oven for 20 min at ll0°C. The
`nine remaining slides were immersed in TEB (1.0 M Tris,
`0.1 M EDT A) for 30 min at room temperature, washed in
`diH20, dried in a convection oven and stored. Nine slides were
`modified with PLL. The slides were immersed in a solution of
`70 ml phosphate-buffered saline, 70 ml of 0.1% PLL and
`
`Page 2 of 19
`
`
`
`•
`
`PAGE 3 OF 19
`
`•
`
`Nucleic Acids Research, 2003, Vol. 31, No. 16 e87
`
`560 ml of diH20, then incubated with gentle shaking for 1 h at
`room temperature. The slides were then washed five times in
`diH20, dried with filtered nitrogen and placed in a 55°C
`vacuum oven for 10 min. All slides were stored in a plastic
`microscope box wrapped in aluminum foil then placed in a
`desiccator cabinet until needed for spotting. The PLL(cid:173)
`modified slides were stored for 1 week prior to microarray
`spotting.
`·
`
`Contact angle and AFM measurements
`Contact angles of de-ionized ,water (YL = 'YLP + 'YL d =53 + 20 =
`73 mN m-1) and anhydrous hexadecane (YL"' Yt.d = 26 mN m-1)
`were measured at the cleaned or chemically modified
`microscope glass slides using an NRL Contact Angle
`Goniometer
`(Rame-Hart
`Inc., Mountain Lakes, NJ).
`Octadecyltricholorsilane (OTS) was used as a reference
`surface and was prepared following solvent cleaning ·by
`immersion in 0.1% v/v OTS in anhydrous toluene at 40°C for
`30 min. The slides were then rinsed three times with toluene
`and dried at l10°C for 20 mil!. In a contact angle measure(cid:173)
`ment, a droplet ( -15 ).l.l) of probe solvent was placed on the
`cleaned or modified glass slide from a fixed height, and the
`contact angle was directly measured through the focusing lens
`of the goniometer. AFM was performed using a Digital
`Instruments Dimension 3 100 Atomic Force Microscope. Scan
`rates were set between 5 and 8 Hz depending on the image
`quality, and the scan size was changed from I to 10 ).l.m upon
`engagement of the cantilever. The instrument was operated in
`tapping mode to obtain the micrographs. The resulting height
`images were processed using Nanoscope ill software. Images
`were flattened to remove scan lines, and the height scale was
`set to 75 nm. Feedback controls such as integral gain,
`proportional gain and amplitude set point were modulated in
`real time as the image was being generated. Integral and
`proportional gain were always set between 2 and 0.5.
`Preparation of GAPDH eDNA for arraying
`The glyceraldehyde-3-phosphate dehydrogen.ase (GAPDH)
`gene fragment obtained from PCR was a source of eDNA for
`arraying onto the slides prepared in the previous step. Amine(cid:173)
`modified PCR primers: forward: 5' amine-C6-ccacccatgg(cid:173)
`caaattccatggcaccgtca and reverse: 5' amine-C6-ggtttttcta(cid:173)
`gacggcaggtcaggtccacc, were diluted to a working con(cid:173)
`centration of 0.001 ·).l.g/).11 and 10 ).l.l was then mixed with
`0.5 ).l.l (5000 U/).l.l) of New England Biolabs (NEB) Taq
`polymerase (M0267S), 0.1 ).l.l (200 mM) dNTPs (Invitrogen
`10216-012, 014, 016, 018), 5 ).l.l of lOX NEB PCR buffer,
`0.5 ).l.l of GAPDH template and 34 ).l.l of diH20 per 50 ).l.l
`reaction for a total of 50 reactions. The reaction was initiated
`at 95°C for 30 s and cycled 29 times under the following
`conditions: melt at 95°C for 30 s, anneal at 50°C for 30 s and
`
`extend at 72°C for 1 min using an MJ Research PTC-200
`· thermal cycler. After PCR, the reaction products were
`combined and distributed into three 1.7 ).l.l centrifuge tubes.
`To each tube was added 750 ).l.l of 100% ice:cold isopropanol
`and'the tubes were centrifuged at 14 000 r.p.m. for 30 min in
`an Eppendorf Model 5804R centrifuge to pelletize the PCR
`product. The pellet was washed in 75% ethanol and re-pelleted
`by centrifugation at 14000 r.p.m. for 30 min. After
`centrifugation ·the pellet was re-suspended in 20 ).l.l diH20
`per tube and the contents of each tube were combined. The
`concentration of GAPDH in solution was quantified by UV
`spectroscopy with a Perkin Elmer Lambda 40 spectrometer.·
`The GAPDH eDNA was diluted to the concentrations of 2.0,
`1.0, 0.5, 0.2, 0.02 and 0.002 ).l.g/).11. An equal volume of 2X
`sp9tting buffer (3M Betaine, 6X SSC) was added to each of
`the dilutions to make the 1 X spotting solution. The solutions
`were then distributed into separate 96 well V bottom micotiter
`plates using a Packard Biochip MultiProbell Liquid Handling
`robot. The plates were stored at -20°C until needed for
`spotting.
`
`Preparation of oligonucleotides for arraying
`Oligonucleotide primers were designed using the GAPDH
`sequence (accession no. NM_002046) and synthesized by
`Integrated DNA Technologies. Table 1 lists the oligonucle(cid:173)
`otides, their 5' modification and their position in the GAPDH
`sequence. The forward, interior and randoin primers were
`diluted to the 2X concentrations: 2.0, 1.0, 0.5, 0.2, 0.02 and
`0.002 ).l.g/).11 in diH20 and mixed with an equal volume of 2X
`spotting buffer (3 M betaine, 6X SSC). The forward, interior
`and random primers were arrayed on each type of chemically
`modified glass slide as well as onto the two groups of
`unmodified slides (RCA-cleaned and buffer immersed).
`Probe immobilization
`Array
`fabrication was performed using a Cartesian
`Technologies PixSys 5500SQ Pin Array Robot and Liquid
`Dispensing System. Forward,
`interior and
`the random
`oligonucleotide sequences were spotted in three sub-arrays
`on slides that were modified with GPS, APS, DAB, PLL and
`the unmodified slides (RCA-cleaned and buffer immersed).
`PCR amplified GAPDH eDNA was also spotted on these
`slides in three additional but separate sub-arrays. The DNA
`arrayed on these surfaces was spotted in graded concentrations
`using the betaine spotting solution. The final DNA microarray
`layoutis shown in Figure 1. After spotting, the APS, DAB,
`PLL, RCA and buffer immersed arrays were cross-linked with
`90 mJ/cm2 in an Ultra-Violet Products CL-1000 UV cross(cid:173)
`linker and baked at 80°C for 1.5 h. The GPS arrays were
`incubated at 42°C in 50% humidity for 8 h, rinsed with 0.2%
`SDS solution for 2 min by vigorous shaking, washed three
`
`Table 1. Oligonucleotide sequence infonnation
`
`Oligo name
`
`Position
`
`Modification
`
`Sequence
`
`Forward
`Reverse
`Interior
`Unlabeled competitor
`Randomer
`
`228-258
`802-811
`502-531
`Complement of interior
`None
`
`Amine
`Amine
`Amine
`None
`Amine
`
`ccacccatgg caaattccat ggcaccgtca
`ggmttcta gacggcaggt caggtccacc
`cagcctcaag atcatcagca atgcctcctg
`caggaggcat tgctgatgat cttgaggctg
`acctggacct gaatccgcca tatagcctac
`
`Page 3 of 19
`
`
`
`•
`
`e87 Nucleic Acids Research, 2003, Vol. 31, No. 16
`
`•
`
`PAGE 4 OF 19 .
`
`eo e c:> eo o o e·
`e·o o o.o.o o o.oo
`• o oo.o.oooo·o.,._-,,(n..:., ..•
`• 0 0 0 0 o.o 0·0 o-11--;t;;;::i~r
`• 0 opo 0 0 0 0-.0~--.....;lnni~:.
`• oo·o·o.oo.o.o·c>+--o.
`
`Probe concentrations
`0 O o o o • • • •11---1000n2/u.l
`0 0 0 0 0 e e • •11--~500nl!liul
`0 0 0 0 0 • • • •it----:250nl!lul
`0 0 0 0 0 e • • •11--1 (tnl!l'ul
`o o o o o • • e·~t---tn!1/ll.ll
`00000_ • • •
`
`high stringency buffer (0.1 X SSC, 0.05% SDS) (Genomic
`Solutions 16004501), post wash buffer (0.1 X SSC) (Genomic
`Solutions 16003501) and diH20. The arrays were then dried
`with filtered nitrogen. Each microarray wa~ scanned at 5 J.lm
`resolution using a Perkin Elmer ScanArray 5000 microarray
`scanner using the 488 nm filter.
`
`RESULTS
`Surface chemistry and blocking strategy
`Four chemically modified and two unmodified glass surfaces
`were studied for their characteristics relating to: (i) im(cid:173)
`mobilization of eDNA and oligonucleotides, (ii) resulting
`slide background intensity after hybridization, (iii) signal
`intensity (spot intensity/slide background intensity) following
`hybridization and (iv) spotting uniformity. The surface
`chemistries evaluated were y-APS. GPS, DAB (linked to the
`glass surface via GPS), PLL, a cleaned glass surface that had
`been immersed in TEB and a RCA-cleaned surface. These
`surfaces were selected because they are commonly used or
`otherwise cost effective/easy to implement in the microarray
`fabrication laboratory. While there are several alternative
`attachment chemistries (5,7), we limited this study to the most
`widely used and well-documented examples. Most eDNA
`microarray fabrication has been reported using PLL surfaces
`(2,3,14,15). However, Hegde et al. (3) and Liu et al. (20) have
`used APS surfaces for their eDNA microarray work and APS(cid:173)
`modified glass surfaces are commercially available from
`Coming [CMT-GAPS slides (catalog no. 40004, Coming)]
`and Telechem [Super Amine slides (catalog no. SMM)] (web
`addresses for microarray substrates: Corning: http://www.
`coming.com!LifeSciences/pdf/gaps_ii_coated_slides_IO_OI_
`ss_cmt_gaps_002.pdf and Telechem: http://arrayit.com/
`Products/Substrates/substrates.html).
`In an effort to identify a better microarray surface, one
`group has examined
`the amine presenting compound,
`PAMAM (6), and found it to have superior background and
`oligonucleotide capturing characteristics. We chose a closely
`related compound to that used by Benters et al. (6) for
`comparison with the common amine surfaces. As a means of
`
`6 X 10 sub grid$
`
`Microarray Layout
`
`Figure 1. Microarray layout.
`
`times in diH20, incubated in diH20 at 50°C for 20 min then
`dried with filtered nitrogen. All arrays were then stored in foil(cid:173)
`wrapped slide-boxes in a desiccator cabinet overnight prior to
`hybridization.
`Labeling of GAPDH target
`The forward and reverse oligonucleotide primers were used to
`. amplify a 600 bp region of the GAPDH gene for ftuorophore
`labeling. The previously described PCR protocol was used
`except that aminoallyl dUTP (Molecular Probes A-21664) was
`included in the reaction mixture at a ratio of 3: 1 dUTP:TTP for
`a final concentration of 200 mM in each 80 J.Ll reaction for a
`total of 60 reactions. The resulting PCR product was labeled
`using the ARES™ DNA labeling kit from Molecular Probes
`(A-21665) according to the supplied protocol.
`Pre-hybridization blocking
`Twelve slides were immersed in pre-hybridization buffer
`containing 5 X SSC, 0.1% SDS and 1.0% BSA, incubated at
`42°C for 45 min, washed 5 X in diH20 then dried using filtered
`nitrogen. Another 12 slides were immersed in SA pre(cid:173)
`hybridization solution containing 15 ml sodium borate and
`6 g SA in 350 ml 1-methyl-2-pyrrolidinone. The solution
`containing the slides was incubated on an orbital shaker for
`20 min, quenched in boiling diH20, washed five times in 95%
`ethanol and dried using filtered nitrogen. Twelve slides were
`left unblocked. The remaining slides in the GPS and RCA
`groups were . processed separately according to the same
`protocol.
`Hybridization and imaging
`Each group of slides was hybridized using a GenTac
`Hybridization Station (Genomic Solutions). 100
`J.Ll of
`hybridization buffer [4X SSC; 1 X Denhardt's reagent, 5.0%
`SDS, 10% dextran sulfate, 40% formamide solution (50% v/v
`diH20)] containing 40 ng labeled GAPDH eDNA and, for
`some experiments, 24 ng unlabeled competitor, was added to
`each microarray hybridization solution. The hybridization was
`allowed to proceed for 16 hat 42°C. After hybridization, the
`arrays were sequentially washed with medium stringency
`buffer (2X SSC, 0.1% SDS) (Genomic Solutions 16004001),
`
`Page 4 of 19
`
`
`
`•
`
`PAGE 5 OF 19
`
`•
`
`Nucleic Acids Research, 2003, Vol. 31, No. 16 e87
`
`Figure 2. Schematic illustration of the various surface chemistries studied and the idealized interaction of DNA with functional groups on a glass surface.
`(A) GPS covalently bound to an amine-terminated oligonucleotide. (B) PLL hydrogen bonding with an oligonucleotide. (C) One-half of a DAB dendrimer
`hydrogen bonding with an oligonucleotide. (D) APS hydrogen bonding with an oligonucleotide.
`·
`
`. covalent coupling, it has been reported that epoxy-silane
`(GPS) has been used for immobilizing amine-terminated
`oligonucleotides and eDNA (5,21). Figure 2 is a schematic
`illustration of the various surfaces studied.
`The pre-hybridization blocking strategies studied were: no
`blocking, the adsorption of BSA and the reaction of SA. The
`ability of each of these three blocking strategies to· reduce
`post-hybridization background intensity was investigated for
`each of the six surfaces. SA is con:imonly used as a blocking
`reagent in eDNA microarrays prepared on amine-functiona(cid:173)
`Iized surfaces (3,13). The anhydride readily reacts with the
`available amines forming the amide and thereby eliminating
`the amine from the surface with the intent of avoiding non(cid:173)
`specific adsorption of DNA. Such an approach should be
`effective for both oligonucleotide and eDNA microarrays.
`A blocking solution containing BSA has been reported
`
`by Hegde et al. (3) to result in lower background intensities
`when compared with SA. BSA is a neutral globular protein
`that readily adsorbs to surfaces and is commonly used in
`ELlS As.
`There are two microarray platforms in wide usage: eDNA
`and oligonucleotide arrays. The oligonucleotide arrays vary in
`oligonucleotide length but are generally 25-70mers while
`printed eDNA typically ranges from 70 to 600 bp. Both types
`were evaluated in this study. The oligonucleotides selected
`were 30mers of the GAPDH gene and the eDNA was an
`-600 bp PCR product amplified from GAPDH using amine(cid:173)
`terminated primers. Both types of DNA were spotted over a
`broad range of concentration (0.001-0.5 J.Lg/J.Ll).
`We measured spot quality as a function of spot and
`background intensities. All intensities were measured under
`the same conditions of laser power and PMT gain. Images
`
`Page 5 of 19
`
`
`
`•
`
`e87 Nucleic Acids Research, 2003, Vol. 31, No. 16.
`
`•
`
`PAGE 6 OF 19
`
`Aa
`
`Unblocked. Average Ba~kground lnte.,si.ties
`
`ElRCAcDNA
`•GPS Oligo!
`•GPScONA
`IIITEBOII~o
`•TEB cO
`•APS Oligo!
`SAPS cDNAi
`o PLL Oligo
`IDPLL eDNA
`II DAB Oligo
`•DAB cDNJ)
`Concentration
`
`<t z
`0
`.!2>
`ca
`i5
`en
`<(
`u a.
`a:::
`(.!)
`
`o·
`<t
`.21
`z 5
`0
`Q)
`(J
`.en w
`a. 1-
`(.!)
`
`0
`01
`
`0
`~
`0
`
`en
`a.
`<(
`
`..J
`..J
`a.
`
`Surface.Chemlstry
`
`Ab
`
`4000
`
`2000
`
`0
`
`Concentration
`
`were subsequently scanned at the same resolution (5 microns).
`Our findings are presented according to the blocking strategy
`employed.
`
`Background intensities
`Figure 3A-C shows the average background intensities
`following hybridization to target for all the eDNA and
`oligonucleotide sectors of all six chemically modified sur(cid:173)
`faces. Background intensities were measured for each of the
`
`six different spotting concentrations · (0.001-0.5
`J.l.g/J.l.l)
`employed and averaged over the many replicates for that
`concentration. We chose this approach to allow us to discern.
`the influence of spotting concentration, and hence spot
`intensity, on the intensity of the background signal as
`perceived by the QuantArray software. All intensities were
`measured using the same QuantArray parameters and were
`plotted on the same scale to allow ready visual comparison of
`the data. Figure 3A shows the background intensity of.
`
`Page 6 of 19
`
`
`
`•
`
`PAGE 7 OF 19
`
`•
`
`Nucleic Acids Research, 2003, Vol. 31, No. 16 e87
`
`Ba
`
`BSA Average Background Intensities
`
`•·GPS Oligo
`•GPSeDNA
`•TEB.Oiigo
`rnTEB eDNA
`•APS Oligo
`mAPS eDNA
`El PLLcDNA
`DPLLOiigo
`1111 DAB Oligo
`•DAB eDNA
`Concentration
`
`<(
`0
`.£1 z
`5
`0
`(,)
`tn
`c. c.
`(!)
`(!)
`
`(/)
`
`<( z
`0
`(,)
`<(
`
`(..) a::
`
`0
`.£1
`5
`tn
`~
`
`0
`Cl
`
`0
`0
`.Ql m
`5
`<(
`0
`...J
`...J c.
`
`Surface Chemistry
`
`BSA Average Background Intensities
`----------------------~
`a GPS Oligo
`ID RCA eDNA..
`il GPS :eDNA
`• TEB Oligo·.
`61 TEB. CDNA
`a AP$ Oligo,
`.erAPS. eDNA·
`I'J PLL eDNA
`fJ PLL Oligo
`a DAB Oligo
`aDABeDNA
`
`Bb
`
`4000
`
`a(cid:173)
`iii c .e
`
`.5 .2000
`
`0
`
`2
`
`3
`4
`Concentration
`
`5
`
`6
`
`unblocked slides, while Figure 3B and C shows
`the
`background intensities of the BSA- and SA-blocked slides,
`respectively.
`It can be seen in Figure 3A (unblocked) that the amine(cid:173)
`bearing sutfaces gave the highest background intensities
`(-4000 counts) when compared with the unmodified sutfaces,
`RCA and TEB, and the epoxide-bearing sutface .. Figure 3B
`(BSA-blocked) shows very similar behavior to the unblocked
`slides. That is, the amine-bearing sutfaces gave higher
`
`background intensities when compared with the unmodified
`sutfaces, RCA and TEB, and the epoxide-bearing sutface.
`However, in this case the background intensities are between
`1000 and 2000 counts, half as much as the unblocked slides.
`BSA therefore reduces the background intensity by -50%
`compared with unblocked slides. It is noteworthy that this
`reduction in background intensity is most significant for the
`amine-bearing sutfaces and does not significantly affect the
`background intensities of the unmodified sutfaces, RCA and
`
`Page 7 of 19
`
`
`
`•
`
`e87 Nucleic Acids Research, 2003, Vol. 31, No. 16
`
`•
`
`PAGE 8 OF 19
`
`SA Average, Background. Intensities
`
`Ca
`
`s~RCA eDNA I
`•GPS Oligo
`•GPS.cDNA
`•TEBOiigo
`cTEB eDNA
`•APSOilgo
`mAPS eDNA
`OPLLcDNA
`oPLL Oligo
`II DAB Oligo
`• DAB eDNA
`
`~
`0
`0
`<(
`()
`0:
`
`0)
`
`0 ~
`0 o·
`0
`en
`en
`0..
`0..
`<!)
`<!)
`
`a:l
`w
`1-
`
`0
`0)
`
`0
`en
`~
`
`0
`.!2'
`a
`
`a:l
`..J
`..J <(
`0.. 0
`
`Surface Chemistry
`
`Cb
`
`SA Average Background Intensities
`~UU'UU]~~~~----~~~
`•GP$01igo
`lilTEB Oligo
`iliAPSOiigo
`OPLLOiigo
`•DAB Oligo
`
`•GPScDNA
`•TEB eDNA
`l:lAPScDNA
`DPLL.cDNA
`
`2
`
`3
`
`4
`Concentration
`
`5
`
`6
`
`Figure 3. (Previous two pages and above) Average background intensities following hybridization of all eDNA and oligonucleotide sectors at different
`spotting concentrations (0.001-1.0 J,tg/J,tl) for all six surfaces studied. These are grouped by the blocking method employed; (A) unblocked, (B) BSA blocked
`and (C) SA blocked. (a) 3D bar charts of average background intensities as a function of spotting concentration and surface chemistry. (b) 2D bar charts
`showing the standard error.
`
`TEB, or the epoxide-bearing surface. It can be seen in
`Figure 3C (SA-blocked) that the amine-bearing surfaces
`likewise gave higher background intensities compared with
`the unmodified surfaces, RCA and TEB, and the epoxide(cid:173)
`bearing surface. However, in the case of SA blocking, these
`background values were considerably higher than those found
`for the amine-bearing surfaces on unblocked and BSA-
`
`blocked slides. Here, background intensities ranged from
`3000 to 24 000 counts. There is also clear variation in the
`behavior of oligonucleotide an~ eDNA spots when blocked
`with SA. Oligonucleotide sectors were less prone to high
`background intensity counts while eDNA sectors gave high
`counts. Close observation of the scanned images revealed
`sizable comet tails on the eDNA spots. These observations
`
`Page 8 of 19
`
`
`
`•
`
`PAGE 9 OF 19
`
`•
`
`Nucleic Acids. Research, 2003, Vol. 31, No. 16 e87
`
`have been previously reported in microarray experiments
`using SA blocking
`(19,20, Oregon State Microarray
`Laboratory: http://www .cgrb.orst.edu/CSL/custom. pdf). SA
`appears to have a deleterious effect on UV-cross-linked
`eDNA spots, inducing comet tail formation, compromising the
`integrity ofDNA spots.
`
`Spot intensities
`Oligonucleotide and eDNA sectors were spotted at concen(cid:173)
`trations of 0.001, 0.01, 0.1, 0.25, 0.5 and 1.0 J.l.g/J.I.l. Figure 4A
`and B shows the·resulting raw spot intensities obtained over
`these six concentrations and under the three blocking condi(cid:173)
`tions studied. For eDNA sectors the plots display a fairly sharp
`rise to plateau between 0.25 and 1.0 J.l.g/J.I.l resulting in higher
`spot intensity · values
`than oligonucleotide sectors. The
`oligonucleotide plots did not exhibit a plateau, rather they
`displayed a constant gradual rise and a smaller and more even
`slope. Although both types of DNA were spotted at the same
`concentration, the raw spot intensities of oligonucleotide
`sectors were generally lower than those of eDNA sectors
`(Fig. 4B versus A) over all surfaces studied. eDNA sectors
`displayed an -2-8-fold higher raw intensity than oligonucle(cid:173)
`otide sectors for any given concentration.
`The difference between eDNA and oligonucleotide spot
`intensities was especially apparent among the amine surfaces
`where spot intensities differed 8-fold. Oligonucleotides and
`eDNA exhibited close clustering at each concentration
`regardless of the surface modification employed, except for
`the buffer-treated surface. However, oligonucleotide intensity
`on the GPS surface was slightly higher than that found on
`other surfaces when blocked with BSA or in the unblocked
`conditio