United States Patent [19J
`Boss et al.
`
`[11] Patent Number:
`[45] Date of Patent:
`
`4,816,397
`Mar. 28, 1989
`
`[75]
`
`[54] MULTICHAIN POLYPEPTIDES OR
`PROTEINS AND PROCESSES FOR THEIR
`PRODUCTION
`Inventors: Michael A. Boss, Slough; John H.
`Kenten; John S. Emtage, both of
`High Wycombe; CliveR. Wood,
`Near Fordingbridge, all of United
`Kingdom
`[73] Assignee: Celltech, Limited, Slough, United
`Kingdom
`672,265
`
`[21] Appl. No.:
`Mar. 23, 1984
`[22] PCT Filed:
`PCT/GB84/00094
`[86] PCT No.:
`§ 371 Date:
`Nov. 14, 1984
`§ 102(e) Date:
`Nov. 14, 1984
`[87] PCT Pub. No.:
`W084/03712
`PCT Pub. Date: Sep. 27, 1984
`Foreign Application Priority Data
`[30]
`Mar. 25, 1983 [GB] United Kingdom ................. 8308235
`[51]
`Int. 0,4 ...................... C12P 21/00; C12N 15/00;
`C12N 1!00; C12N 1/20
`[52] u.s. a .................................... 435/68; 435/172.3;
`435/243; 435/255; 435/320; 435/252.31;
`435/252.33
`[58] Field or Search ...................... 435/68, 172.3, 243,
`435/320, 253, 255
`
`[56]
`
`References Cited
`U.S. PATENT DOCUMENTS
`4,403,036 9/1983 Hartley et at. ........................ 435/68
`4,642,334 2/1987 Moore et al .......................... 435/68
`
`FOREIGN PATENT DOCUMENTS
`037723 10/1981 European Pat. Off ..
`
`041313 1211981 European Pat. Off ..
`041767 12!1981 European Pat. Off. .
`055945 7/1982 European Pat. Off ..
`075444 3/1983 European Pat. Off •.
`088994 9/1983 European Pat. Off ..
`0125023 11/1984 European Pat. Off ..
`
`OTHER PUBLICATIONS
`Adams et a!., Biochemistry, vol. 19, pp. 2711-2719,
`1980.
`Haley eta!., DNA, vol. 1, pp. 155-162, 1982.
`Gough et a!., Biochemistry, vol. 19, pp. 2702-2710,
`1980.
`Iserentant et al., Gene, vol. 9, pp. 1-12, 1980.
`Seidman et a!: "Immunoglobulin light-chain structural
`gene sequences cloned in a bacterial plasmid," Nature,
`vol. 271, pp. 582-585, 1978.
`Primary Examiner-Blonde! Hazel
`Attorney, Agent, or Firm...,-Cushman,. Darby & Cushman
`[57]
`ABSTRACT
`Multichain polypeptides or proteins and processes for
`their production in cells of host organisms which have
`been transformed by recombinant DNA techniques.
`According to a first aspect of the present invention,
`there is provided a process for producing a heterolo(cid:173)
`gous multichain polypeptide or protein in a single host
`cell, which comprises transforming the host cell with
`DNA sequences coding for each of the polypeptide
`chains and expressing said polypeptide chains in said
`transformed host cell. According to another aspect of
`the present invention there is provided as a product of
`recombinant DNA technology an Ig heavy or light
`chain or fragment thereof having an intact variable
`domain. The invention also provides a process for in(cid:173)
`creasing the level of protein expression in a transformed
`host cell and vectors and transformed host cells for use
`in the processes.
`
`18 Claims, 13 Drawing Sheets
`
`Sanofi/Regeneron Ex. 1012, pg 407
`
`Merck Ex. 1012, pg 433
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet I of 13
`
`4,816~97
`
`CH3
`
`CH4
`
`FIG. 1
`
`C terminus
`
`Sanofi/Regeneron Ex. 1012, pg 408
`
`Merck Ex. 1012, pg 434
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 2 of 13
`
`4,816~97
`
`A.
`
`Hf 7~ ~c~ac Hl3 pAT>- 1-15
`prel T
`2
`
`1.H+Sac ! 1.H3 CIP
`
`21SOLATE1
`
`2.Sac partial
`I
`,eci•H3
`3.Isolate 2
`-~T GAT~GI:KJjCTGTTGTG
`AATC_1 - _2_ -
`--
`.J?lQrACTAG
`CCGACAACACTGAGTCCTIA G-
`---
`pCT 54
`R44
`pCT 54.
`
`pCT 54.19-1
`B. pCT 54.19-1 MmGTATCGATTGATCA&G
`pNP3
`AAGGGTA
`TTGATCAA_N
`pNP4.
`AAGGGT
`TTGATCAATG
`
`Legend.
`
`E = E corRI
`H = Hinfl
`H3=
`Hind III
`
`FIG. 2
`
`Sanofi/Regeneron Ex. 1012, pg 409
`
`Merck Ex. 1012, pg 435
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 3 of 13
`
`(A)pcDNA f11 ~ Afi
`~ : 450
`
`I
`
`(8)
`
`B~m HI
`600
`420
`1·4kb Pst fragment
`
`4,816,397
`:1'
`
`Pjl
`
`1
`
`O
`
`I 400 • (tp)
`
`a
`
`val
`
`Bam HI
`
`FIG. 3
`
`Sanofi/Regeneron Ex. 1012, pg 410
`
`Merck Ex. 1012, pg 436
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 4 of 13
`
`4,816,397
`
`Possible 2° structures of ~ m RNAs
`
`s!-3'
`
`pNP9.
`
`pNP11.
`
`u c
`U A
`G G
`G=C
`A=U
`~G
`AAGGGUAUGAU~~GCAGC-
`~~
`Ai:~
`C•G
`G::aC
`U=A
`- AAGGUAU =ACUGCAGCAGC-
`
`pNP12
`
`uc
`U A
`G G
`G=C
`-c
`= AGCAG C-
`
`JA:~
`
`- AACiGUAUUGCACA
`
`6. G = 1·6 K.cal.
`11·0 ru)
`
`dG=7·8 K cal.
`!6-9ru I
`
`6.G= 7-6 K cal.
`!1-8ru)
`
`pNP14.
`
`(101-2 ru)
`
`-~GUAUGAUCA~AGUGCAACUGCAG
`
`FIG. 4
`
`Sanofi/Regeneron Ex. 1012, pg 411
`
`Merck Ex. 1012, pg 437
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 5 of13
`
`4,816,397
`
`Bgl It
`
`Bgl II
`
`Pstl
`
`ll !Cia I S1 blunt
`IEcoRY
`
`Oli onucleolides
`
`ligate
`
`Bglll
`s'
`P/0 c=1
`I )J
`1 - - · -i~f-"--11 ~
`Bgl n
`Pst
`EcoR:!l
`
`Pst
`
`P/0
`.......-.l.-___ _
`
`Bglll
`Bam
`
`Sal I
`
`FIG. 5
`
`Sanofi/Regeneron Ex. 1012, pg 412
`
`Merck Ex. 1012, pg 438
`
`

`
`U.S. Patent Mar. 28,1989
`
`Sheet 6 of 13
`
`4,816,397
`
`.• ·.··· .... ·-
`
`'····.····
`
`•
`
`~
`12 3 45 6 7 8
`
`FIG. 6
`
`Sanofi/Regeneron Ex. 1012, pg 413
`
`Merck Ex. 1012, pg 439
`
`

`
`U.S. Patent Mar.28,1989
`
`Sheet 7 of 13
`
`4,816;397
`
`1 2 3 4 s a z a·
`
`94-
`
`67-
`mu~
`
`43--
`
`FIG. 7
`
`Sanoti!Regeneron E
`X. 1012, pg 414
`
`Merck Ex. 1012, pg 440
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 8 of13
`
`4,816,397
`
`-·---..
`
`2 3 4 5
`
`FIG. 8
`
`Sanofi/Regeneron Ex. 1012, pg 415
`
`Merck Ex. 1012, pg 441
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 9 of13
`
`4,816,397
`
`,.
`
`- - _, - -- :....; -~ - • _.,. -----
`
`1 2 3 4 5 6 7 8 9 10
`
`FIG. 9
`
`Sanofi/Regeneron Ex. 1012, pg 416
`
`Merck Ex. 1012, pg 442
`
`

`
`U.S. Patent Mar. 28, 1989
`
`Sheet 10 of 13
`
`4,816,397
`
`FIG. 10
`
`Sanofi/Regeneron Ex. 1012, pg 417
`
`Merck Ex. 1012, pg 443
`
`

`
`U.S. Patent Mar.28, 1989
`
`Sheet 11 of 13
`
`4,816,397
`
`0·2
`
`-<
`Ill
`::;
`UJ
`<I(
`"'
`c;
`m
`·-o-1
`0. e
`I
`c;
`Cl
`0
`_U'I..,.
`1.1
`~<11'1
`zm< --
`II
`
`............
`
`0
`
`10
`
`2 - I
`sJ
`- 1:71
`e g
`e
`60'1
`::l..
`1 .5
`c:
`Ill
`Cl>
`...
`0
`4-6
`c.
`>
`·s
`0
`Z"
`:§
`2:l:
`~
`
`20
`
`26
`
`28
`30
`FRACTIONS
`
`32
`
`0
`
`0
`
`36
`
`FIG. 11
`
`Sanofi/Regeneron Ex. 1012, pg 418
`
`Merck Ex. 1012, pg 444
`
`

`
`U.S. Patent
`
`Mar.28,1989
`
`Sheet 12 of 13
`
`4,816,397
`
`NIP-cap-BSA binding activity
`from:
`fraction 26 ( A ), purifiltd
`lg }JandA ( Cl) and 81-8( o ).
`Binding in the presence of
`30uM NIP-cap("*' ,•, e,
`respectively l
`
`0·3
`
`0·2
`o(
`!a
`~ w
`.:
`E
`c:
`0
`'>#
`
`ltl "" 0·1
`
`Serial dilution 1:1
`
`FIG. 12
`
`Sanofi/Regeneron Ex. 1012, pg 419
`
`Merck Ex. 1012, pg 445
`
`

`
`U.S. Patent Mar.28,1989
`
`Sheet 13 of 13
`
`4,816,397
`
`o~~--------~~----------~~~~~---r~------
`10-a
`1~7
`hapten concentrution (t-4)
`
`Binding of antibodies to NIP-cap BSA
`81-8 lgM ( • ), fraction 26 (,. );
`purified lg }J or>.. ( • >. in the presence
`of free NIP-cap(----) or NIP-cap(-).
`
`FIG. 13
`
`Sanofi/Regeneron Ex. 1012, pg 420
`
`Merck Ex. 1012, pg 446
`
`

`
`1
`
`4,816,397
`
`MULTICHAIN POLYPEPTIDES OR PROTEINS
`AND PROCESSES FOR THEIR PRODUCIION
`
`This invention relates to multichain polypeptides or
`proteins and processes for their production in cells of
`host organisms which have been transformed by recom(cid:173)
`binant DNA techniques.
`In recent years advances in molecular biology based
`on recombinant DNA techniques have provided pro- 10
`cesses for the production of heterologous (foreign)
`polypeptides or proteins in host cells which have been
`transformed with heterologous DNA sequences which
`code for the production of these products.
`Theoretically, the recombinant DNA approach may 15
`be applied to the production of any heterologous poly(cid:173)
`peptide or protein in a suitable host cell, provided that
`appropriate DNA coding sequences can be identified
`and used to transform the host cell. In practice, when
`the recombinant DNA approach was first applied to the 20
`production of commercially useful products, its applica(cid:173)
`tion for the production of any specified polypeptide or
`protein presented particular problems and difficulties,
`and the success of applying this approach to the produc(cid:173)
`tion of any particular polypeptide or product was not 25
`readily predictable.
`However, a large number of heterologous single
`chain polypeptides or proteins have now been produced
`by host cells transformed by recombinant DNA tech(cid:173)
`niques. Examples of such heterologous single chain 30
`polypeptides or proteins include human interferons, the
`A and B chains of human insulin, human and bovine
`growth hormone, somatostatin, calf prochymosin and
`urokinase. Such transformed host cells provide a repro(cid:173)
`ducible supply of authentic heterologous polypeptiede 35
`or protein which may be produced on an industrial scale
`using industrial fermentation technology.
`It should be pointed out that some of these polypep(cid:173)
`tides, for instance urokinase, after secretion by a host
`cell appear as two chain molecules. However, in such 40
`cases, the molecule is synthesised by the host cell as a
`single chain polypeptide, coded for by a single DNA
`sequence, which is cleaved in the host cell subsequent to
`synthesis to form the two chain structure.
`It is known that in both human and animal systems 45
`there are a number of polypeptides or proteins which
`have multichain structure in which the chains are not
`derived from the cleavage of a single chain polypeptide
`coded for by a single DNA sequence. In such cases, the
`gene for each of the chains may be located at different 50
`points on the same chromosome or even on different
`chromosomes. In these cases, the polypeptide chains are
`synthesised separately and then assembled into the com(cid:173)
`plete molecule subsequent to synthesis. Heretofore, no
`such multichain polypeptide or protein has been pro- 55
`duced by recombinant DNA techniques from a single
`host cell.
`A particular example of a class of such multichain
`polypeptides or proteins is the immunoglobulins.
`Immunoglobulins, commonly referred to as antibod- 60
`ies, are protein molecules produced in animals by B(cid:173)
`lymphocyte cells in response to challenge with foreign
`antigenic agents, such as bacteria, viruses and foreign
`proteins. The immunoglobulins comprise a crucial part
`of the immune systems of humans and animals. The 65
`immunoglobulins recognise specific parts of the foreign
`agents and bind onto them. The specific parts are usu(cid:173)
`ally known as antigenic determinants or antibody bind-
`
`2
`ing sites. A given foreign agent is likely to have a num(cid:173)
`ber of different antigenic determinants.
`A typical immunoglobulin (Ig) molecule is shown in
`FIG. 1 of the accompanying drawings, to which refer(cid:173)
`ence is now made. The Ig molecule comprises two
`identical polypeptide chains of about 600 amino acid
`residues (usually referred to as the heavy chains H),
`disulphide bonded to each other, and two identical
`shorter polypeptide chains of about 220 amino acid
`residues (usually referred to as the light chains L), each
`light chain being disulphide bonded to one end of each
`heavy chain as shown.
`When the Ig molecule is correctly folded, each chain
`is formed into a number of distinct globular areas, usu(cid:173)
`ally known as domains, joined by a more linear poly(cid:173)
`peptide chain. The light chains have two such domains,
`one of which is of variable sequence V L, and the other
`of which is of constant sequence CD The heavy chains
`have a single variable domain V H adjacent the variable
`domain V L of the light chain, and three or four constant
`domains Cm-3 or 4 .
`The variable domains on both the heavy and the light
`chains each contain
`three hypervariable regions
`(HVl-3) which, when the Ig molecule is correctly
`folded, are located adjacent one another and form the
`antigen binding site. It is this area which recognises and
`binds to the antigenic determinant for which the Ig
`molecule is specific.
`The constant domains of the lg molecule do not take
`part in the binding to the antigenic determinant, but
`mediate the actions triggered by the binding of the lg
`molecule to the antigenic determinant. It is believed
`that this triggering is caused by an allosteric effect in(cid:173)
`duced by the binding of the lg molecule to the antigenic
`determinant. The constant domain may enable the lg
`molecule to fix complement or may cause mast cells to
`release histamine.
`Ig's may be categorised by class or subclass, depend(cid:173)
`ing on which of a number of possible heavy chain con(cid:173)
`stant domains they contain, there being eight such possi(cid:173)
`ble heavy chains in mice. Thus, for instance, and Ig
`molecule with a 1.1. heavy chain belongs to the class lgM,
`and one with a 'Yl heavy chain to the class lgGt.
`Ig's may also contain one of two light chains, desig(cid:173)
`nated as K and ll. light chains, which have different
`constant domains and different sets of variable domains.
`The structure of the lg molecule and the location of
`the genes coding for the various domains thereof are
`discussed more fully by Early· and Hood, in Genetic
`Engineering, Principles and Methods, Vol. 3, pages
`153-158 (edited by Setlow and Hollaender, Plenum
`Press).
`It is known that Ig molecules on digestion with se(cid:173)
`lected enzymes can produce a number of immunologi(cid:173)
`cally functional fragments. Two such fragments are
`known as the Fab and (Fab'h fragments. The Fab frag(cid:173)
`ment comprises one light chain linked to the V H and
`Cm domains of a heavy chain as shown in FIG. 1. The
`(F ab')l fragment consists essentially of two F ab frag(cid:173)
`ments linked together by a small additional portion of
`the heavy chains as shown in FIG. 1. These fragments
`and other similar fragments can be of use in various tests
`and diagnostic and medical methods.
`The principle method employed for the production of
`lg's involves the immunisation of susceptible animals
`with the antigenic agent to provide an immune reaction.
`Generally the animal is immunised a second time to
`
`Sanofi/Regeneron Ex. 1012, pg 421
`
`Merck Ex. 1012, pg 447
`
`

`
`4,816,397
`
`20
`
`3
`improve the yield of I g. The animal is then bled and the
`Ig is recovered from the serum.
`However, the product of this method is not a homo(cid:173)
`geneous protein. The animal will produce Ig of differ(cid:173)
`ent classes and also Ig specific for each of the different
`antigenic determinants on the antigenic agent, and its
`blood will therefore contain a heterogeneous mixture of
`Ig's. Obtaining a specific Ig of particular class and de(cid:173)
`sired specificity from such a mixture requires very diffi(cid:173)
`cult and tedious purification procedures.
`Recently, it has become possible to produce a homo(cid:173)
`geneous Ig of a single class and a single specificity by a
`technique first described by Kohler and Milstein (Na(cid:173)
`ture, 256, 495-479, 1975). The technique involves the
`fusion of single Ig-producing parent cells with cancer 15
`cells to produce a monoclonal hybridoma cell which
`produces the Ig. Ig produced by this technique is usu(cid:173)
`ally known as monoclonal antibody. The nature of the
`monoclonal Ig is determined by the class and specificity
`of the Ig produced by the parent cell.
`Recently attempts have been made to use recombi(cid:173)
`nant DNA techniques to produce fragments of lg mole(cid:173)
`cules. For instance, Amster et al. (Nucleic Acid Re(cid:173)
`search, 8, No. 9, 1980, pp 2055 to 2065) disclose the
`cloning of double stranded eDNA sequences encoding 25
`for a mouse Ig light chain into a plasmid. An E. Coli
`strain transformed by the plasmid synthesised a protein
`thought to comprise the complete constant domain of
`the light chain and about 40 amino acid residues of its
`variable region.
`Kemp and Cowman (Proc. Nat!. Acad. Sci. USA, 78,
`1981 , pp 4520 to 4524) disclose the cloning of eDNA
`sequences encoding for mouse heavy chain fragments
`and the transforming of an E. Coli strain which then
`synthesised heavy chain polypeptide fragments.
`In both these cases, the polypeptides were produced
`as fusion proteins, in which the fragments of the Ig
`polypeptides were fused with additional non-Ig poly(cid:173)
`peptide sequences, and the incomplete variable do(cid:173)
`mains. Thus, the polypeptide chains produced in these 40
`studies were not immunologically functional polypep(cid:173)
`tides as they were incapable of combining with comple(cid:173)
`mentary heavy or light chains to provide Ig molecules
`having intact antigen binding sites and immunological
`function.
`Research studies have also been carried out in mam(cid:173)
`malian systems. For instance, Falkner and Zachau (Na(cid:173)
`ture, 298, 1982, pp 286 to 288) report the cloning of
`eDNA sequences encoding for mouse light chains into
`a plasmid which was used to transfect genomic eukary- 50
`otic cells which could then transiently synthesise light
`chains.
`Rice and Baltimore (Proc. Nat!. Acad. Sci. USA, 79,
`1982, pp 7862 to 7865) report on the transfection of a
`functionally rearranged K light chain Ig gene into a 55
`murine leukemia virus-transformed lymphoid cell line.
`The cell line is then able to express the gene continu(cid:173)
`ously. In both these cases, the K genes used to transfect
`the mammalian cells were obtained from myeloma cells
`and the K polypeptides produced were of indeterminate 60
`immunological function.
`A further approach is exemplified in a series of papers
`by Valle eta!. (Nature, 291, 1981, 338-340; Nature, 300,
`1982, 71-74and J. Mol. Bioi., 160, 1982, 459-474),
`which describe the microinjection of mRNAs encoding 65
`for heavy or light chains of Ig isolated from a mouse
`myeloma line into oocytes of Xenopus laevis. Under
`certain conditions complete Ig molecules were formed.
`
`4
`However, the mRNAs were obtained from myeloma
`cells and the lg molecules were of indeterminate immu(cid:173)
`nological function.
`It can thus be seen that hitherto it has not been possi(cid:173)
`ble to produce functional Ig by recombinant DNA
`technology.
`According to a first aspect of the present invention,
`there is provided a process for producing a heterolo(cid:173)
`gous multichain polypeptide or protein in a single host
`10 cell, which comprises transforming the host cell with
`DNA sequences coding for each of the polypeptide
`chains and expressing said polypeptide chains in said
`transformed host cell.
`According to a second aspect of the present inven(cid:173)
`tion, there is provided a heterologous multichain poly(cid:173)
`peptide or protein produced by recombinant DNA
`technology from a single host cell.
`The present invention is of particular, but not exclu(cid:173)
`sive, application in the production of Ig molecules and
`immunologically functional Ig fragments of the type
`referred to above. However, it will be appreciated that
`the present invention can be applied to the production
`of other multichain polypeptides or proteins.
`In relation to the product of Ig molecules according
`to the invention it will be appreciated that, in order to
`produce a functional molecule, the DNA sequences
`used to transform the host cell will need to encode for
`at least the V L and V H domains of an Ig molecule.
`Moreover, these domains will need to be complemen(cid:173)
`tary so that when the two polypeptide chains fold to(cid:173)
`gether they form an antigen binding site of predeter(cid:173)
`mined specificity.
`Preferably, the Ig molecule or fragment include a
`complete light chain and at least the CHI domain in
`addition to the V H domain of the heavy chain. Most
`preferably the Ig molecule is intact.
`It has also been shown by the present applicants that
`it is now possible to produce individual heavy and light
`chains having intact variable domains. This has not
`previously been possible. Therefore, according to a
`third aspect of the present invention there is provided as
`a product of recombinant DNA technology an Ig heavy
`or light chain or fragment thereof having an intact vari(cid:173)
`able domain.
`Advantageously, the Ig molecule or functional frag(cid:173)
`ment thereof according to the present invention has a
`variable region (formed by the V L and V H domains)
`which defines a binding site for an antigenic determi(cid:173)
`nant of clinical or industrial importance. The DNA
`coding sequences necessary to produce such a molecule
`may be derived from naturally occuring or· hybridoma
`(monoclonal)Ig-producing cells with the desired speci(cid:173)
`ficity.
`The constant domains of the Ig molecule or fragment,
`if present, may be derived from the same cell line as the
`variable region. However, the constant domains may be
`specifically altered, partially or completely omitted, or
`derived from a cell line producing a different class of Ig
`to provide Ig molecules or fragments having desired
`properties.
`For example, an Ig molecule may be produced hav-
`ing variable domains (V H and V L) idential with those
`from a monoclonal antibody having a desired specific(cid:173)
`ity, and constant domain(s) from a different monoclonal
`antibody having desired properties, for instance to pro-
`vide human compatibility or to provide a complement
`binding site.
`
`30
`
`35
`
`45
`
`Sanofi/Regeneron Ex. 1012, pg 422
`
`Merck Ex. 1012, pg 448
`
`

`
`4,816,397
`
`5
`Such alterations in the amino acid sequence of the
`constant domains may be achieved by suitable mutation
`or partial synthesis and replacement or partial or com(cid:173)
`plete substitution of appropriate regions of the corre(cid:173)
`sponding DNA coding sequences. Substitute constant 5
`domain portions may be obtained from compatible re(cid:173)
`combinant DNA sequences.
`The invention may be utilised for the production of
`lg molecules or fragments useful for immunopurifica(cid:173)
`tion, immunoassays, cytochemical labelling and target- 10
`ting methods, and methods of diagnosis or therapy. For
`example, the Ig molecule or fragment may bind to a
`therapeutically active protein such as interferon or a
`blood clotting factor, for example Factor VIII, and may
`therefore be used to produce an affinity chromatorgra- 15
`phy medium for use in the immunopurification or assay
`of the protein.
`It is also envisaged that the Ig molecule may be syn(cid:173)
`thesised by a host cell with another peptide moiety
`attached to one of its constant domains. Such a further 20
`peptide moiety may be cytotoxic or enzymatic. Alterna(cid:173)
`tively, the moiety may be useful in attaching the Ig
`molecule to a biological substrate, such a cell or tissue,
`or to a non-biological substrate, such as a chromatogra(cid:173)
`phy medium. Such a peptide moiety is herein referred to 25
`as a structural peptide moiety.
`It is further envisaged that cytotoxic, enzymic or
`structural peptide moieties could be attached to the lg
`molecule by normal peptide chemical methods, as are
`already known in the art, rather than by being synthe- 30
`sised with the lg molecule.
`The Ig molecule or fragment may also comprise a
`therapeutic agent in its own right. For instance, an Ig
`molecule or fragment specific for D blood group anti(cid:173)
`gen may be useful for the prevention of haemolytic 35
`disease of the new born.
`Any suitable recombinant DNA technique may be
`used in the production of the multichain polypeptides or
`proteins of the present invention. Typical expression
`vectors such as plasmids are constructed comprising 40
`DNA sequences coding for each of the chains of the
`polypeptide or protein.
`It will be appreciated that a single vector may be
`constructed which contains the DNA sequences coding
`for more than one of the chains. For instance, the DNA 45
`sequences coding for lg heavy and light chains may be
`inserted at different positions on the same plasmid.
`Alternatively, the DNA sequence coding for each
`chain may be inserted individually into a plasmid, thus
`producing a number of constructed plasmids, each cod- 50
`ing for a particular chain. Preferably the plasmids into
`which the sequences are inserted are compatible.
`The or each constructed plasmid is used to transform
`a host cell so that each host cell contains DNA sequen(cid:173)
`ces coding for each of the chains in the polypeptide or 55
`protein.
`Suitable expression vectors which may be use for
`cloning in bacterial systems include plasmids, such as
`Col El, peRI, pBR322, pACYC 184 and RP4, phage
`DNA or derivatives of any of these.
`For use in cloning in yeast systems, suitable expres(cid:173)
`sion vectors include plasmids based on a 2 micron ori(cid:173)
`gin.
`Any plasmid containing an appropriate mammalian
`gene promoter sequence may be used for cloning in 65
`mammalian systems. Such vectors include plasmids
`derived from, for instance, pBR322, bovine papilloma
`virus, retroviruses, DNA viruses and vaccinia viruses.
`
`60
`
`6
`Suitable host cells which may be used for expression
`of the heterologous multichain polypeptide or protein
`include bacteria, such as E. coli and B. subtilis, Strepto(cid:173)
`myces, yeasts, such as S. cervisiae, and eukaryotic cells,
`such as insect or mammalian cell lines. Examples of
`suitable bacterial host cells include E. Coli HB 101, E.
`ColiXl776,E. Co/iX2882,R ColiPS410,E; ColiMRC
`I, E. Coli RV308, E. Coli E103S and E. Coli B.
`The present invention also includes constructed ex(cid:173)
`pression vectors and transformed host cells for use in
`producing the multichain polypeptides or proteins of
`the present invention.
`After expression of the individual chains in the same
`host cell, they may be recovered to provide the com(cid:173)
`plete multichain polypeptide or protein in active form,
`for instance to provide an Ig molecule of predetermined
`immunological function.
`It is envisaged that in preferred forms of the inven(cid:173)
`tion, the individual chains will be processed by the host
`cell to form the complete polypeptide or protein which
`advantageously is secreted therefrom.
`However, it may be that the individual chains may be
`produced in insoluble or membrane-bound form. It may
`therefore be necessary to solubilise the individual chains
`and allow the chains to refold in solution to form the
`active multichain polypeptide or protein. A suitable
`procedure for solubilising polypeptide chains expressed
`in insoluble or membrane-bound form is disclosed in our
`copending application No. (Protein Recovery, Agent's
`Ref. GF 402120 and 402121).
`It will be appreciated that the present application
`shows for the first time that it is possible to transform a
`host cell so that it can express two or more separate
`polypeptides which may be assembled to form a com(cid:173)
`plete multichain polypeptide or protein. There is no
`disclosure or suggestion of the present invention in the
`prior art, which relates solely to the production of a
`single chain heterologous polypeptide or protein from
`each host cell.
`The present invention will now be described, by way
`of example only, with reference to the accompanying
`drawings, in which:
`FIG. 1. shows a diagrammatic representation of a
`typical intact Ig molecule;
`FIG. 2 shows the construction of plasmids for the
`direct synthesis of a A. light chain in E. Coli;
`FIG. 3 shows the construction of plasmids for the
`direct synthesis of a p. heavy chain in E. Coli;
`FIG. 4 is a diagrammatic representation of p.mRNA
`sequences around the initiation codon;
`FIG. 5 shows the construction of plasmids having
`altered secondary structure around the initiation codon;
`FIG. 6 is a polyacrylamide gel showing expression
`and distribution of p. protein from E. Coli B;
`FIG. 7 is a polyacrylamide gel showing pulse chase
`autoradiograms of p. protein in E. Coli B and in R Coli
`HBlOl;
`FIG. 8 is a polyacrylamide gel showing the results of
`A. gene expression in E. Coli;
`FIG. 9 is a polyacrylamide gel showing the distribu(cid:173)
`tion of recombinant A. light chain polypeptide between
`the soluble and insoluble cell fractions;
`FIG. 10 is a polyacrylamide gel showing expression
`and distribution of A. protein from E. Coli El03S;
`FIG. 11 shows the results of the fracitonation of p.
`and A. protein expressed by E. Coli B on DEAE Sepha(cid:173)
`cel;
`
`Sanofi/Regeneron Ex. 1012, pg 423
`
`Merck Ex. 1012, pg 449
`
`

`
`4,816,397
`
`8
`well as Bell and Hinfl sticky ends. The two chemically
`synthesised oligonucleotides made to facilitate assembly
`of the gene had the sequences:
`
`R45 5'-pGATCAATGCAGGCTGTTGTG 3'
`
`R44 3' CCGACAACACTGAGTCCTTAp· 5'
`
`7
`FIG. 12 shows the specific hapten binding of recon(cid:173)
`stituted lg molecules; and
`FIG. 13 shows the heteroclitic nature of the hapten
`binding of the reconstituted lg molecules.
`In the following examples, there is described the
`production of Ig light and heavy chain polypeptides
`derived from monoclonal antibodies which recognise
`and bind to the antigenic determinant 4-hydroxy-3-
`nitrophenyl acetyl (NP), using E. coli and S. cerevisiae as
`the host cells Recombinant DNA techniques were used 10
`to enable the host ceUs to express both the polypeptide
`chains.
`It will be appreciated that the invention is not limited
`to the specific methods and construction described
`hereafter.
`
`pCT54 was cut with both Bell and Hindlll and the
`resulting linear molecules isolated, mixed together with
`the two oligodeoxyribonucleotide linkers R44 and R45
`and both fragments 1 and 2, and ligated using T4 ligase
`(FIG. 2). The mixture was used to transform E. coli
`DHl to ampicillin resistance. Recombinant clones in
`15 pCT54 were identified by hybridisation of DNA from
`replica plated colonies on nitrocellulose to a nick-tran(cid:173)
`slated probe derived from the pAT;>,. 1-15 insert.
`A clone was identified which hybridised to lambda
`eDNA and also showed the predicted restriction frag(cid:173)
`ment pattern. This plasmid (designated pCT54 19-1)
`was sequenced from the Clal site and shown to have the
`anticipated sequence except that there was a mutation
`of the fourth codon from CTG to A TG, changing the
`amino acid at this point from valine the methionine.
`The sequence in this area was:
`
`Construction of Lambda Light Chain Expression
`Plasmid
`FIG. 2, to which reference is now made, shows sche(cid:173)
`matically the method used to construct a :\. light chain 20
`expression plasmid.
`It was decided to express the lambda gene in E. coli
`by direct expression of the gene lacking the eucaryotic
`signal peptide but containing a methionine initiator
`residue at the amino-terminus (met-lambda). The ap-
`
`..• GATTGATCA.ATG.CAG.GCT.GTT.ATG.ACT.CAG.GAA.TCT.GCA.CTC.ACC.ACA.TCA
`ala
`val met
`thr gin
`glu
`ser
`ala
`leu
`thr
`thr
`ser
`met gln
`
`40
`
`preach used for bacterial synthesis of met-lambda was 30
`to reconstruct the gene in vitro from restriction frag(cid:173)
`ments of a eDNA clone and to utilise synthetic DNA
`fragments for insertion into the bacterial plasmid pCT54
`(Emtage eta!., proc. Nat!. Acad. Sci. USA., 80, 3671 to
`3675, 1983). This vector contains the E. coli trp pro- 35
`mater, operator and leader ribosome binding site; in
`addition 14 nucleotides downstream of the ribosome
`binding site is an initiator A TG followed immediately
`by EcoR1 and Hindlll sites and the terminator for E.
`coli RNA polymerase from bacteriophage T7.
`As a source of light chain we used a plasmid pABA-
`1-15 which contains a full-length :\.1light chain eDNA
`cloned into the Pstl site of pBR322. This :\.1 light chain
`is derived from a monoclonal antibody, designated S43,
`which binds to 4-hydroxy-3-nitrophenylacetyl (NP) 45
`hap tens.
`In order to create a Hindlll site 3' to the end of the
`lambda gene for insertion into the Hindlll site of
`pCT54, the eDNA was excised from pAB ;>,. 1-15 using
`Pstl. The cohesive ends were blunt ended using the 50
`Klenow fragment of DNA polymerase and synthetic
`Hindlll
`linker molecules
`of
`sequence
`5'(cid:173)
`CCAAGCTTGG-3' ligated. The DNA was digested
`with Hindiii and the 850bp lambda gene isolated by gel
`electrophoresis and cloned into Hindlll cut pAT153 to 55
`yield plasmid pAT :\. 1-15. The 3' end of the lambda
`gene was isolated from pAT ;>,. 1-15 by Hindiii plus
`partial Sac! digestion as a 630bp Sacl-Hindlll fragment
`(2 in FIG. 2). The Hindlll cohesive end was dephos(cid:173)
`phorylated by calf intestinal alkaline phosphatase dur- 60
`ing isolation of the fragment to prevent unwanted liga(cid:173)
`tions at this end in subsequent reactions.
`A Hinfl restriction site is located between codons 7
`and 8 and the lambda sequence. The 5' end of the
`lambda gene was isolated as a 148bp Hinfl to sacl frag- 65
`ment (1 in FIG. 2).
`Two· oligodeoxyribonucleotides were designed to
`restore condons 1-8, and to provide an initiator A TG as
`
`The restriction enzyme sites in pCT54 between the
`Shine and Dalgamo sequence (AAGG), which is im(cid:173)
`portant for ribosome binding, and the A TG allow for
`the adjustment of the SD-A TG distance, an important
`parameter in determining expression rates. The SD(cid:173)
`A TG distance was reduced by cutting the plasmid with
`Clal or