Proc Natl Acad Sci USA
`Vol 95 pp 22562261 March 1998
`Biophysics
`
`High throughput genetic analysis using microfabricated 96sample
`capillary array electrophoresis microplates
`PETER C SIMPSON DAVID ROACHt ADAM T WOOLLEY TODD THORSEN RICK JOHNSTONt
`GEORGE F SENSABAUGH AND RICHARD A MATHIES§
`Department of Chemistry College of Chemistry and Forensic Science Group School of Public Health University of California Berkeley CA 94720 and
`928 East Argues Avenue Sunnyvale CA 94086
`tMolecular Dynamics
`
`Communicated by Ignacio Tinoco Jr University of California Berkeley CA December 23 1997 received for review November 15 1997
`
`Capillary array electrophoresis CAE mi
`ABSTRACT
`croplates that can analyze 96 samples in less than 8 min have
`been produced by bonding 10 cmdiameter micromachined
`glass wafers to form a glass sandwich structure The micro
`plate has 96 sample wells and 48 separation channels with an
`injection unit that permits the serial analysis of two different
`samples on each capillary An elastomer sheet with an 8 by 12
`array of holes is placed on top of the glass sandwich structure
`to define the sample wells Samples are addressed with an
`electrode array that makes up the third layer of the assembly
`was
`Detection of all
`lanes with high temporal resolution
`fluorescence scan
`achieved by using a laser excited confocal
`ner To demonstrate the functionality of these microplates
`separation and fluorescence detection of a
`electrophoretic
`restriction fragment marker for the diagnosis of hereditary
`hemochromatosis were performed CAE microplates will fa
`types of high throughput genetic analysis because
`is 50 to 100
`their high assay speed provides a throughput that
`than that of conventional
`times greater
`slab gels
`
`cilitate all
`
`To facilitate the completion of the Human Genome Project
`and to exploit
`the wealth of genetic information it
`is producing
`the speed throughput and costeffectiveness of DNA analysis
`will need to be significantly increased For many years slab gel
`systems have been used as the workhorse for gene mapping
`DNA sequencing and disease diagnosis Recently
`advances
`such as thin slab gels 1 capillary electrophoresis CE 25
`and capillary array electrophoresis CAE 612 have signif
`icantly increased the performance of gel electrophoresis How
`ever to meet
`the growing demand for increased speed and
`sample throughput more revolutionary
`are
`approaches
`needed
`The application of microfabrication technologies
`to the
`has the po
`analysis devices
`development of electrophoretic
`tential to improve the throughput of DNA analysis by orders
`CE chips were developed in
`of magnitude Microfabricated
`1992 13 and used to separate fluorescent
`dyes 14 15 and
`labeled amino acids 1517 More recently it
`has been shown that DNA restriction fragments 1820 PCR
`products 18 short oligonucleotides 21 and even DNA
`sequencing fragments 22 can be rapidly and effectively
`separated with CE chips Furthermore integrated microde
`vices have been developed that can perform PCR amplifica
`sizing 23 DNA
`tion immediately followed
`by amplicon
`subsequent sizebased
`digestion and
`restriction
`19 and cell sorting and membrane lysis of selected cells 24
`The extension of these individual analysis devices
`to a high
`density array format would help address
`the needs of
`the
`Human Genome Project
`
`separation
`
`fluorescently
`
`The development of a high density capillary array electro
`presents unique and challenging issues
`phoresis microplate
`The design and layout must permit the analysis of many 96
`samples on a small device provide facile loading with no
`contamination be easy to electrically address and provide
`high quality separation and detection We present here the
`development of a CAE microplate assembly consisting of a
`bonded micromachined
`an elastomer over
`glass sandwich
`layer and an electrode array that accomplishes these goals
`Detection is provided by a confocal
`fluorescence galvoscanner
`use the detection of variants of HFE a gene whose
`We
`variation is correlated with hereditary hemochromatosis
`HHC 25 to illustrate the utility of CAE microplates for
`screening for genetic diseases HHC is a genetic
`ideally suited for largescale
`population
`screening
`is identifiable with a simple PCRbased restriction
`because it
`assay and is treatable if detected early in the progression of the
`disease This work demonstrates the utility of high throughput
`CAE microplates for genotyping and further demonstrates the
`in the production of multiplex DNA
`power of microfabrication
`analysis devices
`
`population
`disorder
`
`EXPERIMENTAL SECTION
`
`Microfabrication Borofloat glass wafers Schott Yonkers
`NY were pre etched in 49 HF for 15 sec and cleaned before
`layer 1500 A in a
`deposition of an amorphous silicon sacrificial
`chemical vapor deposition PECVD system
`plasma enhanced
`PEIIA Technics West San Jose CA The wafers were primed
`with hexamethyldisilazane spincoated with photoresist Shipley
`1818 Marlborough MA at 5000 rpm and then softbaked
`at
`90°C for 30 min The mask pattern was transferred to the
`substrate by exposing the photoresist to UV radiation in a Quintel
`in a 11
`contact mask aligner The photoresist was developed
`mixture of Microposit developer concentrate Shipley and H20
`The mask pattern was transferred to the amorphous silicon by a
`CF4 plasma etch performed in the PECVD reactor The wafers
`were etched in 49 HF for 3 min at an etch rate of 7 µmmin
`giving a final etch depth of 21 Am and channel width of
`60 tan
`the bonded surface The photoresist was stripped and the
`at
`remaining amorphous silicon was removed in a CF4 plasma etch
`Holes were drilled into the etched plate with a 125 mmdiameter
`bit Crystalite Westerville OH The
`diamond tipped drill
`etched and drilled plate was thermally bonded to a flat wafer of
`similar size in a programmable vacuum furnace Centurion VPM
`J M Ney Yucaipa CA High quality bonds were typically
`
`the entire substrate After bonding the channel
`achieved over
`surfaces were coated by using a modified version of the Hjerten
`coating protocol 26 27 A more detailed discussion of micro
`fabrication methods is presented elsewhere 28
`
`The publication costs of this article were defrayed in part by page charge
`payment This article must therefore be hereby marked advertisement
`accordance with 18 USC §1734 solely to indicate this fact
`0 1998 by The National Academy of Sciences 0027842498952256682000
`PNAS is available online at httpwwwpnasorg
`
`in
`
`Abbreviations CE capillary electrophoresis CAE capillary array
`electrophoresis HHC hereditary hemochromatosis
`§To whom reprint requests should be addressed at Department
`of
`Chemistry 312 Hildebrand Hall University of California Berkeley
`CA 94720 email richzinccchemberkeleyedu
`
`2256
`
`BioRad Exhibit 2006
`IPR201700055
`Page 1 of 6
`
`

`

`Biophysics Simpson et al
`
`Proc Natl Acad Sci USA 95 1998
`
`2257
`
`Fig 1 Upper presents the mask design used to fabricate the
`CAE microplates The lower
`images are scanning electron
`micrographs that demonstrate the etch quality over the entire
`individual separation channels were etched
`array Fortyeight
`
`serial
`
`are grouped so that only one is required for four injection
`
`in a 150µm periodic array in the detection region A The
`channels branch out
`to an 8 by 12 array of sample reservoirs
`9 mm apart
`loading with an
`to facilitate
`that are spaced
`eight tipped pipetter The separation channels extend 10 cm
`from the injection region to the anode and about 175 cm from
`the injection region to the cathode Two injection reservoirs B
`and C are coupled to each separation channel allowing for
`injection of two samples To reduce the number of access
`holes required for this design injection waste reservoirs D
`reservoirs The cathode reservoirs E are also connected to
`multiple 6 or 12 capillaries The layout has been designed to
`to cathode the same for all
`the distance from anode
`keep
`separation channels The anode F is placed off center
`to
`avoid conflict with the scanning objective The number of
`reservoir holes for this pattern is 54N + 7 where N is the
`number of samples
`to run 96
`so 127 holes are required
`is close to the theoretical minimum
`samples This hole count
`N + 3 obtained by grouping all
`the anode cathode and
`injection waste reservoirs
`Injection Method Fig 2A presents the design of the sample
`that contains four sample reservoirs two separation
`injector
`and one injection waste
`reservoir The injection
`method is demonstrated in Fig 2 BE by using fluorescein In
`
`channels
`
`1 om
`
`FIG 1 Upper Mask pattern for the 96 sample capillary array
`electrophoresis microplate A is the detection region B and C are
`injection reservoirs D are waste reservoirs E are cathode reservoirs
`and F is the anode The diameter of the circle indicates the 10 cm wafer
`sized substrate Lower The scanning electron micrograph on the Left
`150 Arn apart with a 200 Arn spacing
`shows
`all 48 channels spaced
`every 12 channels The scanning electron micrograph
`on the Right
`presents a closeup of a portion of the array showing the 21 µm deep
`etched channels
`
`A
`
`Sample 1
`
`Sample 2
`
`Cathode
`
`Cathode
`
`Sample
`
`Anode
`
`Anode
`
`B
`
`Waste
`
`C
`
`Waste
`
`Cathode
`
`Anode
`
`Cathode
`
`Anode
`
`Sampf el
`
`Saraple2
`
`Sample 1
`
`Sample2
`
`D
`
`Waste
`
`13
`
`Waste
`
`Cathode
`
`Sample
`
`Anode
`
`Cathode
`
`Samp1e2
`
`Sampte I
`
`And
`
`Sample2
`
`FIG 2 A Layout of the sample injector The sample injector
`common waste reservoir labeled as in Fig 1 BE Fluorescence
`
`includes four sample reservoirs two separation
`
`columns and one
`
`images illustrating the operation of the injector with fluorescein
`
`of diffusion into the cathode
`
`cathode
`
`Fig 2B an injection voltage 300 V is applied between sample
`1 and the injection waste to draw sample into the
`reservoir
`cross channel
`region During injection a biasing voltage 250
`V is used to reduce broadening of the injection plug because
`and anode channels In Fig 2C
`the separation voltage 3700 V is applied between the
`and anode and the sample 1 and inject waste reser
`voirs are back biased 720 V to clear excess sample from the
`injection cross channel A 100 pan long sample plug is injected
`and any residual sample is pulled away from the injection
`region to avoid tailing Fig 2 D and E presents analogous
`injections of sample 2 This injection method has been used
`successfully to inject up to four samples into a single capillary
`with no indications of cross contamination 28
`Sample Preparation Samples were prepared by using PCR
`amplification and digestion to assay the C282Y mutation in the
`A mutation at nucleotide 845 creates
`HFE gene This G
`a
`Rsal restriction site in the HFE gene 29 DNA was isolated
`from peripheral blood leukocytes by using standard methods
`30 A segment of the HFE exon containing the variant site
`was amplified with the following primers HHE4B 5
`GACCTCTTCAGTGACCACTC3 HC282R 5CTCAG
`GCACTCCTCTCAACC3 The HC282R primer
`follows
`Feder et al 25 whereas the HHE4B primer is of our own
`design and contains a 5 biotin tag The 25µ1 amplification
`reaction mixture contained 10 mM TrisHC1 pH = 88 50
`mM KC1 075 mM MgC12 02 mM dNTPs 75 pmol of each
`primer and 15 units of AmpliTaq DNA polymerase
`The PCR was carried out under
`three consecutive
`conditions 5 cycles of 95°C for 1 min 64°C for 1 min and 72°C
`for 1 min 5 cycles of 95°C for 1 min 60°C for 1 min and 72°C
`for 1 min and 25 cycles of 95°C for 1 min 56°C for 1 min and
`72°C for 1 min The restriction digestion of amplified product
`was carried out by adding 4 µ1 of each amplified sample to 6
`µ1 of buffer containing 2 units of Rsal Sigma and digesting
`for 90 min at 37°C Samples were dialyzed against deionized
`
`PerkinElmer
`
`BioRad Exhibit 2006
`IPR201700055
`Page 2 of 6
`
`

`

`2258
`
`Biophysics Simpson et al
`
`Proc Natl Acad Sci USA 95 1998
`
`H20 on a 96 sample dialysis plate Millipore Sample types
`on 1 agarose3 SeaPlaque FMC Bioproducts gel in 05 X
`were initially established by separation of restriction fragments
`TBE lx TBE = 9 mM Tris646 mM boric acid25 mM
`EDTA pH 83 Gels were stained in 05 pigm1 ethidium
`bromide for 30 min and visualized on a UV transilluminator
`Spectroline model TR302 along with a 123 bp ladder Life
`Technologies Gaithersburg MD to determine
`fragment
`
`sizes
`
`it
`
`Electrophoretic Methods Previous experiments with CE
`chips 1315 18 and CAE chips 20 have used plastic pipette
`tips pushed into sample holes or tubing glued to the substrate
`to form reservoirs along with manual electrical contact How
`ever with 127 holes and reservoirs these
`approaches
`are
`impractical To simplify sample handling and electrode intro
`duction and to increase the volume of buffer in the cathode and
`anode reservoirs an elastomer Sylgard 184 Dow Corning
`reservoir array and an electrode array were developed Fig 3
`The elastomer reservoir array was placed onto the plate before
`filling the channels with separation medium 075 wtvol
`hydroxyethylcellulose HEC in lx TBE buffer with 1
`iitM
`ethidium bromide Ethidium bromide was used to fluores
`the DNA because
`the
`is better
`suited for
`cently label
`available 532nm excitation than the other stains and labels we
`have developed for 488nm excitation 31 The 1 mm thick
`elastomer sheet makes a water tight seal when it
`is in contact
`with the glass and fully isolates the reservoirs from one
`another The capillaries were pressure filled with sieving
`matrix from the anode until all channels were filled The anode
`reservoirs were filled with 10 X TBE buffer to
`and cathode
`reduce ion depletion during electrophoresis Sample reservoirs
`were rinsed with deionized water and then samples 35 pil
`were loaded from a microtiter plate by using an eight tipped
`pipetter The electrode array was fabricated by placing an array
`of platinum wires through a printed circuit board Each wire
`corresponded to a reservoir on the plate and the wires were
`connected with metal strips on the circuit board The circuit
`board was placed on the elastomer array and used to address
`The elec
`reservoirs and reduce evaporation
`the individual
`trode array was connected to four computer controlled power
`supplies Stanford Research Systems series PS300 Sunnyvale
`CA and a computer program written in LABVIEW National
`Instruments Austin TX was used to automatically
`switch the appropriate voltages
`
`time and
`
`Pt Electrode Array
`
`Elastomer Reservoir
`
`Array
`
`CAE micro plate
`
`IIIIIIr
`
`7 7
`
`5
`
`WA
`
`1 ill VIII
`
`FIG 3 Schematic of the elastomer
`reservoir array and electrode
`loading array is placed on top
`array loading assembly The elastomer
`of the microplate so that
`the holes in the elastomer are aligned with
`the drilled holes in the CAE microplate The electrode array is then
`placed on top of the elastomer
`to address the reservoirs
`
`532 am Frequency
`Doubled YAG Laser
`
`Excitation
`
`Filter
`
`Beam
`
`Expander
`
`Emission
`
`Filterd
`
`PMT
`
`Pinhole
`
`c
`
`Dichroic
`
`Bearnsplitter
`
`Galvo
`
`Final
`Lens
`
`CAE microplate
`
`To Power
`
`Supplies
`
`FIG 4 Schematic of the laser excited galvoscanner and the CAE
`microplate assembly PMT photomultiplier tube
`
`Instrumentation The CAE microplate was probed with a
`galvoscanner Fig 4 equipped with a doubled NdYAG
`laser Uniphase San Jose CA
`yttriumaluminum garnet
`The 30mW 532nm beam was focused to a 5µm spot and was
`across the channels at 40 Hz The beam was focused
`scanned
`by using a 033 numerical aperture scan lens system designed
`field analysis 32 The detection system
`for quantitative
`consisted of an emission filter 545620 nm followed by a 400
`ium pinhole and has demonstrated a fluorescence detection
`limit of 1 molecule of Cy3 dye per 100 ium2 Data correspond
`fluorescent emission were acquired at
`ing to spatially distinct
`77 kHz with a 16 bit analog to digital converter BurrBrown
`Tucson AZ Logarithmic data compression was used result
`ing in 5 linear orders of dynamic measurement
`range The data
`were obtained as a 16 bit TIFF image and electropherograms
`were generated in IPLAB Signal Analytics Vienna Virginia
`by summing data points across each channel
`
`RESULTS
`A restriction fragment marker for HHC derived from the HFE
`gene was chosen to demonstrate the high throughput analysis of
`biologically relevant samples with CAE microplates HHC is a
`genetic disorder that causes a buildup of iron in tissues resulting
`time in disease primarily affecting the liver 33 Between
`over
`01 and 05 of the Caucasian population are homozygous for
`the HFE C282Y variant 34 If this condition is detected early
`treatment can be initiated and long term effects avoided thus
`high throughput screening methods are needed
`Fig 5 presents an image of separations of 96 HFE amplicons
`on a CAE microplate The 96 samples were separated in two
`runs of 48 samples corresponding to the two injection reser
`voirs per channel The width of the electrophoretic
`image
`shown is 74 mm for 48 lanes and the complete analysis of 96
`samples was performed in less than 8 min The expanded
`images show that the bands are of high intensity and resolution
`In this experiment 19 different samples were dispersed among
`the 96 sample wells giving a 5fold redundancy
`in sample
`analysis The normal allele 845G exhibits two fragments one
`at 167 bp and one at 140 bp the variant 845A shows three
`bands at 167 111 and 29 bp The heterozygote types exhibit
`four
`the variation
`fragments After accounting
`for
`in
`migration time across
`the image caused by the asymmetric
`placement of the anode
`the migration times are
`reservoir
`from lane to lane with a range of
`found to be consistent
`199204 sec SD = 065 48 measurements for the first
`injection and 205215 sec SD = 098 48 measurements
`injection The migration times for
`
`all
`
`the second
`
`for
`
`the second
`
`BioRad Exhibit 2006
`IPR201700055
`Page 3 of 6
`
`

`

`Biophysics Simpson et al
`
`Proc Natl Acad Sci USA 95 1998
`
`2259
`
`0
`
`V1
`
`71
`
`141
`
`IsLl
`
`Pt An
`
`tungieraAA
`ilmomemessir
`
`96
`
`84
`
`72
`
`60
`
`g 48
`
`VD
`
`36
`
`24
`
`12
`
`140
`
`160
`
`180
`
`Time Sec
`
`200
`
`220
`
`generated from the image of 96 HFE
`FIG 6 Electropherograms
`separations presented in Fig 5 The electropherograms
`have been
`shifted by up to 10 to align the constant doublet peak at 167 bp The
`by i
`a single peak
`at 140 bp
`three genotypes are characterized
`to the 845G type ii
`a single peak at 111 bp corre
`corresponding
`sponding to the 845A type and iii
`the heterozygote type which
`exhibits both the 140 bp and 111 bp peaks Because
`the intensity of
`to DNA fragment size the
`intercalation
`dye labeling is proportional
`29 bp fragment
`is not observable in these displays
`
`accounts
`in the doublet 11 Although the
`for the larger fragment
`biotinylated material could have been purified by using stan
`the 167 bp doublet provides a
`dard procedures we found that
`useful
`reference for the alignment of the electropherograms
`The average distance between the 111 and 140 bp bands is 73
`sec with SDs of 08 and 06 sec respectively
`for the first
`injection and 66 sec with SDs of 11 and 05 sec respectively
`for the second injection By Students t test the typings for both
`
`13
`
`First
`
`Injection
`
`1
`
`88
`
`101
`
`1
`
`1111111111
`
`14III1411
`
`jI111
`
`11111
`
`041
`
`411114144
`
`1111111111101111111011101
`
`1
`
`12
`Channef Number
`
`24
`
`It
`
`C Second Injection
`
`5
`
`11
`
`re r
`
`i 1r lir il
`
`sell
`
`I
`
`111111
`II eallitill1111
`
`36
`
`1111
`
`24
`
`411111111101011
`
`1
`
`12
`Channd Number
`
`rPnwout
`10101P6
`
`74 RIM
`
`FIG 5 A Image of 96 Rsa I digested HFE amplicons analyzed in
`two sequential 48 sample separations B and C Expanded views of
`the separation image from the first and second injection respectively
`The total time for the two separations was less than 76 min Samples
`were separated on 075 wtvol hydroxyethylcellulose
`in 1X TBE
`buffer with 1 AM ethidium bromide in the running buffer The
`channels were 10 cm in length from the injection to the detection
`region The injection was performed as described in the text and the
`applied fields for injection and separation were 300 Vcm
`
`injection are slower and less consistent because of ion deple
`tion in the reservoirs11 The variation
`in migration times is
`in other CAE chips 20 and conventional
`comparable to that
`capillary arrays 612 The total run time for the two sepa
`rations was 76 min corresponding to an analysis time of less
`than 5 sec per sample
`The image in Fig 5 shows
`there is a variation in the
`that
`20 sec slower
`migration times with the right lanes running
`than the left This is caused by a gradient
`in the electrophoresis
`voltages resulting from the placement of the anode to the side
`of the detection region This placement of the anode was
`necessary to ensure adequate clearance from the objective this
`distortion could easily be eliminated in a second generation
`system by scanning from below or by adjusting the capillary
`lengths accordingly
`obtained from the
`Fig 6 presents the 96 electropherograms
`image in Fig 5 All electropherograms
`have been shifted to
`align the 167 bp doublet
`to compare the separations The
`167 bp fragment appears as a doublet because of the partial
`biotinylation of the HHE4B primer the biotinylated
`form
`
`the start of the second
`1TThe sharp peaks at
`injection electrophero
`grams are believed to be caused by false amplification products
`associated with the AA and AG genotypes The amount of false
`for similar DNA types in the first
`and
`amplification is equivalent
`second injections The peaks due to false amplification are sharper in
`the second injection because of increased stacking effects due to the
`of 10X TBE from the cathode to the injector
`electromigration
`
`Two peaks at 167 bp were also observed in polyacrylamide
`slab gel
`assays The biotinylated form of the primer accounted for the larger
`in the doublet This was shown by amplification with a
`fragment
`E4B primer which yielded a single band correspond
`nonbiotinylated
`the two bands in the doublet
`fragment
`ing to the smaller
`of
`furthermore adsorption of the biotinylated E4B PCR product on
`immobilized avidin removed the larger band data not shown
`
`BioRad Exhibit 2006
`IPR201700055
`Page 4 of 6
`
`

`

`2260
`
`Biophysics Simpson et al
`
`Proc Natl Acad Sci USA 95 1998
`
`from
`
`testing HFE genotyping work was supported in part by a grant
`the Kaiser Foundation Research Institute to David M Baer and GFS
`Fabrication of CAE microplates was performed at the University of
`California Berkeley Microfabrication Laboratory This research was
`supported in part by the Director Office of Energy Research Office
`Research of the US Department
`of Health and Environmental
`of
`Energy under Contract DEFG91ER61125
`and by the National
`tutes of Health under Grant HG01399 to RAM Work at Molecular
`Institutes of Health Grant RO1
`Dynamics was supported by National
`HG0177501
`Institute of Standards and Technol
`and by the National
`ogy under Grant 70 NANB5H1031
`
`Insti
`
`are determined to be at a >999 confidence
`injections
`level All 96 samples were typed accurately and could easily
`from either
`the
`be genotyped
`the electropherograms
`or
`image
`
`DISCUSSION
`We have designed fabricated and operated CAE microplates
`that can rapidly analyze 96 samples on a single device This
`work shows
`that microfabrication
`techniques can be used to
`make high density arrays of capillaries over an entire 10 cm
`wafer without significant defects Cathode anode and injec
`tion waste reservoirs are combined to reduce the number of
`holes to 54N The array pattern places the sample reservoirs
`on 9mm centers in one dimension to facilitate parallel loading
`of multiple samples We have also demonstrated galvanomet
`ric scanning detection that provides sampling rates of >10 Hz
`with sufficient signaltonoise ratio for high sensitivity DNA
`analysis With these CAE microplates the analysis of 96 PCR
`product or double stranded DNA fragment samples can be
`in less than 8 min <5 sec per sample This is a 50
`achieved
`over conventional auto
`to 100 fold increase in throughput
`mated slab gel systems where gel casting loading and running
`of 2448 samples requires hours The high throughput of these
`CAE microplates will
`facilitate rapid and inexpensive double
`stranded restriction
`fragment screening for genetic diseases
`such as HHC CAE microplates will also be valuable for
`single stranded short tandem repeat analysis under denaturing
`conditions following the methods recently developed by Wang
`and coworkers
`for forensic identification and cancer diagnosis
`35 36
`could further
`Several straightforward design modifications
`the application of CAE microplates to genetic anal
`enhance
`ysis While the separation times are short manual sample
`loading remains a timeconsuming task We are currently
`working on methods to automate both channel
`filling and
`injections are an effective method of
`sample loading Serial
`increasing the sample throughput with a limited number of
`is feasible and
`capillaries Injection of four samples per channel
`could be used to analyze 192 samples per plate Alternatively
`fabrication of 96 individual capillaries on a CAE microplate
`would increase the throughput
`2 fold and ensure no sample
`contamination The scanning detection system could be im
`proved by inverting the objective and scanning from below
`Placing the optics below the plate would permit facile manip
`ulation and introduction of samples Inverted scanning would
`also avoid spatial conflict with the anode reservoir permitting
`central placement of the anode With these variations it
`is easy
`to envision microplates in a wide variety of formats that can
`resolution separations
`faster separations or
`provide higher
`separations of more samples
`As the throughput of microdevices
`such as high density
`CAE microplates and oligonucleotide
`arrays 37 increases
`convenient and low cost sample preparation will become a
`more important and significant challenge
`Integrating an
`array of 96 PCR chambers with 96 capillaries on a chip
`following the design concepts we presented previously 23
`would enhance the utility of CAE microplates by eliminating
`sample tracking and manual
`transfer steps This integration
`should also lead to reduced amplification sample volumes
`which will
`reduce assay costs
`Integration of electronic
`heaters thermocouples and detection systems together with
`an array of microfluidic capillaries in a single device would
`further enhance the capabilities
`and ease of operation of
`these DNA microprocessors
`
`We thank Bob Loder and Tom Armstrong for help with computer
`software and optics and Dr David M Baer of Kaiser Permanente
`patient samples for HHC
`in Oakland CA for providing
`
`Hospital
`
`9
`
`253258
`
`15
`
`Jr
`
`19
`
`25
`
`1 Kostichka A J Marchbanks M L Brumley R L Jr Dross
`Smith L M 1992 Bio Technology 10 7881
`man H
`Landers J P Oda R P Spelsberg T C Nolan J A
`2
`Ulfelder K J 1993 Bio Techniques
`14 98111
`3 Drossman H Luckey J A Kostichka A J DCunha J
`Smith L M 1990 Anal Chem 62 900903
`Swerdlow H
`Gesteland R 1990 Nucleic Acids Res 18
`4
`14151419
`5 Cohen A S Najarian D R
`Karger B L 1990 J Chro
`matogr 516 4960
`6 Huang X C Quesada M A Mathies R A 1992 Anal
`Chem 64 967972
`7 Huang X C Quesada M A Mathies R A 1992 Anal
`Chem 64 21492154
`8 Clark S M
`Mathies R A 1993 Anal Biochem 215
`163170
`Takahashi S Murakami K Anazawa T
`Kambara H 1994
`Anal Chem 66 10211026
`10 Ueno K Yeung E S 1994 Anal Chem 66 14241431
`11 Bashkin J Bartosiewicz M Roach D Leong J Barker D
`Johnston R 1996 J Capillary Electrophor 3 6168
`12 Kheterpal I Scherer J R Clark S M Radhakrishnan A Ju
`J Ginther C L Sensabaugh G F
`Mathies R A 1996
`Electrophoresis 17 18521859
`13 Manz A Harrison D J Verpoorte E M J Fettinger J C
`Paulus A Ludi H Widmer H M 1992J Chromatogr 593
`14 Harrison D J Manz A Fan Z Ludi H Widmer H M
`1992 Anal Chem 64 19261932
`Jacobson S C Koutny L B Hergenroeder R Moore A W
`Ramsey J M 1994 Anal Chem 66 34723476
`16 Harrison D J Fluri K Seiler K Fan Z Effenhauser C S
`Manz A 1993 Science 261 895897
`17 Effenhauser C S Manz A Widmer H M 1993 Anal
`Chem 65 26372642
`18 Woolley A T Mathies R A 1994Proc Natl Acad Sci USA
`91 1134811352
`Jacobson S C Ramsey J M 1996Anal Chem 68 720723
`20 Woolley A T Sensabaugh G F Mathies R A 1997Anal
`Chem 69 21812186
`21 Effenhauser C S Paulus A Manz A Widmer H M 1994
`Anal Chem 66 29492953
`22 Woolley A T
`Mathies R A 1995 Anal Chem 67
`36763680
`23 Woolley A T Hadley D Landre P deMello A J Mathies
`R A Northrup M A 1996 Anal Chem 68 40814086
`24 Li P C H Harrison D J 1997Anal Chem 69 15641568
`Feder J N Gnirke A Thomas W Tsuchihashi Z Ruddy
`D A Basava A Dormishian F Domingo R Jr Ellis M C
`Fullan A et al 1996 Nature Genet 13 399408
`26 Hjerten S 1985 J Chromatogr
`347 191198
`27 Clark S M Mathies R A 1997Anal Chem 69 13551363
`28 Simpson P C Woolley A T Mathies R A 1998 Biomed
`ical Microdevices 1 in press
`29 Calandro L Thorsen T Barcellos L Griggs J Baer D
`Sensabaugh G F 1996 Blood Cells Mol Dis 22 194a 194b
`30 Miller S A Dykes D D Polesky H F 1988 Nucleic Acids
`Res 16 1215
`31 Glazer A N Mathies R A 1997 Curr Opin Biotechnol 8
`94102
`32 Alexay C Kain R Hanzel D Johnston R 1996Proc SPIE
`Int Soc Opt Eng 2705 6372
`33 Bothwell T H Charlton R W Motulsky A G 1995 in
`
`The Metabolic
`
`and Molecular Bases of Inherited Disease eds
`
`BioRad Exhibit 2006
`IPR201700055
`Page 5 of 6
`
`

`

`Biophysics Simpson et al
`Scriver C R Beaudet A L SlyW S Valle D McGraw
`Hill New York 7th Ed pp 22372269
`34 MerryweatherClarke A T Pointon J J Shearman J D
`Robson K J H 1997 J Med Genet 34 275278
`35 Wang Y Wallin J M Ju J Sensabaugh G F
`R A 1996 Electrophoresis 17 14851490
`
`Mathies
`
`Proc Natl Acad Sci USA 95 1998
`36 Wang Y Hung S Linn J
`F Steiner G Glazer A N
`Sidransky D
`Mathies R A
`1997 Electrophoresis 18 1742
`1749
`37 Chee M Yang R Hubbell E
`Berno A Huang X C Stern
`D Winkler J Lockhart D J
`Morris M S
`Fodor S P A
`1996 Science 274 610614
`
`2261
`
`BioRad Exhibit 2006
`IPR201700055
`Page 6 of 6
`
`