`(12) Patent Application Publication (10) Pub. No.: US 2002/0164626 A1
`Diehl et al.
`(43) Pub. Date:
`NOV. 7, 2002
`
`US 20020164626A1
`
`(54) PROCESS FOR BINDING NUCLEIC ACIDS
`TO A CARRIER
`
`(30)
`
`Foreign Application Priority Data
`
`Feb. 27, 2001
`
`(EP) ................................... .. 01 104 787.5
`
`(76)
`
`Inventors: Frank Diehl, Baltimore, MD (US);
`Susanne Diehl, Baltimore, MD (US)
`
`(51)
`
`P1lb1iC3ti0Il C13SSifiC3ti0I1
`
`Correspondence Address:
`Eugene E, Renz, Jr,’ RC,
`205 North Monroe Street
`
`Post Oflice Box 2056
`Media, PA 19063-9056 (US)
`
`(21) Appl, No;
`
`10/082,395
`
`(22)
`
`Filed:
`
`Feb. 25, 2002
`
`Int. Cl.7 ........................... .. C12Q 1/68; C12M 1/34;
`1305]) 3/00
`......................... .. 435/6; 435/287.2; 427/211
`
`(52) US. Cl.
`
`(57)
`
`ABSTRACT
`
`The application relates to a process for binding nucleic acids
`to a carrier, wherein the nucleic acids are dissolved in a
`solution containing at least one compound selected from the
`group consisting of betaines, said solution being applied to
`a carrier and the nucleic acids being bound to the carrier.
`
`Page 1 of 10
`Page 1 of 10
`
`BD EXHIBIT 1020
`BD EXHIBIT 1020
`
`
`
`Patent Application Publication
`
`Nov. 7, 2002 Sheet 1 of 4
`
`US 2002/0164626 A1
`
`mgsmeomw
`
`.5:>m.c<
`
`cozaow
`
`8_%aomm
`
`8_s_8_é_92
`
`._o_§8§_§<
`
`EsmeomwE.m.3E..._:.i
`
`
`
`owm..1;
`
`owm
`
` Page2of10
`
`32.2.8<7308SN2:om..mmo
`
`Page 2 of 10
`
`
`
`Patent Application Publication
`
`Nov. 7, 2002 Sheet 2 of 4
`
`US 2002/0164626 A1
`
`50
`
`40
`
`20
`
`‘£0
`
`30 -
`
`fluorescenceintensity[arbitrary
`
`units]
`
`Page 3 of 10
`Page 3 of 10
`
`
`
`/ /5.5
`é/Téu— ssorbetatne
`
`-0- SSC
`
`-4- Arrayltm solution
`
`100
`
`200
`
`300
`
`400
`
`DNA concentration [ng/141]
`
`
`500
`
`
`
`Patent Application Publication
`
`Nov. 7, 2002 Sheet 3 of 4
`
`US 2002/0164626 A1
`
`Page 4 of 10
`Page 4 of 10
`
`
`
`Patent Application Publication
`
`Nov. 7, 2002 Sheet 4 of 4
`
`US 2002/0164626 A1
`
`1
`
`60
`
`40
`
`20
`
`M
`_.—
`_
`0.25 M
`-:::a ~><—
`a
`C
`0.50 M
`_Q _ -0-
`0.75 M
`‘Q
`80
`.
`°
`‘
`--I-
`1.00 M
`8
`_
`,
`.
`—a—
`1.25 M
`cg
`-0-
`1.50 M
`a)
`_
`.
`_ u
`-3-
`_2.00 M
`‘*5
`_
`-0-
`(D
`-D-_ 3.00. M
`3
`—A—
`4.00 M
`C
`.
`<1:
`concentration
`(.3
`-
`.
`5
`of betame
`Q.
`
`'
`
`_
`
`,7"
`
`'
`
`.
`
`0
`
`'
`
`‘
`
`0
`
`25
`
`50
`
`75
`
`100
`
`time [h]
`
`h.
`125
`
`541+.
`\'\'‘''‘—~-:-
`-v V«zV‘~+,+
`'
`4
`_
`
`'
`
`A
`
`b
`
`
`
`-—+— 125 h
`—v—-
`50 h
`-47-
`33 h
`—®-
`8 h
`incubation
`time
`
`<3
`
`1
`
`2
`
`3
`
`4
`
`5
`
`6
`
`7
`
`concentration of betaine [M]
`
`Fig. 4
`
`0
`
`C 1 00
`:3
`g
`89
`C)
`CL
`g
`(1)
`"6
`3 40
`.5’.
`C
`
`60
`
`20
`
`0
`
`§(
`
`1)
`°*
`
`Page 5 of 10
`Page 5 of 10
`
`
`
`US 2002/0164626 A1
`
`Nov. 7, 2002
`
`PROCESS FOR BINDING NUCLEIC ACIDS TO A
`CARRIER
`
`CROSS REFERENCE TO RELATED
`APPLICATION
`
`[0001] This appliation claims priority of German patent
`application no. 01 104 787.5, filed Feb. 27, 2002,
`the
`complete disclosure of which is hereby incorporated by
`reference.
`
`FIELD OF THE INVENTION
`
`[0002] The invention relates to a process for binding
`nucleic acids to a carrier.
`
`BACKGROUND OF THE INVENTION
`
`[0003] DNA chip technology is a research area which is
`still under development and wherein DNA chips having up
`to several thousand spots are used. To this end, nucleic acids
`are fixed on a carrier in an orderly grid pattern. The DNA or
`RNA to be examined is labelled, e.g. using a fluorescent dye,
`and applied to the chip. In the case of hybridization to sensor
`molecules bound to
`carriers
`having
`complementary
`sequences, a signal is detected at a corresponding position
`within said grid through a CCD camera or by a laser scanner.
`
`the nucleic
`[0004] For the fabrication of microarrays,
`acids to be bound to carriers are stored in microtiter plates.
`For the spotting process, the nucleic acids are only solved in
`a very small volume, for instance 5 to 10 yl. The spotting
`solution, in which the nucleic acids are dissolved, is spotted
`on the carrier, generally glass slides. When nucleic acids
`dissolved in a solvent are deposited on a glass surface, the
`solvent evaporates quickly leading to an unequal attachment
`of nucleic acids to the surface of the glass and a low binding
`efficiency to the glass.
`
`[0005] As a spotting solution, saline sodium citrate (SSC)
`buffer is widely used. However, binding efficiency and spot
`uniformity are very poor when using this buffer. The prob-
`lems are reduced by supplementing SSC with 50% dimethyl
`sulfoxide. This substance has the disadvantage, however, of
`being both toxic and a solvent of many materials, apart from
`its only limited effect on spot appearance.
`
`[0006] Thus, the technical problem underlying the present
`invention is to provide a process for binding nucleic acids to
`a carrier not having the disadvantages of the processes of the
`prior art.
`
`[0007] According to the present invention, this technical
`problem is solved by a process for binding nucleic acids to
`a carrier wherein the nucleic acids are dissolved in a solvent
`
`containing at least one compound selected from the group
`consisting of betaines, the obtained solution being applied to
`a carrier and the nucleic acids being bound to the carrier.
`
`[0008] The term “nucleic acids” as used herein refers to
`either DNA or RNA. It includes plasmides, infectious poly-
`mers of DNA and/or RNA, non-functional DNA or RNA,
`chromosomal DNA or RNA, and DNA or RNA synthesized
`in vitro, such as by the polymerase chain reaction or
`oligonucleotide sythesis. For a person skilled in the art, it is
`well-known to produce DNA or RNA in vitro, in particular
`by the polymer chain reaction.
`
`[0009] According to the process of the present invention,
`the solvent in which the nucleic acids are dissolved contains
`
`at least one compound selected from the group consisting of
`betaines. The betaines can be present in the solvent before
`the nucleic acids are dissolved. On the other hand,
`the
`betaines can be added to the solvent after the nucleic acids
`are dissolved therein.
`
`[0010] The term “betaines” as used herein is a collective
`term for compounds having the atom grouping R3N61
`—CH2—COO@(IUPAC Rule C-816.1). Betaines have the
`typical characteristics of zwitterions, i.e. they are amphot-
`eric. The group R can be independently selected and pref-
`erably represents a C1-C5 alkyl, in particular methyl, ethyl
`and propyl.
`
`In a preferred embodiment of the present invention,
`[0011]
`the compound selected from the group consisting of betaines
`is trimethylammonium acetate (betaine) since a particularly
`good binding of nucleic acids to the carrier is achieved with
`it.
`
`[0012] Preferably, the compound selected from the group
`consisting of betaines is present in said solvent at a concen-
`tration of 8 mM to 6.5 M, in particular 1.5 M, since in this
`concentration range good effects of the betaines on the
`binding of nucleic acids to the carrier were observed.
`
`the nucleic acids are dis-
`[0013] As mentioned above,
`solved in a solvent. The term “solvent” as used herein refers
`
`to any liquid capable of dissolving nucleic acids. Generally,
`the main ingredient of such liquids is water, which can be
`buffered to a certain pH value.
`
`If the process according to the invention is used for
`[0014]
`manufacturing microarrays, so-called spotting solutions can
`be used as solvent. Examples of the spotting solutions are
`saline sodium citrate (SSC) buffer, in particular containing
`45 mM Na-citrate, 450 mM NaCl, pH 7.0 (3>< SSC).
`
`In the process according to the present invention,
`[0015]
`the nucleic acids-containing solvent is applied to a carrier,
`and the nucleic acids are bound to the carrier.
`
`[0016] Preferably, the carrier is made of glass, in particular
`slides, due to its favourable optical characteristics. Further-
`more it is solid, planar and not fluorescent.
`
`[0017] The binding of the nucleic acids to the carrier can
`be achieved either by covalent or electrostatical (ionical)
`bounds.
`
`[0018] For covalent binding, for example compounds pro-
`viding aldehyde groups are coated on the surface of the
`carrier. Nucleic acids contain primary amino groups which
`can react with the aldehyde group to form a Schiff base, i.e.
`a covalent bond.
`
`[0019] For the electrostatical binding, use is made of the
`fact that nucleic acids are generally negatively charged. By
`providing positive charges on the surface of the carrier,
`binding between the negatively charged nucleic acids and
`the positively charged surface of the carrier can be achieved
`by an interaction of the charges. For this purpose, glass
`surfaces coated with compounds providing positive charges,
`e.g. coated with poly-L-lysine and/or aminosilane, are used.
`Such activated slides are well-known in the art.
`
`If necessary, cross-linking of the nucleic acids with
`[0020]
`the carrier can be achieved by UV irradiation, for example
`with a total energy of 60 m].
`
`Page 6 of 10
`Page 6 of 10
`
`
`
`US 2002/0164626 A1
`
`Nov. 7, 2002
`
`It has to be understood that the process according
`[0021]
`to the present invention can be carried out in a wide variety
`of methods in which nucleic acids are bound to carriers. In
`
`particular, the process of the present invention is generally
`useful for the fabrication of microarrays which is known
`from the prior art. The following illustrates the fabrication of
`microarrays using the process of the present invention, but
`it has to be understood that the present invention is not
`limited to the fabrication of microarrays.
`
`e.g. of 75
`slides,
`[0022] Poly-L-lysine-coated glass
`mm><25 mm, can be prepared as described by Schena, M. et
`al., (1995) Quantitative Monitoring of Gene Expression
`Patterns with a Complementary DNA Microarray, Science,
`467-470. Slides having an aminosilane surface are commer-
`cially available (for example CMT-GAPSTM from Corning,
`USA). The DNA spotting solution can be adjusted to 45 mM
`Na-citrate, pH 7.0, 450 mM NaCl (3>< SSC) containing, e.g.
`1.5 M betaine. Varying the parameters, it was found that a
`concentration of 1.5 M betaine had the overall best effect on
`
`the quality of DNA microarrays. DNA spotting can usually
`be done, for instance, with an SDDC-2 DNA Micro Arrayer
`from Engineering Services Inc. (Toronto, Canada). A single
`SMP3 pin (Telechem International Sunnyvale, USA) can be
`used to avoid differences between the pins. The DNA
`samples can be printed in quadruplicate at a 200 gm centre-
`to-centre spacing. Slides can be left at room temperature for
`several hours, e.g. 10-20 hours, and then heat-treated on a
`metal block at about 80° C. for about 5 seconds. The DNA
`can be cross-linked to the support by UV-irradiation with a
`total energy of about 60 m] using a commercially available
`UV-crosslinker,
`for
`instance
`a Hoefer UV-crosslinker
`(Amersham Pharmacia Biotech, Freiburg, Germany).
`
`[0023] The process of the present invention has a plurality
`of advantages. Analysis of bound nucleic acids, in particular
`on DNA-microarrays, depends considerably on spot quality
`and low background signal of the glass support. By using at
`least one compound selected from the group consisting of
`betaines as an additive to a solvent, in particular spotting
`solutions, for dissolving nucleic acids both the binding
`efficiency of spotted PCR products and the homogenity of
`the DNA spots are improved significantly, in particular by
`using aminated surfaces, such as glass slides coated with the
`widely used poly-L-lysine and/or aminosilane. The more
`nucleic acids are bound during this process, the better the
`subsequent analysis will be, since the efficiency of binding
`nucleic acids to glass slides limits the sensitivity and the
`dynamic range of such measurements. Also, nucleic acid
`spots of high homogenity are beneficial, since they simplify
`image analysis and enhance considerably the accuracy of
`signal detection. In addition, unspecific background signal is
`markedly diminished. Furthermore,
`the betaines reduce
`evaporation from the microtiter dish wells during the array
`procedure, which hold the nucleic acids.
`
`[0024] An important part of microarray manufacturing is
`the processing of the glass surface after spotting the nucleic
`acids, during which the remaining, unreacted amino residues
`of the poly-L-lysine polymer and/or aminosilane are deac-
`tivated. This prevents subsequent binding of nucleic acids,
`which increases the background signal upon hybridisation of
`a labelled target. The blockage can be achieved by various
`methods of the prior art, for example by reacting the arrays
`with succinic anhydride in aqueous borate-buffered 1-me-
`thyl-2-pyrrolidinone, converting the amines into carboxylic
`
`moieties. During this process, however, the spotted nucleic
`acids come into contact with the aqueous blocking solution,
`are partly re-dissolved and spread across the entire slide.
`
`To prevent this, a robust processing method has
`[0025]
`been developed wherein the slides are treated with a solution
`of succinic anhydride as a blocking agent and an acylating
`catalyst in an unpolar non-aqueous solvent.
`
`[0026] Preferably, said acylating catalyst is N-methylimi-
`dazol, since it
`is highly soluble, has low toxicity and
`functions as a buffer to maintain a pH of about 8. It is further
`preferred that the unpolar non-aqueous solvent is 1,2-dichlo-
`roethane, which has the advantage that it is a good solvent
`for both the succinic anhydride and the N-methylimidazol.
`
`[0027] A preferred composition for the blocking solution
`contains 0.2 g to 20 g, in particular about 1 g, of succinic
`anhydride and 1 ml to 10 ml, in particular about 2.5 ml, of
`N-methylimidazol dissolved in about 200 ml of 1,2-dichlo-
`roethane. In order to achieve good results, the molar ratio of
`N-methylimidazol to succinic anhydride can be 2:1 to 4:1, in
`particular about 3:1.
`
`[0028] Adetailed example of the blocking process is given
`hereinafter: about 1 g of succinic anhydride is freshly
`dissolved in 200 ml of anyhdrous 1,2-dichloroethane. To this
`solution, about 2.5 ml of N-methylimidazol can be added
`and immediately poured into a slide chamber. Incubation of
`the slide in this solution is carried out for about 1 hour,
`placed on an orbital shaker for slide agitation. Subsequently,
`the slides can be washed briefly in about 200 ml of fresh
`1,2-dichloroethane and incubated in boiling water for 2
`minutes for nucleic acid denaturation. After a brief rinse in
`
`95% ethanol, they can be left to dry at room temperature.
`
`[0029] Surprisingly, it has been found that blocking of the
`chip surface with succinic anhydride in an unpolar non-
`aqueous solvent,
`in particular 1,2-dichloroethane,
`in the
`presence of an acylating catalyst, in particular N-methylimi-
`dazol, prevents overall background signal that occurs with
`the frequently applied aqueous solvent 1-methyl-2-pyrroli-
`don in borate buffer.
`
`[0030] As is evident from the foregoing, betaines are
`useful in processes for binding nucleic acids to carriers,
`wherein the betaines are present as additives in the solvent,
`in which the nucleic acids are dissolved before applying
`them to the carrier and binding them to it. Accordingly, the
`use of betaines as additives for solvents in which nucleic
`acids are dissolved in order to bind them to a carrier is a
`
`further subject of the present invention, wherein the terms
`“betaines”, “solvents”, “nucleic acids” and “carrier” are
`defined as above.
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`[0031] These and other objects of the present invention
`and various features and details of the operation and con-
`struction thereof are hereinafter more fully set forth with
`reference to the accompanying drawings, wherein:
`
`intensities produced upon
`[0032] FIG. 1 shows signal
`hybridisation of Cy5-labelled DNA to increasing amounts of
`spotted PCR-product;
`
`[0033] FIG. 2 shows the effect of probe concentration and
`spotting solution on hybridisation efficiency;
`
`Page 7 of 10
`Page 7 of 10
`
`
`
`US 2002/0164626 A1
`
`Nov. 7, 2002
`
`[0034] FIG. 3 shows the comparison of blocking reac-
`tions; and
`
`[0035] FIG. 4 shows the effect of betaine on evaporation.
`
`DETAILED DESCRIPTION OF THE
`PREFERRED EMBODIMENT
`
`[0036] The following examples serve to illustrate the
`invention in more detail.
`
`EXAMPLE 1
`
`Manufacturing of DNA-Microarrays
`
`[0037]
`
`a) Probe and Target Synthesis
`
`[0038] Non-homologous DNA-inserts of about 500 bp
`length were picked at random from a clone library generated
`by cDNA representational difference analysis (Hubank, M.
`and Schatz, D. G. (1994) Identifying differences in mRNA
`expression by representational difference analysis of cDNA,
`Nucleic Acids Res., 22, 5640-5648). They were PCR-am-
`plified in 100 yl reactions with the universal primer d(AG-
`GCAACTGTGCTATCCGAGGGAA), purified by isopro-
`panol precipitation and resuspended in water. The DNA-
`concentration was
`determined
`by measuring
`the
`fluorescence signal obtained in the presence of the dye
`Hoechst-33258. Purity of the fragments was checked by
`agarose gel electrophoresis. For the generation of comple-
`mentary hybridisation targets, a Cy5-labelled oligonucle-
`otide primer of identical sequence was used for amplifica-
`tion.
`
`[0039]
`
`b) Fabrication of Microarrays
`
`[0040] Poly-L-lysine-coated glass slides of 75 mm><25
`mm were prepared as described by Schena, M. et al.,
`Quantitative Monitoring of Gene Expression Patterns with a
`Complementary DNA Microarray, Science, 270,467-470.
`Slides having an aminosilane surface (CMT-GAPSTM) were
`purchased from Corning (Corning, USA). The DNA spotting
`solution was adjusted to either 45 mM Na-citrate, pH 7.0,
`450 mM NaCl (3>< SSC) or the same composition was used
`supplemented with 1.5 M betaine (obtained from Sigma,
`Germany). DNA spotting was done with an SDDC-2 DNA
`Micro-Arrayer from Engineering Services Inc. (Toronto,
`Canada). A single SMP3 pin (TeleChem International Inc.,
`Sunnyvale, USA) was used to avoid differences between
`pins. The DNA samples were printed in quadruplicate at a
`200 pm centre-to-centre spacing. Slides were left at room
`temperature overnight and then heat-treated on a metal block
`at 80° C. for 5 sec. The DNA was cross-linked to the support
`by UV-irradiation with a total energy of 60 m] in a Hoefer
`UV-crosslinker (Amersham Pharmacia Biotech, Freiburg,
`Germany). For the blocking process, 1 g of succinic anhy-
`dride (Fluka, Deisendorf, Germany) was freshly dissolved in
`200 ml of anhydrous 1,2-dichloroethane (Fluka). To this
`solution, 2.5 ml of N-methylimidazol (Fluka) was added and
`immediately poured into the slide chamber. Incubation in
`this solution was for 1 hour, placed on an orbital shaker for
`slight agitation. Subsequently, the slides were briefly washed
`in 200 ml of fresh 1,2-dichloroethane and incubated in
`boiling water for 2 min for DNA denaturation. After a brief
`rinse in 95% ethanol, they were left to dry at room tem-
`perature.
`
`[0041]
`
`c) Hybridisation of Labelled Samples
`
`[0042] For each hybridisation, 0.2 yg of Cy5-labelled and
`1.8 yg of unlabelled PCR-product were mixed and precipi-
`tated with ethanol. The pellet was taken up in 15 yl hybridi-
`sation buffer of 50% formamide, 3x SSC, 1% SDS, 5><
`Denhardt’s reagent and 5% dextran sulfate. The sample was
`denatured at 80° C. for 10 min, applied to a microarray and
`spread evenly by a coverslip of 22 mm><22 mm. Hybridisa-
`tion was done for 16 h at 42° C. in a humidified hybridisation
`chamber (TeleChem International Inc.). The slides where
`washed in 2x SSC, 0.1% SDS for 2 min, then in 1x SSC for
`2 min, rinsed briefly in 0.2>< SSC and dried by centrifugation
`at 500 rpm for 5 min. Detection of the fluorescence signals
`was performed on a ScanArray5000 unit and analysed with
`the QuantArray1.0 software package (GSI Lumonics, Bil-
`lerica, USA).
`
`[0043]
`
`d) Effectiveness of DNA Binding
`
`[0044] One critical factor in microarray analysis is the
`amount of probe material attached to the support that is
`available for hybridisation. This factor can quickly limit the
`signal
`intensities detectable on glass arrays, and thus it
`directly influences the sensitivity and dynamic range of
`measurements. In order to determine how the buffer condi-
`
`tion of the spotting solution affects the binding efficiency of
`the spotted DNA, PCR-products of about 500 bp in length
`were produced from individual clone inserts, which had
`been randomly picked from a subtractive human clone
`library (cf. above). The DNA was diluted to concentrations
`of 500 ng/pl, 250 ng/yl, 100 ng/yl, 50 ng/pl and 25 ng/Ml and
`applied to glass slides in four replica-spots each (cf. above).
`Also, spotting solution without DNA was deposited. Parallel
`to 3x SSC and the same buffer supplemented with 1.5 M
`betaine, the commercial ArrayltTM micro-spotting solution
`of TeleChem International Inc. was tested.
`
`[0045] Labelled PCR-products were hybridised. FIG. 1
`shows a typical
`image of fluorescence signal intensities
`obtained from such experiments. Spots obtained with each
`DNA concentration and buffer system were present in qua-
`druplicate. Signals in (a) represent the background of non-
`specific binding to a non-complementary sequence. In (b),
`the signals obtained on a fully complementary probe are
`shown. Panels (c) and (d) represent enlargements that dis-
`play in detail the background signal collected in the absence
`of DNA (c) and the homogeneity of signal for spots pro-
`duced with 100 ng/pl DNA
`
`Irrespective of the buffer, hybridisation was spe-
`[0046]
`cific to the complementary probe molecule. Also, in all cases
`the signal intensities increased with increasing concentration
`of the spotted DNA-probe solution. However, quantification
`reveals that at a DNA-concentration in the spotting solution
`of up to 100 ng/pl the signal intensities were higher by a
`factor of about 2.5, where betaine had been present in the
`spotting buffer (FIG. 2). FIG. 2 shows the effect of probe
`concentration and spotting solution on hybridisation effi-
`ciency. The mean signal intensities produced in the experi-
`ments shown in FIG. 1 are plotted versus the DNA concen-
`tration of the spotted DNA. The error bars indicate the
`standard deviation. Correspondingly, the binding capacity of
`the glass surface is nearly saturated at a DNA concentration
`of 250 ng/yl with betaine, while without betaine this level is
`reached only at a concentration higher than 500 ng/yl.
`
`Page 8 of 10
`Page 8 of 10
`
`
`
`US 2002/0164626 A1
`
`Nov. 7, 2002
`
`[0047]
`
`e) Spot Homogeneity
`
`[0048] Spot homogeneity is dependent on the variation of
`the DNA-concentration across a spot. There are distinct,
`frequently occurring patterns that can be observed upon
`hybridisation, such as a higher DNA concentration at the
`edges (“doughnut” effect) or the aggregation of the DNA at
`few points within a spot. The former effect was seen on
`slides printed with DNA in pure SSC buffer, while the latter
`occurred when the ArrayltTM micro-spotting solution was
`used (FIG. 1). Supplementing SSC with 1.5 M betaine
`yielded much more homogenous spots. This effect was
`evaluated by calculating the variation coefficient of signal
`intensity across all pixels that represent a spot. At a DNA
`concentration of 100 ng/pl during spotting (FIG. 1a), for
`example, the variation coefficient was found to be 7% with
`the commercial buffer, 14% if SSC was used and only 5%
`for SSC supplemented with betaine.
`
`[0049]
`
`f) Spot-Specific Background Signal
`
`[0050] The choice of spotting solution also has a notice-
`able effect on the background signal produced at the spots in
`absence of a complementary target DNA. In FIG. 1c, typical
`results are presented, if a buffer without any DNA has been
`spotted. Particular care was taken to avoid any carry-over of
`DNA from other samples by extensive washing steps and
`spotting the buffer probe first before proceeding to samples
`containing DNA. The signal-to-noise ratio of each feature
`was calculated by dividing the mean signal intensity of the
`four spot areas by the mean of the background signal in
`between spots. A ratio of 0.7 (10.2) was found for 3x SSC
`supplemented with 1.5 M betaine, while much higher ratios
`of 5.1 (10.8) and 10.5 (11.5) were determined for SSC
`without betaine and the TeleChem ArrayltTM micro-spotting
`solution, respectively.
`
`EXAMPLE 2
`
`Suppression of Overall Background During
`Manufacturing of DNA Microarrays
`
`[0051] The microarrays were manufactured as described
`in Example 1 and the suppression of overall background
`caused by the postprocessing was evaluated, wherein the
`blocking process of the prior art is compared with the effect
`of the blocking process according to the present invention.
`
`[0052] The method of slide postprocessing with succinic
`anhydride was introduced by Schena et al. (Quantitative
`Monitoring of Gene Expression Pattern with Complemen-
`tary DNA Microarray, Science, 270,467-470) and is widely
`used for the blocking of aminated surfaces by acylating the
`unreacted primary amines. In this process, succinic anhy-
`dride is first dissolved in 1-methyl-2-pyrrolidone (NMP)
`before sodium borate buffer (pH 8)
`is added;
`the final
`concentrations are 164 mM succinic anhydride, 96% (v/v)
`NMP and 4% (v/v) aqueous sodium borate buffer.
`
`It is assumed that incubation in this solution re-
`[0053]
`dissolves part of the DNA deposited on the glass surface,
`which then could spread across the slide causing additional
`background. In an effort to avoid this effect, the unpolar,
`nonaqueous solvent 1,2-dichloroethane (DCE) was substi-
`tuted for NMP, see example 1 for details. The concentration
`of succinic anhydride was decreased to 50 mM. Also, no
`aqueous buffer was added to the solution.
`Instead,
`the
`
`acylating catalyst N-methylimidazol was added for accel-
`eration of the process. Slides produced and processed par-
`allel but acylated by either the NMP-method or DCE-
`method of the present invention were compared. With the
`latter blocking reaction of the present invention, an overall
`significantly reduced background is achieved (FIG. 3). FIG.
`3 shows microarray slides produced simultaneously before
`being subjected to the blocking procedures. In (a), acylation
`was performed by 164 mM succinic anhydride in borate
`buffered NMP, while in (b) 50 mM succinic anhydride and
`150 mM N-methylimidazol in DCE were used. The slides
`were hybridised in parallel with a Cy5-labelled, comple-
`mentary PCR-product, briefly washed and scanned under
`identical conditions. The slight DNA “tails” seen in (b) are
`caused by target DNA left after the brief washing. Such
`features occur on both types of slides, as was determined by
`radioactive hybridisations, but are submerged in the back-
`ground signal of slide (a). Ever since using the DCE-based
`process (present
`invention) as a blocking procedure, no
`background problems attributed to the blocking have ever
`been encountered, whereas before, when using the NMP-
`method of the prior art, all commonly known problems were
`experienced, such as inverted signal phenomena or a higher
`background around DNA-spots.
`
`EXAMPLE 3
`
`Effect of Betaine on Evaporation
`
`In order to determine the effect of betaine on
`[0054]
`evaporation, 1 ml of spotting solution supplemented with
`different concentrations of betaine was filled in a 1.5 ml
`
`Eppendorf cup, which was incubated with an open lid at 30°
`C. The results are shown in FIG. 4. In panel (a),
`the
`percentage of evaporation is presented. It is pointed out that
`by the increase in betaine concentration at the liquid surface
`the evaporation eventually stops. From this data, it can be
`extrapolated (b) that betaine at a concentration of 6.8 M
`prevents further evaporation.
`
`What is claimed is:
`
`1. Aprocess for binding nucleic acids to a carrier, wherein
`the nucleic acids are dissolved in a solvent containing at
`least one compound selected from the group consisting of
`betaines, the obtained solution being applied to a carrier and
`the nucleic acids being bound to the carrier.
`2. The process according to claim 1, wherein the com-
`pound selected from the group consisting of betaines is
`trimethylammonium acetate.
`3. The process according to claim 1 or 2, wherein the
`compound selected from the group consisting of betaines is
`present in said solvent at a concentration of 8 mM to 6.5 M.
`4. The process according to one of the preceding claims,
`wherein the solvent contains about 1.5 M of sodium chloride
`
`and about 150 mM of sodium citrate, and wherein the pH
`value is about 7.
`
`5. The process according to one of the preceding claims,
`wherein said carrier is made of glass.
`6. The process according to claim 5, wherein said glass is
`coated with poly-L-lysine and/or an aminosilane.
`7. The process according to claim 6, wherein said glass,
`after binding of the nucleic acids thereto, is treated in order
`to deactivate the poly-L-lysine and/or the aminosilane.
`
`Page 9 of 10
`Page 9 of 10
`
`
`
`US 2002/0164626 A1
`
`Nov. 7, 2002
`
`8. The process according to claim 7, wherein said glass is
`treated with a solution of succinic anhydride as blocking
`agent and an acylating catalyst in an unpolar non-aqueous
`solvent.
`
`9. The process according to claim 8, wherein said acy-
`lating catalyst is N-methylimidazol.
`10. The process according to one of claim 8 or 9, wherein
`the unpolar nonaqueous solvent is 1,2-dichloroethane.
`
`11. The process according to one of claims 8 to 10,
`wherein 0.2 g to 20 g of succinic anhydride and 1 ml to 10
`ml of N-methylimidazol are dissolved in about 200 ml of
`1,2-dichloroethane.
`12. The use of betaines as additives for solvents in which
`nucleic acids are dissolved in order to bind them to a carrier.
`
`Page 10 of 10
`Page 10 of 10