United States Patent [19J
`Mi to ma
`
`I lllll llllllll Ill lllll lllll lllll lllll lllll 111111111111111111111111111111111
`US006144448A
`[11] Patent Number:
`[45] Date of Patent:
`
`6,144,448
`Nov. 7, 2000
`
`[54] FLUORESCENCE DETECTING APPARATUS
`
`[75]
`
`Inventor: Yasutami Mitoma, Kanagawa-ken,
`Japan
`
`[73] Assignee: Tosoh Corporation, Yamaguchi-ken,
`Japan
`
`[21] Appl. No.: 09/517,666
`
`[22] Filed:
`
`Oct. 30, 1996
`
`Related U.S. Application Data
`
`[63] Continuation of application No. 08/087,855, Jul. 9, 1993,
`abandoned.
`Foreign Application Priority Data
`
`[30]
`
`Jul. 17, 1992
`
`[JP]
`
`Japan .................................... 4-212288
`
`Int. Cl.7 ..................................................... GOlN 21/64
`[51]
`[52] U.S. Cl. ....................... 356/317; 250/458.1; 435/808;
`436/172
`[58] Field of Search ..................................... 356/317, 318,
`356/417, 440; 250/458.1, 459.1, 461.1,
`461.2; 435/34, 289-291, 808; 422/82.07-82.08,
`82.11; 436/172
`
`[56]
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`3,992,631
`4,498,780
`5,217,876
`5,252,834
`
`11/1976 Harte .
`2/1985 Banno et al. ....................... 356/440 X
`6/1993 Turner et al. ............................. 435/34
`10/1993 Lin ....................................... 250/458.1
`
`5,371,016 12/1994 Berndt .................................. 356/461.2
`5,473,437 12/1995 Blumenfeld et al. ................... 356/417
`
`FOREIGN PATENT DOCUMENTS
`
`0 127 286
`0 127 418
`0 266 881
`0 156 274 A2
`WO 87/06716
`
`12/1984
`12/1984
`5/1988
`12/1992
`11/1987
`
`European Pat. Off ..
`European Pat. Off ..
`European Pat. Off ..
`European Pat. Off ..
`WIPO.
`
`OTHER PUBLICATIONS
`
`Bio/Technology vol. 10 Apr. 1992 Research pp. 413-417
`Higuchi et al Simultaneous Amplification and Detection of
`Specific DNA Sequences.
`
`Primary Examiner---F. L. Evans
`Attorney, Agent, or Firm-Nixon & Vanderhye
`
`[57]
`
`ABSTRACT
`
`A fluorescence detecting apparatus which allows highly
`precise measurement of fluorescence even with minute
`sample amounts, which has a strong responsiveness to
`temperature variations, which allows simultaneous measure(cid:173)
`ment of a plurality of samples, and wherein the light source
`and the container holder, and the container holder and the
`fluorescence detector, are each optically connected by opti(cid:173)
`cal fibers; and the optical fibers are connected to the con(cid:173)
`tainer holder in such a manner that the sample in the
`container is excited for fluorescence from below the sample
`container held by the container holder, and that they may
`receive the fluorescent light which is emitted by the sample
`from below the sample container.
`
`13 Claims, 4 Drawing Sheets
`
`DETECTING
`APPARATUS
`
`LIGHT
`SOURCE
`
`THERMO FISHER EX. 1008
`
`

`
`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 1 of 4
`
`6,144,448
`
`Fig. 1
`
`1
`
`5
`
`2
`
`3
`
`D
`
`6 -
`
`1 - - - - - - - - - - '
`
`THERMO FISHER EX. 1008
`
`

`
`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 2 of 4
`
`6,144,448
`
`Fig. 2
`
`7
`
`10
`
`8
`
`DETECTING
`APPARATUS
`
`LIGHT
`SOURCE
`
`THERMO FISHER EX. 1008
`
`

`
`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 3 of 4
`
`6,144,448
`
`Fig. 3
`
`.
`
`600-
`
`500 -
`
`400-
`
`300-
`
`200-
`
`100 -
`
`>-
`1-
`Cf) z
`w
`1-z
`w
`(.) z
`w
`u
`Cf)
`w
`a::
`0
`:::>
`_J
`LL
`w
`>
`I(cid:173)
`<!
`_J
`w
`a::
`
`0 +-~-.-----,lr----r~--.-----1--,r----rl~-
`o
`10
`20
`30
`
`THERMO FISHER EX. 1008
`
`

`
`U.S. Patent
`
`Nov. 7, 2000
`
`Sheet 4 of 4
`
`6,144,448
`
`Fig. 4
`
`1 • 5
`
`1 • 0
`
`........
`>
`....._,.
`
`>-
`I-
`Cf)
`z
`w
`I-z
`
`UJ
`u
`z
`w
`u
`Cf)
`UJ
`0:::
`0
`:::)
`_J 0.5
`LL
`
`UJ
`>
`I-
`<(
`_J
`UJ
`0:::
`
`0
`
`55°C
`
`72°C
`
`94°C
`
`........
`p
`....._,.
`
`w
`0:::
`:::)
`..__
`<(
`0:::
`w
`a..
`~ w
`I-
`
`0
`
`2
`
`3
`
`4
`
`5
`
`TIME
`
`(MINUTE)
`
`THERMO FISHER EX. 1008
`
`

`
`6,144,448
`
`1
`FLUORESCENCE DETECTING APPARATUS
`
`This is a continuation of application Ser. No. 08/087,855,
`filed Jul. 9, 1993, now abandoned.
`
`FIELD OF THE INVENTION
`
`The present invention relates to a fluorescence detecting
`apparatus, and more specifically, it relates to a fluorescence
`detecting apparatus for measuring variations in the fluores(cid:173)
`cent properties of substances or their interacted complexes
`in reactions which occur between at least two types of
`substances capable of interaction between each other, for
`example, reactions involving nucleic acids and intercalatory
`fluorescent pigments, lipid bilayers and hydrophobic fluo(cid:173)
`rescent probes, proteins and fluorescent pigments, organic
`polymers and fluorescent pigments, etc.
`
`DESCRIPTION OF THE PRIOR ART
`
`5
`
`2
`light source to compensate for the reduction in the quantity
`of light, but in this case the problem of heat waste from the
`device and the influence of heat on the fluorescence detect(cid:173)
`ing apparatus are considerable, and thus it becomes difficult
`to obtain highly precise and repeatable measurement results.
`Very recently, devices which employ optical fibers in an
`optical system (Biotechnology, Vol. 10, p. 413, 1992) have
`become known, but in these devices the sample is excited
`from the top of the sample container, and the fluorescence
`10 from the sample is also received from the top, and therefore
`if the amount of the sample is small, there is a loss of
`exciting light and fluorescence from the sample in the air
`layer between the sample and the tip of the optical fibers.
`The process is thus complicated by the necessity of replac-
`15 ing the sample container from time to time, depending on the
`volume of the sample, in order to overcome this problem,
`and therefore improvement thereof is in order.
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`FIG. 1 is a drawing showing the construction of an
`apparatus according to the present invention;
`FIG. 2 is a drawing showing the periphery of the container
`holder of the apparatus in FIG. 1;
`FIG. 3 is a graph showing the results of Example 1, with
`the fluorescence intensity during the PCR cycle for various
`concentrations of A.DNA plotted on the vertical axis, and the
`number of PCR cycles plotted on the horizontal axis. In the
`figure, "a" represents a case where the amount of DNA is 2.5
`30 ng, "b" a case where it is 0.25 ng, and "c" a case where it
`is 0.025 ng.
`FIG. 4 is a graph showing the results of Example 2, with
`the fluorescence intensity during a PCR conducted in the
`presence of an intercalatory fluorescent pigment plotted on
`the vertical axis, indicating temperatures of the sample at the
`time of measurement of the fluorescence intensity on the
`right-hand side, and the time plotted on the horizontal axis.
`
`In reactions which occur between at least two types of 20
`substances capable of interaction between each other, for
`example, reactions involving nucleic acids and intercalatory
`fluorescent pigments, lipid bilayers and hydrophobic fluo(cid:173)
`rescent probes, proteins and fluorescent pigments, organic
`polymers and fluorescent pigments, etc., the fluorescent 25
`properties of these substances or their interacted complexes
`vary depending upon their state. Thus, if the variation in the
`fluorescent properties thereof is measured, it is possible to
`know the state of interreaction of the above substances, the
`amount of complex formed, etc.
`In polymerase chain reactions (PCRs) which are con(cid:173)
`ducted in the copresence of an intercalatory fluorescent
`pigment (for example Japanese Patent Application Hei
`3-313616) etc., it is possible to know the state ofnucleic acid
`amplification (success of the PCR) by measuring the fluo- 35
`rescent properties at a desired point in each cycle of the
`PCR, and usually at a point during repetition of separation
`of the double-stranded nucleic acid into single strands and
`hybridization between single strands, by variation of the
`temperature. In this procedure, a device is required which 40
`can vary the temperature according to a preset program and
`measure the change in the fluorescent properties of a sample
`in a sample container. Such a device in current use is a
`spectrophotometer containing a temperature-controlling cell
`holder.
`
`SUMMARY OF THE INVENTION
`
`DETAILED DESCRIPTION OF THE
`INVENTION
`The present invention relates to a fluorescence detecting
`apparatus which comprises a sample container which holds
`a sample, a container holder which holds the sample con(cid:173)
`tainer and is capable of varying the temperature of the
`45 sample in the sample container which it holds, a fluores(cid:173)
`cence detector for measuring the fluorescence from the
`sample, and a light source which emits exciting light to
`excite the sample for fluorescence, characterized in that the
`Measurement of fluorescent property variation according
`light source and the container holder, and the container
`to the prior art using a spectrophotometer employs a system 50 holder and the fluorescence detector, are each optically
`in which exciting light is directed towards a cell using an
`connected by optical fibers; and said optical fibers are
`optical system of lenses, mirrors, etc., and fluorescence is
`connected to the container holder in such a manner that the
`directed towards a fluorescence detecting apparatus in the
`sample in the container is excited for fluorescence from
`same manner, and therefore it has been difficult to effect
`below the sample container held by the container holder, and
`multichannel measurement (simultaneous measurement of 55
`that they may receive the fluorescent light which is emitted
`multiple samples). Furthermore, the responsiveness of the
`by the sample from below the sample container. A more
`sample temperature to the temperature variation is lessened
`detailed description of the present invention is provided
`by the amount of liquid in the sample, and it is difficult to
`below. The sample container for holding the sample may be
`measure the rapid interactions between compounds which
`of any shape, but in order to excite the sample from the
`accompany phase transitions.
`60 bottom of the container and to receive fluorescence of the
`sample from the bottom of the container, a container is used
`Various attempts have been made at improving tempera(cid:173)
`ture responsiveness, but in methods where the volume of the
`of which at least the bottom is light-permeable. In reaction
`systems such as the PCR, wherein there exists the danger of
`sample container is reduced, etc. it becomes necessary to
`select the beam of the exciting light, thus causing new
`infection of viral nucleic acids, etc. and the slightest con(cid:173)
`problems such as a reduction in the quantity of light and a 65
`tamination between two or more samples results in a large
`resulting decrease in the precision of measurement. An
`experimental error, it is preferable to use a sealable reaction
`attempt at improvement has been made by using an intense
`container and to supply the samples to the detector under
`
`THERMO FISHER EX. 1008
`
`

`
`6,144,448
`
`3
`sealed conditions. An example of a sealable sample con(cid:173)
`tainer is a commercially available centrifuge tube (for
`example, an Eppendorf microcentrifuge tube, etc.). Also,
`there is not particular restriction on the material, provided it
`satisfies the conditions described above.
`The container holder used to hold the sample container
`has a function for varying the temperature of the sample, and
`also serves to hold the container. It may be, for example, in
`the form of a container holder shaped to fit the container
`used, or be constructed, for example, in a large box shape
`with said container simply being placed therein.
`If the container holder is constructed in the form of a
`container holder shaped to fit the container, then it may be
`constructed so that variation in the temperature of samples
`may be achieved by, for example, varying the temperature of
`the container holder itself to vary the temperature of the
`sample container, thus varying the temperature of the sample
`in the sample container. In this case, the container holder and
`sample container are preferably constructed of a highly
`thermoconductive material. An example which may be
`mentioned is a heater, etc. installed on the surface of contact
`of the container holder with the container, in a position
`which does not interfere with excitement or reception of the
`fluorescent light. If the container holder is constructed in the
`form of a large box shape, then the temperature of the
`sample may be varied by installing a heater therein, creating
`a refrigerant circuit, or by air-conditioning or liquid bath,
`etc. In addition to these, a variety of other methods may be
`employed to vary the temperature of the sample according to
`the present invention. Since there is no need for heating 30
`when varying the temperature of the sample within a tem(cid:173)
`perature range of, for example, room temperature or lower,
`in such cases only cooling means may be provided. Thus, the
`container holder is preferably constructed with attention to
`the desired range of variation of the sample temperature.
`The fluorescence detector may be any one which is
`capable of measuring fluorescence from a sample. Here,
`"fluorescence" includes fluorescence intensity, fluorescence
`spectrum, etc., and these can be measured using a photo(cid:173)
`multiplier or a photodiode.
`The light source to be used may be a xenon lamp, a D2
`lamp, a mercury lamp, a halogen lamp, a discharge tube,
`laser light, or the like. According to the present invention,
`optical fibers are used both to direct the exciting light from
`the light source to the sample, and to direct the fluorescent
`light from the sample to the detecting apparatus. However,
`this does not exclude a construction wherein, for example,
`common optical parts such as lenses or mirrors are used near
`the light source in addition to the optical fibers, and the light
`focussed thereby is directed to the optical fibers.
`Two systems of optical fibers are used, one for directing
`the exciting light to the sample, and the other for directing
`fluorescent light from the sample to the fluorescence detec(cid:173)
`tor. Also, by using, for example a dichroic mirror or the like, 55
`the above mentioned 2 systems may be provided for by a
`single optical fiber (one line). The ends of the optical fibers
`of each system are connected directly to the light source and
`the fluorescence detector, respectively, via the above men(cid:173)
`tioned optical parts or if necessary a light amplifier, etc. If 60
`the two systems are provided for by a single optical fiber
`line, then an auxiliary optical system is attached thereto to
`direct light branched at the dichroic mirror provided at one
`end to the light source or the detector. The other end of the
`optical fiber line is connected to the container holder so that 65
`exciting light is radiated to the sample from below the
`sample container held by the container holder, and so that
`
`4
`fluorescence from the sample is received from below the
`sample container. For example, if the container holder is in
`the form of a holder shaped to fit the container, then the
`fibers may be connected so as to provide a through-opening
`5 on the concave section thereof, but in order to allow for
`highly precise and repeatable measurement of small
`amounts of samples, they are preferably connected at the
`deepest area of the concave section.
`The end of the optical fiber line for directing the exciting
`10 light and the one for receiving the fluorescent light may each
`be connected separately to the container holder. For
`example, the ends of the exciting light radiation fibers or the
`fluorescent light receiving fibers may be arranged so as to
`intersect over an extension wire, or they may be arranged to
`15 be parallel to each other. For a more sensitive and repeatable
`measurement of fluorescence according to the present
`invention, it is preferable to construct the ends of the fibers
`of the two systems in proximity to each other, and it is
`particularly preferable to construct the ends using fibers of
`20 two coaxial systems. If the ends are constructed using fibers
`of two coaxial system, then it is preferable to position the
`ends of the fibers for receiving the fluorescent light from the
`sample on the exterior, and the ends of the optical fibers for
`directing the exciting light in the center, since this allows for
`25 reception of weaker fluorescence. As mentioned previously,
`if the two systems are provided for by a single optical fiber
`line, then the end of the fiber line may be simply connected
`to the container holder.
`The source of the exciting light is normally selected to
`maximize the light intensity, but in cases where there exists
`the possibility of deterioration of the sample due to the
`radiation of the exciting light, a light-interrupting shutter
`may be provided to prevent the exciting light from radiating
`onto the sample, and the shutter may be opened and closed
`35 only at the time of measurement of the fluorescence to avoid
`constant bombardment of the exciting light onto the sample.
`The light-interrupting shutter is provided in the optical path
`running from the light source to the container holder, but the
`simplest construction is one in which a movable shutter is
`40 constructed between the ends of the optical fibers and the
`light source, and the shutter is mechanically or electrically
`moved to open and close in synchronization with the timing
`of measurement of the fluorescence. This timing may be, for
`example, the time at which the temperature of the container
`45 holder falls within a desired range (i.e., the time at which the
`sample in the container is thought to be in the desired range).
`Such a procedure is particularly effective in cases where
`continuous (intermittent) detection of fluorescence from two
`identical samples is made, such as in the fluorescence
`50 measurement in PCRs, as disclosed in Japanese Patent
`Application Hei 3-313616.
`The variation of the temperature of the container holder
`for varying the sample temperature may be effected within
`a desired range, and this may be stored in a program, and a
`controller for controlling the temperature of the container
`holder may be attached to the apparatus according to the
`present invention. The controller may include a sensor for
`sensing the temperature of the container holder and means
`for storing the above mentioned program, and may compare
`the signal from the above mentioned sensor and the contents
`of the program, outputting an indication for heating or
`cooling of the container holder, and this purpose may be
`achieved by using a microcomputer or the like. If the
`controller functions to control the detector, light source and
`shutter, etc. of the present invention, then it is possible to
`achieve an automatic fluorescence detecting apparatus
`which varies the temperature of a sample when the sample
`
`THERMO FISHER EX. 1008
`
`

`
`6,144,448
`
`20
`
`25
`
`EXAMPLES
`
`Examples will now be provided to illustrate the apparatus
`according to the present invention and measurement of
`fluorescence using it, without limiting the present invention
`thereto.
`
`Example 1
`
`6
`5
`container is placed in the container holder, and which can
`a case wherein the end surfaces of the optical fibers for
`measure fluorescence by opening and closing the shutter in
`irradiating exciting light and the end surfaces of the optical
`accordance with the timing.
`fibers for receiving fluorescent light are arranged coaxially.
`Also, in this embodiment the controller used is a
`The apparatus according to the present invention is suit(cid:173)
`5 microcomputer, and it controls the container holder, the
`able for use in PCRs. In this case, it is particularly preferable
`fluorescence detector, the light source and the shutter.
`that the above mentioned sample container be sealed. The
`PCR is a reaction which amplifies the nucleic acid in a
`The temperature of the container holder is varied accord-
`sample, and for the purpose of preventing secondary con(cid:173)
`ing to the temperature variation program stored in the
`tamination a fluorescence detecting apparatus according to
`controller, in order to vary the temperature of the sample in
`the present invention which employs a sealed sample con- 10
`the sample container (not shown). The light source is on
`tainer is most effective. This is because, by using a sealed
`during this time, or is controlled to be on in synchronization
`container, it is possible to keep to a minimum the contami(cid:173)
`with the timing of measurement of the fluorescence. The
`nation of nucleic acids by other samples, which is a cause of
`controller opens and closes the shutter according to a
`false positivity in PCRs.
`prescribed timing, following the signal from a temperature
`15 sensor (not shown), thus exciting the sample and allowing
`In most PCRs, completion is not after a single procedure.
`This is because the separation of double-stranded nucleic
`the fluorescence to be measured by the fluorescence detector.
`acids into single-stranded nucleic acids by varying the
`In this apparatus, the results of measurement by the fluo(cid:173)
`temperature of the sample, annealing of a primer to each of
`rescence detector may be read by the controller and later
`the single-stranded nucleic acids, and the extension reaction
`displayed.
`of nucleic acids originating from the primer (which results
`FIG. 2 is a drawing showing the periphery of the container
`in the appearance of double-stranded nucleic acids) are
`holder of the apparatus explained in FIG. 1. 7 represents a
`conducted as one cycle, and the cycle is usually repeated.
`sealed sample container, 8 a sample in the container, 9 an
`Thus, an apparatus according to the present invention which
`aluminum container holder which holds the sample con-
`is suitable for PCRs, is preferably provided with the above
`tainer (only one of the plurality of concave sections in
`mentioned shutter.
`shown), 10 an 0-ring and 11 a screw which connects the
`Because the above mentioned cycle is repeated, the tem(cid:173)
`optical fibers to the container holder. In this embodiment, 48
`perature variation of the container holder is actually the
`fibers are bunched together and arranged around the
`variation between the temperature at which the nucleic acids
`perimeter, with 12 for irradiation of the exciting light and the
`can exist in double-stranded form (if the object nucleic acid 30 remaining 36 for receiving the fluorescent light.
`is double-stranded, then this temperature range is applied at
`the start of the above mentioned cycle, at the time of
`extension of the primer, and appearance of the double(cid:173)
`stranded nucleic acid resulting from the above mentioned
`extension) and the temperature at which they can only exist 35
`in single-stranded form (this temperature range is applied for
`division of the double-stranded nucleic acid into single
`strands).
`With reactions involving nucleic acids and intercalatory
`fluorescent pigments as a case in point, here the fluorescent 40
`properties of the fluorescent pigment themselves vary in a
`temperature-dependent manner, and thus the timing of varia(cid:173)
`tion of the temperature of a sample in a PCR and opening
`and shutting of the above mentioned shutter is preferably
`such that the measurement is made at a stage wherein a fixed 45
`temperature has been reached after completion of a series of
`temperature variations, rather than during variation of the
`temperature. Furthermore, in this reaction, since a fluores(cid:173)
`cent pigment is taken up in the nucleic acid extension
`reaction which originates with a primer, and the fluorescent 50
`properties thereof vary, the reaction may be monitored to
`determine whether or not the PCR is successful (Japanese
`Patent Application Hei 3-313616); however, here as well the
`temperature range may be one in which the nucleic acids can
`exist in double-stranded form, and a timing which maintains 55
`a fixed temperature in the interior of the sample container is
`preferable. In concrete terms, this is at the moment of
`completion of the above mentioned cycle.
`An explanation of the present invention will now be given
`with reference to the drawings. FIG. 1 is a drawing showing 60
`the entire body of an apparatus according to the present
`invention. 1 represents a container holder for holding a
`sample container, provided with a plurality of concave
`sections for holding containers to allow measurement of a
`plurality of samples, and optical fibers 5 on each concave 65
`section. 2 represents a fluorescence detector, 3 a light source,
`4 a shutter, 5 optical fibers, and 6 a controller. FIG. 1 shows
`
`Using a commercially available DNA synthesis kit
`(GeneAmp, trade name, product of Takara Brewing Co.) and
`the apparatus shown in FIGS. 1 and 2, amplification of
`nucleic acids was effected using the PCR (1 cycle=
`denaturation at 94 ° C. for 1 minute, annealing at 55° C. for
`1 minute, extension at 72° C. for 1 minute (using Taq
`polymerase), and 30 cycles were repeated in the presence of
`an intercalatory fluorescent pigment (Pigment 33258, prod(cid:173)
`uct of Hoechst AG). The reaction solution for the PCR was
`prepared using a calibrating A.-DNA and 1 set of primer
`included in the kit, and following the directions for the kit.
`The fluorescent pigment was added to a concentration of 1
`µg!ml. The composition of the reaction solution is listed
`below.
`
`A-DNA (1 µg, 0.1 µg or 0.01 µg/ml)
`10 x reaction buffer solution
`(Sodium chloride
`(Tris-HCl buffer solution (pH 8.0)
`(Magnesium chloride
`(Gelatin (weight/volume)
`Intercalatory fluorescent pigment
`(final concentration)
`(20 µM)
`Primer 1 and Primer 2
`(Primer 1:
`A-DNA, corresponding to 7131-7155,
`anti sense strand
`GATGAGTTCGTGTCCGTACAACfGG)
`
`10 µl
`10 µl
`0.5 M)
`0.1 M)
`15 mM)
`0.01%)
`1 ug/ml
`
`1 µlea
`
`THERMO FISHER EX. 1008
`
`

`
`7
`
`-continued
`
`(Primer 2:
`
`A.-DNA, corresponding to 7607-7630,
`sense strand
`GGTTATCGAAATCAGCCACAGCGCC)
`dNTP mixture
`(2.5 mM ea)
`Water
`Taq polymerase
`
`(5 units/µ!)
`
`8 µl
`59 .5 µl
`0.5 µl
`
`6,144,448
`
`8
`coaxial fibers (E32-CC200, product of Omron) were used.
`For comparison, the above mentioned optical fibers were
`affixed to the upper opening of the microcentrifuge tube for
`measurement in the same manner. For this purpose, the end
`5 surfaces of the optical fibers positioned at the liquid surface
`of the sample in the centrifuge tube and at the above
`mentioned opening were separated by a gap of 23 mm.
`The above mentioned optical fibers consisted of one 1 mm
`diameter fiber in the center, and 16 lines of 0.25 mm fibers
`10 around the periphery, with the center fiber used for irradi(cid:173)
`ating exciting light, and the peripheral fibers used for
`receiving fluorescent light. In this embodiment, a 50 W
`xenon lamp is used as the light source, and measurement
`was made of the exciting light which was transmitted
`15 through a U-350 filter and of the fluorescent light which was
`transmitted through an interference filter (400--450 nm).
`As a result, a fluorescence intensity of 265 m V was
`obtained with the apparatus according to the present
`invention, whereas the fluorescence intensity from the same
`sample was measured to be 20 m V, or only about 1.lt3 in
`comparison, when the optical fibers were attached to the
`upper opening of the centrifuge tube.
`
`EFFECT OF THE INVENTION
`
`In the apparatus shown in FIGS. 1 and 2, optical fibers
`(Superesca, product of Mitsubishi Rayon), a controller
`(DCP200, product of Yamatake Honeywell) and a light
`source (50 W xenon lamp; light power source: Model
`C-2576, both products of Hamamatsu Photonics) were used,
`and the shutter and fluorescence detector were manufactured
`in-house.
`For the three different samples prepared in the above
`manner having different initial A-DNA concentrations, 25 µl
`of each reaction solution was sampled in a microcentrifuge
`tube (product of Biobic ), mineral oil was superpositioned on 20
`the surface thereof to prevent evaporation of the sample,
`which was carried on an aluminum block, and the PCR was
`carried out while raising and lowering the temperature.
`Exciting light from the xenon lamp light source and passing
`through a U350 color glass filter was focussed with a lens, 25
`directed towards the optical fibers, and irradiated from the
`bottom of the sample container to the sample. The fluores(cid:173)
`cence from the sample was received by the optical fibers at
`the bottom of the reaction container, and the light which
`passed through a 400-450 nm interference filter was mea- 30
`sured with the in-house manufactured fluorescence detector
`which contained a photodiode. The measurement of the
`fluorescence was made during the final second of the exten(cid:173)
`sion reaction of the above mentioned reaction cycle.
`The resulting measurement of the variation in fluores(cid:173)
`cence during the PCR was as shown in FIG. 3. In FIG. 3, the
`fluorescence intensity during the PCR cycle for each con(cid:173)
`centration of A-DNA is plotted on the vertical axis, and the
`number of cycles is plotted on the horizontal axis, and it is
`clear from this graph that the number of cycles required for
`an increase in the fluorescence intensity depended on the
`concentration of the sample; that is, 3 curves were obtained
`with different increase points depending on the initial
`amount of DNA in the sample.
`
`35
`
`40
`
`According to the present invention, since the light source,
`the container holder (i.e., the sample) and the fluorescence
`detector are all connected by the optical fibers, it is possible
`to arrange all of these separately so that the heat-emitting
`light source and the container holder do not affect the
`fluorescence detector. Furthermore, multichannel
`measurement, or direction of exciting light from a single
`light source to a plurality of samples, and direction of
`fluorescence from a plurality of samples to a detector, may
`be easily realized. If highly photoconductive fibers are used,
`then the loss of the exciting light and fluorescent light may
`be prevented and the light beam may be selected, and
`therefore it is possible to make high precision measurements
`even in the case of, for example, minute sample amounts,
`etc.
`According to the present invention, exciting light is
`irradiated onto the bottom of a sample container, and fluo(cid:173)
`rescent light is received at the bottom of the sample, and
`therefore the air layer between samples may be kept to a
`45 minimum. As a result, highly precise measurements are
`possible particularly in cases where fluorescence is mea(cid:173)
`sured from minute sample amounts.
`The significance of using minute sample amounts is that
`the responsiveness of samples to temperature variation may
`50 be improved, and therefore that in reactions involving sub(cid:173)
`stances which undergo temperature-dependent phase transi(cid:173)
`tions and have been difficult to measure according to the
`prior art ... for example, reactions involving intercalatory
`fluorescent pigments and nucleic acids, reactions involving
`55 lipid bilayers and hydrophobic fluorescent probes, reactions
`involving proteins and fluorescent pigments, and reactions
`involving organic polymers and fluorescent pigments ... the
`measurement of rapid interactions between compounds
`which result from phase interactions due to temperature
`60 variations may be made by measuring the variation in the
`fluorescent properties thereof.
`Particularly, if an apparatus according to the present
`invention is used in a PCR in which an intercalatory pigment
`is added, and the fluorescence intensity is measured accord(cid:173)
`ing to a desired timing during each cycle, or the variation in
`the fluorescence is measured throughout each cycle, then it
`is possible to know the progress of nucleic acid
`
`Example 2
`
`Using the amplified sample from Example 1, continuous
`measurement was made of the fluorescence intensity at
`temperatures (94, 72, 55° C.) predetermined for the double(cid:173)
`stranded nucleic acid fragments (approximately 500 base
`pairs) and during a state of continuous variation of the
`temperature to each one, in the presence of an intercalatory
`fluorescent pigment.
`The resulting measurement of the variation in fluores(cid:173)
`cence was as shown in FIG. 4. In FIG. 4, the time is plotted
`on the horizontal axis, and the fluorescence intensity on the
`vertical axis.
`
`Example 3
`Of A-DNA which had been digested with EcoT14I, 1 µg
`was suspended in 25 µl of a buffer solution (50 mM of NaCl,
`1 µg/ml of intercalatory fluorescent pigment (33258, product
`of Hoechst AG), 10 mM of Tris-HCl, pH 8.5), the suspen(cid:173)
`sion was placed in a 25 ul microcentrifuge tube (pro