`
`Nucleic Acids Research, 2001, Vol. 29, No. 71338
`
`Manufacturing DNA microarrays of high spot
`homogeneity and reduced background signal
`
`Frank Diehl*, Susanne Grahlmann, Markus Beier and Jorg D. Hoheisel
`
`Functional Genome Analysis, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 506, D-69120 Heidelberg,
`Germany
`
`Received January 11. 2001; Revised and Accepted February 13, 2001
`
`ABSTRACT
`
`Analyses on DNA microarrays depend considerably
`on spot quality and a low background signal of the
`glass support. By using betaine as an additive to a
`spotting solution made of saline sodium citrate, both
`the binding efficiency of spotted PCR products and
`the homogeneity of the DNA spots is improved
`significantly on aminated surfaces such as glass
`slides coated with the widely used poly-L-lysine or
`aminosilane.
`In addition, non-specific background
`signal
`is markedly diminished.
`concomitantly,
`during the arraying procedure, the betaine reduces
`evaporation from the microtitre dish wells, which
`hold the PCR products. Subsequent blocking of the
`chip surface with succinic anhydride was improved
`considerably in the presence of
`the non-polar,
`non-aqueous solvent 1,2-dichloroethane and the
`acylating catalyst N-methylimidazole. This procedure
`prevents the overall background signal that occurs
`with
`the
`frequently applied
`aqueous
`solvent
`1-methyl-2-pyrrolidone in borate buffer because of
`DNA that re-dissolves from spots during the blocking
`process, only to bind again across the entire glass
`surface.
`
`INTRODUCTION
`
`DNA microarrays are produced by in situ synthesis of oligo-
`nucleotides (1,2) or
`the immobilisation of pre-fabricated
`molecules (3). Currently, glass slides are mainly used as
`support medium because of their favourable optical character-
`istics. Especially for transcriptional profiling analyses (4,5),
`PCR products are spotted onto activated glass surfaces coated
`with poly-L-lysine or aminosilane. Since the efficiency of
`binding PCR products to glass slides still limits the sensitivity
`and the dynamic range of such measurements, performance is
`directly influenced by the amount of DNA that is attached to
`the surface. Also, DNA spots of high homogeneity are beneficial,
`since they simplify image analysis and considerably enhance
`the accuracy of signal detection. One important factor in the
`spotting process is the chemical properties of the solution in
`which the DNA is dissolved. With the widely used saline
`sodium citrate (SSC) buffer, binding efficiency and spot
`
`uniformity are often poor. The problems are reduced by
`supplementing SSC with 50% dimethyl sulfoxide. This reaction
`buffer has the disadvantage, however, of being both toxic and
`a solvent for many materials, apart from its only limited effect
`on spot appearance.
`Another critical part of microarray manufacturing is the
`processing of the glass surface after spotting, during which the
`remaining, unreacted amino residues of the poly-L-lysine
`polymer or aminosilane are deactivated. This prevents subse-
`quent binding of DNA, which increases the background signal
`upon hybridisation of a labelled target. Blocking is usually
`achieved by reacting the arrays with succinic anhydride in
`aqueous, borate-buffered 1-methyl-2-pyrrolidinone (NMP),
`converting the amines into carboxylic moieties (3,5). During
`this process, however, the spotted DNA comes in contact with
`the aqueous blocking solution,
`is partly re-dissolved and
`spread across the entire slide. To prevent this, we developed a
`robust processing protocol that makes use of a non-polar, non-
`aqueous solvent and accelerates the blocking reaction by the
`addition of a catalyst.
`
`MATERIALS AND METHODS
`
`Probe and target synthesis
`
`For the analysis, non-homologous DNA inserts of ~500 bp in
`length were picked at random from a clone library generated
`by cDNA representational difference analysis (6). They were
`PCR-amplified in 100 pl reactions with the universal primer
`d(AGGCAACTGTGCTATCCGAGGGAA), purified by an
`isopropanol precipitation and resuspended in water. The DNA
`concentration was determined by measuring the fluorescence
`signal obtained in the presence of the dye Hoechst-33258.
`Purity of the fragments was checked by agarose gel electro-
`phoresis. For the generation of complementary hybridisation
`targets, a Cy5-labelled oligonucleotide primer of identical
`sequence was used for amplification.
`
`Fabrication of microarrays
`
`Poly-L-lysine-coated glass slides of 75 X 25 mm were prepared
`as described (3) (http://cmgm.stanford.edu/pbrown/MGuide).
`Slides with aminosilane
`surface
`(CMT-GAPSTM) were
`purchased from Corning (Corning, USA). The DNA spotting
`solution was adjusted to either 45 mM sodium citrate pH 7.0,
`450 mM NaCl
`(3>< SSC) or the same composition supple-
`mented with 1.5 M betaine (N,N,N-trimethylglycine; Sigma,
`
`*To whom correspondence should be addressed. Tel: +49 622} 424680; Fax: +49 6221 424682; Email: f.diehl@dkfz.de
`
`BD EXHIBIT 1021
`BD EXHIBIT 1021
`
`
`
`PAGE 2 OF 5
`
`e38 Nucleic Acids Research, 200], Vol. 29, No. 7
`
`Germany). DNA spotting was done with an SDDC-2 DNA
`Micro—Arrayer
`from Engineering Services
`Inc.
`(Toronto,
`Canada). A single SMP3 pin (TeleChem International Inc.,
`Sunnyvale, USA) was used to avoid differences between pins.
`The DNA samples were printed in quadruplicate at a 200 um
`centre-to-centre spacing. Slides were left at room temperature
`overnight and then heat-treated on a metal block at 80°C for
`5 s. The DNA was crosslinked to the support by UV irradiation
`with a total energy of 60 m] in a Hoefer UV-crosslinker (Amer-
`sham Pharrnacia Biotech, Freiburg. Germany). For the blocking
`process, 1 g succinic anhydride (Fluka, Deisendorf, Germany)
`was freshly dissolved in 200 ml anhydrous 1,2-dichloroethane
`(DCE; Fluka). To this solution, 2.5 ml of N-methylimidazol
`(Fluka) was added and immediately poured into the slide
`chamber. Incubation was for 1 h, placed on an orbital shaker
`for slight agitation. Subsequently,
`the slides were briefly
`washed in 200 ml of fresh DCE and incubated in boiling water
`for 2 min for DNA denaturation. After a brief rinse in 95%
`
`ethanol, they were left to dry at room temperature. Blocking
`with succinic anhydride in borate-buffered NMP was carried out
`according to the protocol published by Eisen and Brown (5).
`
`Hybridisation of labelled samples
`
`For each hybridisation, 0.2 pg of Cy5-labelled and 1.8 ug of
`unlabelled PCR product were mixed and precipitated with
`ethanol. The pellet was taken up in 15 ul hybridisation buffer
`of 50% formamide, 3x SSC, 1% SDS, 5>< Denhardt’s reagent
`and 5% dextran sulfate (7). The sample was denatured at 80°C
`for 10 min, applied to a microarray and spread evenly by a
`coverslip of 22 X 22 mm. Hybridisation was carried out for
`
`a humidified hybridisation chamber
`at 42°C in
`16 h
`(TeleChem International Inc.). The slides were washed in 2x
`SSC, 0.1% SDS for 2 min, then in 1X SSC for 2 min, rinsed
`briefly in 0.2>< SSC and dried by centrifugation at 500 r.p.m.
`for 5 min. Detection of the fluorescence signals was performed
`on a ScanArray5000 unit and analysed with the QuantArrayl.0
`software package (GSI Lumonics, Billerica, USA).
`
`RESULTS
`
`Effectiveness of DNA binding
`
`One critical factor in microarray analyses is the amount of
`probe material attached to the support that is available for
`hybridisation. This factor can quickly become limiting to the
`signal intensities detectable on glass arrays and thus directly
`influences the sensitivity and dynamic range of measurements.
`In order to determine how the buffer condition of the spotting
`solution affects the binding efficiency of the spotted DNA,
`PCR products of ~500 bp in length were produced from
`individual clone inserts, which had been randomly picked from
`a subtractive human clone library. The DNA was diluted to
`concentrations of 500, 250, 100, 50 and 25 ng/ttl and applied to
`glass slides in four replica-spots each. Spotting solution
`without DNA was also deposited. Parallel to 3X SSC and the
`same buffer supplemented with 1.5 M betaine, the commercial
`ArrayIt"M micro-spotting solution (TeleChem International
`Inc.) was tested.
`In hybridisations, labelled PCR products were used as target
`DNA. Figure 1 shows a typical image of fluorescence signal
`
`0
`
`25
`
`50
`
`100
`
`250
`
`500 DNA oonc. [nglpl]
`SSC
`
`Sscrbetalne
`Anaylll" solution
`
`SSC
`SSC/betalne
`Arra IF“ solution
`
`
`
`
` SSC
`
`Anayltm
`solution
`
`SSClbetaine
`
`no signalT saturation
`
`Figure 1. Signal intensities produced upon hybridisation of Cy5—labelled DNA to increasing amounts of spotted PCR product. Spots made with each DNA
`concentration and buffer system were present in quadruplicate. (A) The background of non—specific binding to a non—complementary sequence. (B) The signals
`obtained on a fully complementary probe. Enlargements that display in detail (C) the background signal collected in absence of DNA and (D) the homogeneity of
`signal at spots produced with 100 ng/ttl DNA.
`
`Page 2 of 5
`Page 2 of 5
`
`
`
`Nucleic Acids Research, 2001, Vol. 29, N0. 7 e38
`
`PAGE 3 OF 5
`
`50
`
`
`
`fluorescenceintensity
`
`
`
`[arbitraryunits]
`
`/‘_"—'_-_--#—_§
`40
`/- 5/
`:2
`10 E§/: 2::/betaine
`
`0
`
`/’¢.
`0
`
`.
`100
`
`.
`200
`
`- A— Arrayltm solution
`.
`.
`300
`400
`
`.
`500
`
`DNA concentration [ng/pl]
`
`Figure 2. Effect of probe concentration and spotting solution on hybridisation
`efficiency. The mean signal intensities produced in the experiments shown in
`Figure l are plotted versus the DNA concentration of the spotted DNA. The
`error bars indicate standard deviation.
`
`intensities obtained from such experiments. Irrespective of the
`buffer, hybridisation was specific to the complementary probe
`molecule. Also,
`in all cases the signal intensities increased
`with increasing concentration of the spotted DNA probe
`solution. However, quantification reveals that, at a DNA
`concentration in the spotting solution of up to 100 ng/ttl, the
`signal intensities were ~2.5-fold higher if betaine was present
`in the spotting buffer (Fig. 2). Correspondingly, the binding
`capacity of the glass surface is nearly saturated at a DNA
`concentration of 250 ng/til, while without betaine this level is
`reached only at a concentration >500 ng/ul.
`
`Spot homogeneity
`
`Spot homogeneity is dependent on the variation of the DNA
`concentration across a spot. There are distinct, frequently
`occurring patterns that can be observed upon hybridisation,
`such as a higher DNA concentration at the edges (‘doughnut’
`effect) or the aggregation of the DNA at few points within a
`spot. The former effect was seen on slides printed with DNA in
`pure SSC buffer, while the latter occurred when the ArrayItTM
`micro-spotting solution was used (Fig. 1). Supplementing SSC
`with 1.5 M betaine yielded much more homogenous spots.
`This effect was evaluated by calculating the variation
`coefficient of signal intensity across all pixels that represent a
`spot. At a DNA concentration of 100 ng/ul during spotting
`(Fig. 1D), for example, the variation coefficient was found to
`be 7% with the commercial buffer, 14% if SSC was used and
`only 5% for SSC supplemented with betaine.
`
`Spot-specific background signal
`
`The choice of spotting solution also has a noticeable effect on
`the background signal produced at the spots in absence of a
`complementary target DNA. In Figure 1C, typical results are
`presented where buffer
`lacking DNA has been spotted.
`Particular care had been taken to avoid any carry-over of DNA
`from other samples by extensive washing steps and spotting
`the buffer probe first before proceeding to samples containing
`DNA. The signalznoise ratio of each feature was calculated by
`dividing the mean signal intensity of the four spot areas by the
`mean of the background signal in between spots. A ratio of 0.7
`(i0.2) was found for 3X SSC supplemented with 1.5 M betaine,
`
`Page 3 of 5
`Page 3 of 5
`
`while much higher ratios of 5.1 (i0.8) and 10.5 (i1.5) were
`determined for SSC without betaine and the TeleChem
`
`Arrayltm micro-spotting solution, respectively.
`
`Suppression of overall background
`
`The protocol of slide post-processing with succinic anhydride
`was introduced by Schena et al. (3) and is widely used for the
`blocking of aminated surfaces by acylating the unreacted
`primary amines. In this process, succinic anhydride is first
`dissolved in NMP before sodium borate buffer pH 8 is added;
`the final concentrations are 164 mM succinic anhydride, 96%
`(v/v) NMP and 4% (v/v) aqueous sodium borate buffer. We
`suspected that an incubation in this solution re-dissolves part
`of the DNA deposited on the glass surface, which could then
`spread across the slide, causing additional background. In an
`effort to avoid this effect, we substituted the non-polar, non-
`aqueous solvent DCE for NMP. The concentration of succinic
`anhydride was decreased to 50 mM. Also, no aqueous buffer was
`added to the solution. Instead, the acylating catalyst N-methyl-
`imidazol was added for acceleration of the process. We did
`comparisons of slides produced and processed in parallel but
`acylated by either the NMP method or our DCE protocol. With
`the latter blocking reaction, an overall significantly reduced
`background is achieved (Fig. 3). Since using the DCE-based
`process as our routine blocking procedure, we have not
`encountered any background problems that could be attributed
`to the blocking, whereas before, when using the NMP method,
`we experienced all commonly known problems, such as
`inverted signal phenomena or a higher background around
`DNA spots.
`
`DISCUSSION
`
`The results described above suggest that binding of DNA to
`poly-L-lysine slides in the presence of betaine is a different
`reaction from spotting DNA in SSC alone. Betaine is a
`naturally occurring substance that serves as an osmoprotectant
`factor in bacteria (8). It is known to alter DNA and protein
`stability and to reduce the difference in stability of A:T and
`G:C base pairs (9,l0). Because of these effects, it has been
`introduced as an additive in sequencing reactions and different
`PCR strategies (11,12). In physical terms, betaine increases the
`viscosity of a solution and reduces the rate of evaporation,
`dependent on its concentration (Fig. 4). However, surface
`tension is less affected (data not shown). These characteristics
`are likely to account for its effects as an additive to spotting
`solution. The increased binding efficiency and spot homo-
`geneity is most likely due to the reduced evaporation rate. Only
`very small volumes in the nanolitre range are deposited on the
`microarray surface during spotting. Because of the swift
`evaporation of such small volumes, the electrostatic binding of
`DNA on the positively charged surface must occur within a
`very short period. Also,
`the quickly receding liquid film
`dictates where binding takes place. If spots stay humid for
`longer, however, the DNA is more likely to bind at equal rates
`across the entire surface. As a side effect, betaine reduces the
`evaporation of the DNA samples in the microtiter plates during
`the microarray manufacturing process. Varying the para-
`meters, we found that a concentration of 1.5 M betaine had the
`overall best effect on the quality of DNA microarrays.
`
`
`
`PAGE 4 OF 5
`
`e38 NucleicAcids Research, 2001, Vol. 29, No. 7
`
`
`
`Figure 3. Comparison of blocking reactions. T‘wo microarray slides were produced simultaneously before being subjected to the blocking procedures. Acylation
`was performed using (A) 164 mM succinic anhydride in borate-buffered NMP or (B) 50 mM succinic anhydride and 150 mM N—methylimidazol in DCE. The slides
`were hybridised in parallel with a Cy5—labelled, complementary PCR product, washed briefly and scanned under identical conditions. The slight DNA ‘tails’ seen
`in (B) are caused by target DNA left after the brief washing. Such features occur on both types of slides, as could be determined by radioactive hybridisations (not
`shown), but are submerged in the background signal of (A).
`
`The substitution of DCE for the NMP solution during the
`blocking of the glass surface subsequent to DNA spotting and
`the addition of an acylation catalyst improved the background
`considerably. In most published reports, NMP has been used as
`solvent of the acylating succinic anhydride. In this procedure,
`sodium borate buffer is added to keep the pH at 8,
`thus
`enhancing deprotonation of the charged amines. Deprotonation
`leaves a free pair of electrons on the amine, which can undergo
`a nucleophilic attack on the carbon of succinic anhydride. We
`chose DCE because of its non-polar, non-aqueous nature,
`while nevertheless being a solvent of succinic anhydride and
`N-methylimidazol. N-methylimidazol is a tertiary amine, which is
`used as a standard acylation catalyst in organic chemistry. Since it
`not only acts as a coupling activator but also has a basic
`character, there is no need for the use of other buffer compo-
`nents.
`
`In combination, the modifications in the compositions of the
`spotting solution and the blocking reagent led to a significant
`improvement in the quality of microarrays, affecting sensi-
`tivity and accuracy of measurements,
`thereby moving such
`analyses another step toward more quantitative performance.
`
`ACKNOWLEDGEMENTS
`
`We are grateful to Achim Stephan for the preparation of slides
`and Philipp Angenendt for technical help. This work was
`funded by the German Ministry of Education and Research
`(BMBF).
`
`REFERENCES
`
`l . Maskos,U. and Southem,E.M. (1992) Oligonucleotide hybridisations on glass
`supports: a novel linker for Oligonucleotide synthesis and hybridisation
`
`pereentageofevaporation
`
`A
`
`tn
`
`8'8‘
`
`concentration of betaine [M]
`
`Figure 4. Effect of betaine on evaporation. Spotting solution ( l ml) was supplemented
`with different concentrations of betaine in a 1.5 ml Eppendorf tube, which was
`incubated with an open lid at 30°C. (A) The percentage of evaporation is
`presented. Note that by the increase in betaine concentration at the liquid
`surface the evaporation eventually stops. From this data, it can be extrapolated
`that a concentration of 6.8 M betaine prevents further evaporation (B).
`
`Page 4 of 5
`Page 4 of 5
`
`100
`
`8 Q
`
`0
`
`+¢¢+++++H § 2
`percentageofevaporation 88
`
`
`
`Nucleic Acids Research, 2001, Vol. 29, N0. 7e38
`
`PAGE 5 OF 5
`
`properties of oligonucleotides synthesised in situ. Nucleic Acids Res., 20,
`1679-1684.
`. Fodor,S.P.A., Rava,R.P., Huang,X.C., Pease,A.C., Holmes,C.P. and
`Adams,C.L. (1993) Multiplexed biochemical assays with biological chips.
`Nature, 364, 555-556.
`. Schena,M., Sha1on,D., Davis,R.W. and Brown,P.O. (1995) Quantitative
`monitoring of gene expression patterns with a complementary DNA
`microarray. Science, 270, 467-470.
`. The Chipping Forecast (1999) Nature Genet, 21 (suppl.), 1-60.
`. Eisen,M.B. and Brown,P.O. (1999) DNA—arrays for analysis of gene
`expression. Methods Enzymol., 303, 179-205.
`. Hubank,M. and Schatz,D.G. (1994) Identifying differences in mRNA
`expression by representational difference analysis of cDNA. Nucleic
`Acids Res., 22, 5640-5648.
`. Welford,S.M., Gregg,J., Chen,E., Garrison,D., Sorensen,P.1-l.,
`Denny,C.T. and Ne1son,S.F. (1998) Detection of differentially expressed
`genes in primary tumor tissues using representational differences analysis
`coupled to microarray hybridisation. Nucleic Acids Res., 26, 3059-3065.
`
`. Csonka,L.N., Ikeda,T.P., Fletcher,S.A. and Kustu.S. (1994) The
`accumulation of glutamate is necessary for optimal growth of Salmonella
`typhimurium in media of high osmolality but not induction of the proU
`operon. J. Bacteriol., 176, 6324-6333.
`. Santoro,M.M., Liu,Y., Khan,S.M., Hou,L.X. and Bolen,D.W. (1992)
`Increased thermal stability of proteins in the presence of naturally
`occurring osmolytes. Biochemistry, 16, 5278-5283.
`Rees,W.A., Yager,T.D., Korte,J. and Hippel,P.H. (1993) Betaine can
`eliminate the base pair composition dependence of DNA melting.
`Biochemistry, 32, 137-144.
`Mytelka,D.S. and Chamberlin,M.J. (1996). Analysis and suppression of
`DNA polymerase pauses associated with a trinucleotide consensus.
`Nucleic Acids Res., 24, 2774-2781.
`. Henke,W., Herdel,K., Jung,K., Schnorr,D. and Loening.S.A. (1997)
`Betaine improves the PCR amplification of GC—rich DNA sequences.
`Nucleic Acids Res., 25, 3957-3958.
`
`11.
`
`Page 5 of 5
`Page 5 of 5