`Vol. 86, pp. 607-611, January 1989
`Immunology
`
`Three-dimensional structure of Fab R19.9, a monoclonal murine
`antibody specific for the p-azobenzenearsonate group
`M.-B. LASCOMBE*, P. M. ALZARI*, G. BOULOT*, P. SALUDJIAN*, P. TOUGARD*, C. BEREKt, S. HABAt,
`E. M. ROSENt, A. NISONOFFt, AND R. J. POLJAK*§
`*DNpartement d'Immunologie, Institut Pasteur, 75015 Paris, France; tInstitute of Genetics, University of Cologne, Cologne 41, Federal Republic of Germany;
`and tRosenstiel Research Center, Department of Biology, Brandeis University, Waltham, MA 02254
`Contributed by A. Nisonoff, August 8, 1988
`
`ABSTRACT
`The crystal structure of Fab R19.9, derived
`from an anti-p-azobenzenearsonate monoclonal antibody, has
`been determined and refined to 2.8-A resolution by x-ray
`crystallographic techniques. Monoclonal antibody R19.9
`(IgG2bK) shares some idiotopes with a major idiotype (CRIA)
`associated with A/J anti-p-azobenzenearsonate antibodies.
`The amino acid sequences of the variable (V) parts of the heavy
`(VH) and light (VL) polypeptide chains of monoclonal antibody
`R19.9 were determined through nucleotide sequencing of their
`mRNAs. The VL region is very similar to that of CRIA-positive
`anti-p-azobenzenearsonate antibodies as is VH, except for its
`third complementarity-determining region, which is three
`amino acids longer; it makes a loop, unique to R19.9, that
`protrudes into the solvent. A large number of tyrosine residues
`in the complementarity-determining region of VH and VL, with
`their side chains pointing towards the solvent, may have an
`important function in antigen binding.
`
`Murine antibodies to model antigens have provided valuable
`experimental systems to study the molecular bases of the
`specificity, diversity, and genetic control of immune re-
`sponses. The hapten, p-azobenzenearsonate (Ar), has been
`used in several laboratories as a suitable probe for such studies
`(1-5), which have been facilitated by the presence of an
`intrastrain cross-reactive idiotype, designated CRIA, among
`the anti-Ar antibodies ofA/J mice or ofclosely related strains.
`The expression of CRIA is linked to genetic loci encoding
`heavy (H) chains (6) and light (L) chains (7). On the average,
`about half of the anti-Ar antibodies induced by keyhole limpet
`hemocyanin-Ar in A/J mice share this idiotype. The variable
`(V) regions, VH and VL, of CRIA antibodies appear to be
`encoded by single germ-line genes (8, 9), and the diversity (D)
`region is encoded by a variant of the DFL16.1 gene (10). CRIA
`molecules also utilize the VK10, K chain joining (J) 1, and,
`almost invariably, JH2 gene segments (4, 5, 11). Idiotype-
`expressing antibodies from hyperimmunized mice display
`somatic variants ofamino acid sequences in each ofthese gene
`segments (4, 5, 12), whereas the antibodies from an early
`primary response reflect few if any mutations (5). The VH
`region appears to be somewhat more susceptible to somatic
`variation than VL (4). A disproportionate number of mutations
`in VH and VL occurs in their complementarity-determining
`regions (CDR); this probably reflects selection by antigen of
`variants with higher affinity (5).
`Among the serum anti-Ar antibodies of immunized A/J
`mice are molecules that carry some but not all ofthe idiotopes
`associated with CRIA (13, 14). Such antibodies are bound by
`anti-CRIA antibodies, but they are unable to completely
`displace labeled CRI+ antibodies from such anti-idiotype
`antibodies. Antibodies of this type were designated "minor
`idiotypes" (13, 14). The subject of the present investigation,
`
`The publication costs of this article were defrayed in part by page charge
`payment. This article must therefore be hereby marked "advertisement"
`in accordance with 18 U.S.C. §1734 solely to indicate this fact.
`
`monoclonal antibody (mAb) R19.9 (IgG2bK), has these sero-
`logical properties and is thus a member of a minor idiotypic
`anti-Ar family. The L chains of R19.9, when combined with
`H chains of a CRI' mAb, yielded a CRI+ product (14).
`However, the converse recombinant (Hl9.9LcRI) was CRIA
`by the criterion of inhibition in the standard assay for CRIA.
`Amino acid sequences (this paper) indicate that the VK10, JK1,
`VH, and JH2 sequences of R19.9 are closely related to the
`putative germ-line sequences controlling CRIA but that the
`DH sequence (in CDR3 of VH) differs markedly; it is 3
`residues longer than the characteristic DH sequence (11 vs. 8
`residues). There are also three amino acid substitutions in
`CDR2 of VH that may contribute to the idiotypic variance of
`R19.9.
`The x-ray crystallographic study of Fab R19.9 presented
`here permits a correlation between amino acid sequences,
`idiotypic markers, and the three-dimensional structure of the
`A/J anti-Ar antibodies. Tentative conclusions can also be
`drawn about the conformation of the antigen-combining site
`of anti-Ar molecules.
`
`MATERIALS AND METHODS
`The monoclonal, A/J anti-Ar antibody R19.9 (IgG2bK) was
`prepared as described (15, 16). After papain digestion (17),
`the Fab fragment of R19.9 was extensively purified by three
`successive column chromatography steps with Sephadex
`G-100 (Pharmacia), DEAE-cellulose (0.76 milliequivalent per
`g; Serva, Heidelberg) equilibrated in 0.04 M potassium
`phosphate buffer, and PBE 94 (Pharmacia) for chromatofo-
`cusing. In this last step, the Fab was eluted with Polybuffer
`96 (Pharmacia) as a major peak at pH 7.5-7.6. The purified
`Fab of R19.9 was crystallized at room temperature by vapor
`diffusion in hanging drops (18) or in capillaries against 20%
`(wt/vol) PEG 8000 (Sigma)/0.2 M sodium chloride/3 mM
`sodium azide/0.1 M potassium phosphate, pH 7.3 (19). The
`crystals grow to a size of up to 0.3 mm x 0.4 mm x 1.5 mm.
`They are monoclinic, space group P21, with unit cell di-
`mensions a = 43.3 A, b = 80.8 A, c = 75.1 A, , = 960. There
`is one Fab in the asymmetric unit.
`X-ray intensity data were measured on a diffractometer
`with CuKa radiation. Since the crystals of Fab R19.9 are
`polymorphic (19), they were carefully selected to conform to
`the unit cell dimensions given above. Crystals were replaced
`with the intensities of reference reflections decreased below
`70% of their starting values. Integrated intensities were
`obtained by profile fitting (20) and were further corrected for
`Lorentz-polarization factors, absorption (21), and radiation
`decay. For the native crystals, a complete data set to 2.8-A
`
`Abbreviations: Ar, p-azobenzenearsonate; CRIA, major cross-
`reactive idiotype associated with anti-Ar antibodies of the A strain of
`mouse; H, heavy; L, light; V, variable; D, diversity; J, joining; C,
`constant; mAb, monoclonal antibody; CDR, complementarity-de-
`termining region.
`§To whom reprint requests should be addressed.
`
`607
`
`PETITIONER'S EXHIBITS
`
`Exhibit 1060 Page 1 of 5
`
`
`
`_ASA~~ --
`
`20
`S V K H
`
`30
`S C K A S G Y T F T S
`
`-
`
`-
`
`D- - -- -- -- --_ *_**
`
`__^_^
`
`Y G
`
`N
`
`I
`
`v
`
`0.349
`0.500
`0.465
`0.500
`0.469
`0.500
`IFobsi = 0.2%; number of
`
`hk I
`
`608
`
`Immunology: Lascombe et a!.
`
`Table 1.
`
`Crystallographic refinement of Fab R19.9
`Actual rms
`deviation, A
`
`0.011
`0.091
`0.085
`0.006
`
`Target or
`
`0.020
`0.060
`0.060
`0.020
`
`Parameter
`Deviation from ideal distances
`Bond distances
`Angle distances
`Planar 1-4 distances
`Deviation from planarity
`Deviation from permitted constant
`distances
`Single torsion contacts
`Multiple torsion contacts
`Possible hydrogen bond
`IIFobsI - IFca-iII/>ZJ
`R factor = »,1
`h k I
`structure factors F > 2o = 12,145.
`resolution was obtained from 26,284 measurements that were
`merged to yield the intensities of 13,138 independent reflec-
`tions (Rsym = 0.074). Three heavy atom derivatives were
`obtained by using phenylmercury(II) acetate, p-hydroxy-
`methylbenzenesulfonate, and OsCl6. Their intensities were
`measured to 3.5-A [phenylmercury(II) acetate and p-
`hydroxymethylbenzenesulfonate] and 6-A (OsCl6) resolu-
`tion. After refinement of heavy atom occupancies, scale
`factors, and thermal (isotropic) and positional parameters, an
`electron density map was calculated to 3.5-A resolution
`(average figure of merit, m = 0.52). The interpretation of this
`map was facilitated by a six-dimensional real space search by
`using the model ofFab New (22) as a search object. A rotation
`function calculation (23) gave a clear indication of the
`orientation of the Fab in the unit cell, in agreement with that
`found by the model search of the electron density map. The
`positions of the VH, VL, CHi, and CL domains were refined
`at 6-A resolution by a constrained-restrained least-squares
`procedure [CORELS (24)]. At this stage the agreement
`factor, R, between observed (obs) and calculated (calc)
`structure factors (F), R = I(Fobs - FcW1)/-(Fob), was 42%.
`A solvent-flattened (25) electron density map at 3.5-A reso-
`lution (m = 0.81, AO = 350) allowed the tracing of most of the
`
`10
`E V Q L Q Q S G A E L V R A G
`GAGGTTCAGCTTCAGCAGT
`
`A
`
`A_*_ _
`
`*_
`
`_
`
`A
`
`*_
`
`A------R
`N
`A
`
`S
`
`GERMLINE
`
`R19.9
`
`(
`
`not sequenced
`
`Proc. Natl. Acad. Sci. USA 86 (1989)
`
`polypeptide chain. The amino acid sequence of Fab R19.9
`was adjusted to the electron density map using the program
`FRODO (26) on a PS300 Evans and Sutherland interactive
`graphics system. The model was refined by the restrained
`least-squares program PROLSQ (27) by using reflections be-
`tween 10- and 2.8-A resolution. After 33 cycles of refinement
`(R = 32.4%), the model was partially rebuilt based on
`difference Fourier (2Fwca - Fobs, acwc) and "OMIT" (28)
`maps, as well as inspection of the solvent-flattened electron
`density map. The structure was further improved by alter-
`nating model building on difference Fourier and OMIT maps
`followed by PROLsQ refinement until reasonable convergence
`was achieved (see Table 1). The current R factor is 0.296. No
`attempt was made to place solvent molecules in the model.
`Sequencing ofpolysomal mRNA for VH and VK was carried
`out according to Griffiths and Milstein (29) by using primers
`described previously (30, 31).
`
`RESULTS
`The 3.5-A resolution electron density map described above
`was used to fit the amino acid sequences of the variable
`regions [VH, D, and JH2 and also VK and JK (see Figs. 1 and
`2)] and those of the constant regions, CH1 of IgG2b and CK
`(32). Since the sequence of VH was determined for residues
`16-123 only, the first 15 residues were assumed to be the
`same as those in protein 36-65, which expresses the germ-
`line-encoded VH sequence of CRIA (8). This choice seemed
`reasonable because the same VH germ-line gene is expressed
`in 36-65 and R19.9 and because in 11 published N-terminal
`sequences of CRI' mAbs there is a total of only seven amino
`acid substitutions in this region (33, 34). Although the
`electron density maps gave an indication for the trace of the
`polypeptide chain in CDR3 of VH, the detailed conformation
`of this region was less clear than that of other parts of Fab
`R19.9. VH positions 34, 55, 58, 59, and 74 differ from those
`of the germ-line VH gene; however, the electron density map
`showed good agreement with the experimentally determined
`VH sequence (Fig. 1) at those positions. Although the
`ambiguity (His/Asp) at VH position 105 cannot be resolved
`with certainty by the electron density map, aspartic acid
`---CDR 1---
`
`40
`V V K Q R P
`
`70
`50
`60
`G Q G L E V I G Y I N P G N G Y T K Y N L K F K G K T T L
`AAGTTCAGGGCAGACCACACTG
`L S
`K
`Or-GT-T
`
`G
`
`T V
`
`D K S
`
`S
`
`S
`
`T
`
`80
`A Y M Q L R S
`
`L T
`
`90
`S E D
`
`S A V Y
`
`98
`C A R
`
`F
`
`ACTGTAGACAMTCCTCCAGCACAGCCTACATGCAGCTCAGAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGA
`R
`
`GERMLINE
`
`R19.9
`
`GERMLINE
`
`R19.9
`
`36-65
`
`R19.9
`
`V
`S
`TCGGTC
`F
`
`-r-
`
`D segment
`S
`G G
`
`Y
`
`Y
`
`I
`
`H/D L A V
`-c
`C;.ACCTAGCCM
`
`_--
`
`Je2
`Y F D Y V G Q G T T L T V S
`S
`Y
`TACTACITTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCFCA
`s
`---c
`
`FIG. 1.
`Nucleotide and deduced amino acid sequences of the VH region of mAb R19.9. They are compared, between residues 1-98, with
`the VH germ-line sequence believed to encode CRIA molecules (8). The D and JH2 segments are compared with those of mAb 36-65, whose
`VH gene (codons 1-98) corresponds to that of an unmutated germ-line gene (8). A solid line represents identity with the prototype sequence.
`Amino acid substitutions are indicated above the nucleotide sequences. Gaps have been introduced in the D segment to maximize homology.
`
`PETITIONER'S EXHIBITS
`
`Exhibit 1060 Page 2 of 5
`
`
`
`Immunology: Lascombe et al.
`
`----c
`
`609
`
`Proc. Natl. Acad. Sci. USA 86 (1989)
`CDR 1-------------
`30
`20
`10
`S N T
`R V T
`I
`L N
`0
`G
`S
`D
`C
`S
`I
`R A
`Q D
`L
`S
`A
`S
`L
`S
`M
`I
`T T
`S
`D
`Q
`T
`GATATCCAGATGACACAGACTACATCCTCCcGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGcAGGGCAAGTCAGGACATTAGCTTAATrAAAC
`VK10
`R19.9 XC
`--------CDR 2-------
`60
`50
`40
`S G
`S
`G
`Y
`S
`T
`S
`R
`L
`B
`S
`G
`V
`P
`R
`F
`T V K
`L
`L
`I
`Y
`V
`Y
`Q
`Q K
`P
`D G
`TGGTATCAGCAGAAACCAGATGGAACTGTTACACTGATCTACTACACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGG
`I-x
`x
`x
`----------CDR 3--.------
`70
`80
`90
`Y F C O O G
`N
`T
`L
`P
`T
`S
`A
`I
`D
`E
`E
`L
`N
`0
`I
`L T
`G T
`S
`D
`S
`Y
`TCTGGAACAGArrATrCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTrrTGCCAACAGGGTAATACGCTTCCT
`S
`
`VK1O
`R19.9
`
`VK10
`R19.9
`
`JK1
`R19.9
`
`100
`T K L
`K
`I
`E
`G
`G
`F
`T
`G
`ACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA
`? R
`?
`
`vw
`
`lr
`
`R
`
`,---
`
`Nucleotide and deduced amino acid sequences ofthe VK region of mAb R19.9. Comparison is made with sequences ofthe VK1O-Ars-A
`FIG. 2.
`and JK1 genes that encode CRIU mAb (9). See legend to Fig. 1. ?, undetermined nucleotide.
`
`seems to be the best choice. Electron density features in VL
`positions 31, 55, and 107 correspond reasonably well with the
`amino acid sequence encoded by the VK10-Ars-A germ-line
`gene that encodes the VL region ofCRI' antibodies and to the
`JKl germ-line sequence (Fig. 2). At position 105, where an
`ambiguity in the nucleotide sequence is consistent with the
`presence of alanine, glutamic acid, glycine, or valine, the
`electron density map favors glutamic acid, in agreement with
`the germ-line JK1 sequence.
`The domain structure of Fab R19.9 closely follows that
`observed for all Fabs whose three-dimensional structure has
`been determined by x-ray diffraction to date (reviewed in
`refs. 35 and 36). The quaternary structure of Fab R19.9 is that
`of an extended conformation. This conformation is usually
`described by reference to an "elbow" angle made by the
`pseudo 2-fold axes relating VH to VL and CH1 to CL. For Fab
`R19.9 this angle is 1780, which is the largest (closest to 1800)
`so far observed in Fab structures. The rotation-translation
`operations necessary to superimpose selected a-carbon
`backbones of VH and VL are 1750 and 0.45 A, respectively,
`indicating a nearly ideal symmetry relationship between
`those domains. The numerical values for the corresponding
`operations in the CH-CL domains are 1680 and 1.5 A, values
`similar to those of other known Fab structures.
`A measure of the closeness of the Fab R19.9 structure to
`that of several other Fab molecules can be obtained by
`analyzing the shifts in the relative positions of packed
`,8-sheets (37). Thus, if the spatial superposition of the VH or
`VL 131 sheets is optimized, the (32 sheets of different Fabs
`(listed in Table 2) are no further away than an average of 0.55
`and a rotation angle of 90 from the corresponding sheet of
`Fab R19.9.
`The relative disposition of VH and VL in Fab R19.9 can be
`further compared to those of other Fabs by superposing the
`a-carbon coordinates of the residues that define the interface
`between the VH and VL subunits, as described in Table 2. The
`largest deviations that were observed for Fab R19.9 are 1.5
`A and 12.8°. These deviations and others observed with
`different Fabs do not appear to be significant.
`
`DISCUSSION
`The three-dimensional structure of Fab R19.9 presented here
`provides a structural model of a specific hapten-binding mAb
`of predefined specificity. The calculation of electron density
`maps at 2.8-A resolution by x-ray crystallographic techniques
`and the determination of amino acid sequences (through
`nucleotide sequencing of the mRNAs) of VH and VL allowed
`the tracing of most of the polypeptide chain. However,
`although the general position of VH CDR3 is clearly indicated
`
`in the different electron density maps that were calculated, its
`side chains could not be placed unambiguously. The ambi-
`guity may arise from an intrinsic high mobility of VH CDR3.
`This possibility is supported by the fact that the long VH
`CDR3 loop protrudes into the solvent beyond other parts of
`the molecule (see Fig. 3).
`The three-dimensional structure of Fab R19.9 agrees well
`with those of other Fabs that have been determined. It
`displays the largest elbow angle that has been observed in
`Fabs, in agreement with the idea that an extended (or
`contracted) conformation is independent of ligand binding to
`the combining site. As shown in Table 2, the relative dispo-
`sition of VH and VL in Fab R19.9 is well within a spectrum
`of angular and translational values observed in a number of
`Fabs, irrespective of their human or murine origin or of their
`liganded or unliganded state. The difference in relative
`disposition of VH and VL observed by Colman et al. (45) in
`a neuraminidase complex falls in the range of those observed
`in Table 2, indicating that formation of a complex with
`
`Table 2. The relative arrangements of VH and VL domains in
`different Fabs
`HyS
`
`J539 McPC603 R19.9
`Kol
`D1.3
`New
`0.68 A 0.69 A
`0.53 A
`0.49 A 0.70 A 0.42 A
`0.95 A 0.62 A
`0.54 A 0.69 A 0.67 A
`0.39 A
`0.78 A 0.61 A
`0.74 A 0.73 A
`0.56 A
`0.92 A 0.55 A
`0.56 A 0.49 A
`0.30 A
`0.82 A 0.87 A
`0.64A
`0.80 A
`0.62 A
`0.92 A 0.56 A
`0.57 A
`0.75 A 0.77 A
`0.62 A
`1.03 A 0.64 A
`0.54 A
`0.71 A 0.57 A
`0.88 A 0.59 A
`0.69A
`0.93 A
`
`HyS
`
`Kol
`
`New
`
`J539
`
`McPC603
`
`R19.9
`
`D1.3
`
`0.96 A
`8.50
`0.36 A
`1.14 A
`3.60
`5.00
`1.14 A 1.14A
`0.70 A
`11.00
`4.50
`6.70
`0.68 A
`0.74 A 0.72 A 0.44 A
`4.90
`5.40
`3.80
`7.20
`1.93 A
`1.19 A 1.08 A 2.13 A
`1.69 A
`8.0°
`9.10
`6.90
`12.80
`6.90
`0.53 A 0.38 A 0.90 A
`0.91 A
`1.22 A
`0.46 A
`6.80
`1.90
`2.60
`5.10
`4.80
`9.50
`Atomic coordinates for Fab Kol (38), New (22), McPC603 (39),
`J539 (40), and HyS (41) were obtained from the Brookhaven Data
`Bank (42, 43), and those of Fab D1.3 (44) were obtained from the
`authors. The VL domain of the Fab corresponding to each horizontal
`row was mapped into the VL of the Fab in the column by using
`a-carbon coordinates of residues defining the interface between VH
`and VL domains (45). The calculated transformation was applied to
`the Fab corresponding to the horizontal row, and the additional
`translation (A) and rotation (0) to optimize overlap between the
`corresponding pair of VH domains are given in the lower left triangle.
`The upper right triangle gives the corresponding root-mean-square
`distances for the pair of VL'S (upper number of each pair) and VH'S
`(lower number).
`
`PETITIONER'S EXHIBITS
`
`Exhibit 1060 Page 3 of 5
`
`
`
`610
`
`Immunology: Lascombe et al.
`
`Proc. Natl. Acad Sci. USA 86 (1989)
`
`by Jeske et al. (46), although orientations of these residues
`were not known.
`Site-directed mutagenesis (47) and chain recombination
`studies (48) have implicated VH Ser-99 and VL Arg-96, re-
`spectively, as residues that are important in Ar binding.
`Inspection of the model of Fab R19.9 shows that the guani-
`dino group of VL Arg-96 is at the bottom of the narrow cavity
`between VH and VL and that it could participate in direct
`contacts with an Ar ligand. Thus, it provides a positively
`charged group that could neutralize the negative charge ofthe
`Ar hapten. Ser-99 in VH appears less accessible to interac-
`tions with an external ligand. However, it and Arg-96 may be
`important in hapten binding not only because they could
`contribute direct contacts with Ar but also through stabilizing
`interactions with other amino acid residues at the combining
`site of the antibody itself. A precise identification of residues
`contacting bound Ar will require the determination of the
`three-dimensional structure of a hapten-Fab complex.
`The presence of a long VH CDR3 loop in R19.9 has two
`major effects on the structure of the combining site: (i) it
`partially fills what otherwise would be a large cavity or
`depression surrounded by the other CDRs of VH and VL; and
`(ii) it provides a protruding structural feature that appears
`unique to R19.9 among other Fab structures that have been
`determined. It is interesting to compare this loop with that of
`human VH KOL (38). Although KOL's CDR3 is three amino
`acids longer, it is partially bent inwards, thus resulting in a
`less salient loop than that of R19.9 (Fig. 4).
`The anti-Ar mAb R19.9 expresses some but not all id-
`iotopes associated with CRIA. The nucleotide and amino acid
`sequences of its VH and VK regions are consistent with the
`possibility that they are somatic variants of the germ-line VH
`and VK genes that encode CRIA antibodies (Figs. 1 and 2). In
`addition, R19.9 utilizes the canonical JH2 of CRIA. A major
`distinction in R19.9 is the contribution of a D gene segment
`giving rise to an atypical CDR3 that contains three more
`amino acid residues than are present in mAbs that fully
`express CRIA. The typical eight-residue D sequence appears
`to arise from the DFL16.1 genetic segment (10). The unusual,
`longer D segment as well as the three amino acid substitutions
`in VH CDR2 are likely to account for the incomplete expres-
`sion of CRIA idiotopes in R19.9. In agreement with this
`conclusion, the L chain of R19.9, when combined with the H
`chain of a CRI' mAb, yields a recombinant molecule that
`expresses CRIA, whereas the converse recombinant,
`HR19.9LCRI is idiotypically inactive (14).
`The partial idiotypic cross-reactivity between R19.9 and
`CRI) mAbs can be explained by the presence, in anti-
`idiotype sera, of antibodies that recognize residues in VH and
`VL other than those in VH CDR3. Small differences in the
`primary structure of R19.9 and the germ-line-encoded struc-
`ture owing to somatic mutations, as well as the large
`difference in D-region structure, could also contribute to the
`lack of total identity in serological tests. Among the somatic
`variations, the change from Ile-34 to Val in VH R19.9 does not
`seem adequate to explain a change in antigenic properties
`since the amino acid side chain at that position is not exposed.
`The sequence variations observed at positions Lys-55, Tyr-
`57, Leu-58, and Ser-59 in CDR2 and Arg-74 in FR3 could
`readily affect recognition of idiotopes since they are exposed
`at the accessible surface of VH.
`Characterization of two antigenic determinants occurring
`on a native protein (41, 44) indicates that the antigen-
`antibody interface extends over an area of about 700 A2 and
`includes residues from each of the VH and VL CDRs.
`Contacts with an anti-idiotype antibody might similarly
`include residues from all CDRs. Thus, given the solvent-
`exposed location and the spatial proximity of the CDR loops
`it is most reasonable to expect that the VL as well as VH CDRs
`will contribute to many combining-site related idiotopes.
`
`FIG. 3. A superposition of a portion of the a-carbon backbones
`of Fabs Kol (38) and R19.9. The VH CIQR3 of the Fabs have very
`different conformations. That of R19.9 is labeled and indicated by a
`slightly thinner trace. The numbers above 300 represent position
`numbers in the VH sequence of R19.9 plus 300.
`
`antigen is not necessary to produce the observed variability
`in the relative disposition of VH and VL.
`The CDRs of R19.9 contain a striking number of aromatic
`side chains, mostly tyrosines, which are oriented in such a
`way that they expose their phenolic OH groups to the solvent
`(see Fig. 4). These include the VH tyrosines 27, 32, 57, 101,
`and 109. VH Phe-100 in this region is also exposed to the
`solvent. VH Phe-29, Tyr-50, and Tyr-110 are oriented towards
`the interior of the structure, thus precluding their participa-
`tion in contacts with ligands. In VL, Tyr-32, Tyr-49, and
`Tyr-50 are oriented with their side chains pointing towards
`the solvent. Thus, a total of nine aromatic side chains
`belonging to the VH and VL CDRs, mostly tyrosines, are
`positioned to provide possible contacts with antigen. The
`prevalence of tyrosine residues in these CDRs has been noted
`
`FIG. 4. A view of the combining site of Fab R19.9, which shows
`a high density of aromatic residues, mostly tyrosine VL is at left; VH
`is at right. The numbers above 300 represent positions in the VH
`sequence plus 300 (i.e., CA 401 = VH residue 101, etc.). Lower
`numbers are positions in VL-
`
`PETITIONER'S EXHIBITS
`
`Exhibit 1060 Page 4 of 5
`
`
`
`Immunology: Lascombe et al.
`
`Proc. Natl. Acad. Sci. USA 86 (1989)
`
`611
`
`Note Added in Proof. After this paper was submitted for publication,
`Stevens et al. (49) reported differences in low and high ionic strength
`crystalline forms of human immunoglobulin L-chain dimer Loc,
`which they take to indicate different potential conformations of an
`antibody. The different VL-VL contacts observed in Loc, as well as
`those between VH and VL domains in FabNC41 complexed to
`antigen (45), are postulated (49) to increase antigenic and idiotypic
`specificities ofantibodies. However, as shown in Table 2, the VH-VL
`contacts observed in NC41 are within the range observed in Fabs,
`independently of their liganded (D1.3 and Hy5) or nonliganded
`states. Since Table 2 includes Fabs crystallized at low (Hy5, D1.3,
`and R19.9) and high ionic strength (Kol, New, J539, and McPC603),
`the conformational variations observed in Loc may be unique to it or
`to L chains, which do not normally occur as dimers in nature. The
`lack of significant differences in the relative disposition of VH and VL
`thus far observed in liganded or unliganded Fabs does not seem to
`suggest that such differences could contribute to increase the
`functional diversity of antibodies.
`
`We wish to thank Dr. Claude Riche (Centre National de la
`Recherche Scientifique, Gif sur Yvette, France) for the interpreta-
`tion of the electron density map of R19.9 at 6-A resolution by means
`of a six-dimensional real space search. This work was supported by
`grants from the Institut Pasteur, Centre National de la Recherche
`Scientifique, contract BAP-0221(DC) from the European Economic
`Community, and by National Institutes of Health grants AI-25369
`and AI-22068.
`
`1.
`
`2.
`
`3.
`
`4.
`
`5.
`
`6.
`
`7.
`
`8.
`
`9.
`
`10.
`
`11.
`
`12.
`
`13.
`
`14.
`
`15.
`
`16.
`
`17.
`18.
`
`19.
`
`Kuettner, M. G., Wang, A. L. & Nisonoff, A. (1972) J. Exp.
`Med. 135, 579-595.
`Nisonoff, A., Ju, S.-T. & Owen, F. L. (1977) Immunol. Rev. 34,
`89-118.
`Greene, M. I., Nelles, M. J., Sy, M.-S. & Nisonoff, A. (1982)
`Adv. Immunol. 32, 253-300.
`Rathbun, G., Sanz, I., Meek, K., Tucker, P. & Capra, J. D.
`(1988) Adv. Immunol. 42, 95-164.
`Manser, T., Wysocki, L. J., Margolies, M. N. & Gefter, M. L.
`(1987) Immunol. Rev. 96, 141-162.
`Pawlak, L. L., Mushinski, E. B., Nisonoff, A. & Potter, M.
`(1973) J. Exp. Med. 137, 22-31.
`Laskin, J. A., Gray, A., Nisonoff, A., Klinman, N. R. &
`Gottlieb, P. G. (1977) Proc. Natl. Acad. Sci. USA 74, 4600-
`4604.
`Siekevitz, M., Huang, S.-Y. & Gefter, M. L. (1983) Eur. J.
`Immunol. 13, 123-132.
`Sanz, I. & Capra, J. D. (1987) Proc. Natl. Acad. Sci. USA 84,
`1085-1089.
`Landolfi, N. F., Capra, J. D. & Tucker, P. W. (1986) J.
`Immunol. 137, 362-365.
`Meek, K., Sanz, I., Rathbun, G., Nisonoff, A. & Capra, J. D.
`(1987) Proc. Natl. Acad. Sci. USA 84, 6244-6248.
`Estess, P., Lamoyi, E., Nisonoff, A. & Capra, J. D. (1980) J.
`Exp. Med. 151, 863-875.
`Gill-Pazaris, L. A., Brown, A. R. & Nisonoff, A. (1979) Ann.
`Immunol. (Paris) 130C, 199-213.
`Gill-Pazaris, L. A., Lamoyi, E., Brown, A. R. & Nisonoff, A.
`(1981) J. Immunol. 126, 75-79.
`Lamoyi, E., Estess, P., Capra, J. D. & Nisonoff, A. (1980) J.
`Immunol. 124, 2834-2840.
`Amit, A. G., Harper, M., Mariuzza, R. A., Saludjian, P.,
`Poljak, R. J., Lamoyi, E. & Nisonoff, A. (1983) J. Mol. Biol.
`165, 415-417.
`Porter, R. R. (1959) Biochem. J. 73, 119-127.
`Wlodawer, A. & Hodgson, K. 0. (1975) Proc. Natl. Acad. Sci.
`USA 72, 398-399.
`Mariuzza, R. A., Amit, A. G., Boulot, G., Saludjian, P., Saul,
`F., Tougard, P., Poljak, R. J., Conger, J., Lamoyi, E. &
`Nisonoff, A. (1984) J. Biol. Chem. 259, 5954-5958.
`
`20.
`
`21.
`
`22.
`
`23.
`
`24.
`25.
`26.
`27.
`
`28.
`29.
`
`30.
`
`31.
`
`32.
`
`33.
`
`34.
`
`35.
`
`36.
`
`37.
`38.
`
`39.
`
`40.
`
`41.
`
`42.
`
`43.
`
`44.
`
`45.
`
`46.
`
`47.
`
`48.
`
`49.
`
`Oatley, S. & French, S. (1982) Acta Crystallogr. Sect. A 38,
`537-549.
`North, A. C. T., Phillips, D. C. & Matthews, F. S. (1968) Acta
`Crystallogr. Sect. A 24, 351-358.
`Saul, F. A., Amzel, L. M. & PolIjak, R. J. (1978) J. Biol. Chem.
`253, 585-597.
`Crowther, R. A. (1972) The Molecular Replacement Method,
`ed. Rossmann, M. G. (Gordon & Breach, New York), pp. 173-
`178.
`Sussman, J. L. (1985) Methods Enzymol. 115, 271-303.
`Wang, B. C. (1985) Methods Enzymol. 115, 90-122.
`Jones, T. A. (1985) Methods Enzymol. 115, 157-171.
`Hendrickson, W. A. & Konnert, J. H. (1980) in Computing in
`Crystallography, eds. Diamond, R., Ramaseshan, S. & Ven-
`katesan, K. (Indian Acad. Sci., Bangalore, India), pp. 13.01-
`13.25.
`Bhat, T. N. (1988) J. Appl. Crystallogr. 21, 279-281.
`Griffiths, G. M. & Milstein, C. (1985) in Hybridoma Technol-
`ogy in Biosciences and Medicine, ed. Springer, T. A. (Plenum,
`New York), pp. 103-115.
`Kaartinen, M., Griffiths, G. M. & Milstein, C. (1983) Nature
`(London) 304, 320-324.
`Robbins, P. F., Rosen, E. M., Haba, S. & Nisonoff, A. (1986)
`Proc. Natl. Acad. Sci. USA 83, 1050-1054.
`Kabat, E. A., Wu, T. T., Reid-Miller, M., Perry, H. M. &
`Gottesman, K. S. (1987) Sequences ofProteins ofImmunolog-
`ical Interest (U.S. Public Health Service, National Institutes of
`Health, Bethesda, MD), 4th Ed.
`Slaughter, C. A. & Capra, J. D. (1984) in Biology ofIdiotypes,
`eds. Greene, M. I. & Nisonoff, A. (Plenum, New York), pp.
`35-58.
`Huang, S. Y., Margolies, M. N., Marshak-Rothstein, A.,
`Siekevitz, M. & Gefter, M. L. (1982) Pharmacol. Rev. 34, 43-
`49.
`Davies, D. R. & Metzger, H. A. (1983) Annu. Rev. Immunol.
`1, 87-117.
`Alzari, P. M., Lascombe, M.-B. & Poljak, R. J. (1988) Annu.
`Rev. Immunol. 6, 555-580.
`Lesk, A. M. & Chothia, C. (1982) J. Mol. Biol. 160, 325-342.
`Marquart, M., Deisenhofer, J., Huber, R. & Palm, W. (1980) J.
`Mol. Biol. 141, 369-391.
`Satow, Y., Cohen, G. H., Padlan, E. A. & Davies, D. R. (1986)
`J. Mol. Biol. 190, 593-604.
`Suh, S. W., Bhat, T. N., Navia, M. A., Cohen, G. H., Rao,
`D. N., Rudikoff, S. & Davies, D. R. (1986) Proteins 1, 74-80.
`Sheriff, S., Silverton, E. W., Padlan, E. A., Cohen, G. H.,
`Smith-Gill, S. J., Finzel, B. C. & Davies, D. R. (1987) Proc.
`Natl. Acad. Sci. USA 84, 8075-8079.
`Bernstein, F. C., Koetzle, T. F., Williams, G. J. B., Jr.,
`Meyer, E. F., Brice, M. D., Rodgers, J. R., Kennard, O.,
`Shimanouchi, T. & Tasumi, M. (1977) J. Mol. Biol. 112, 535-
`542.
`Abola, E. E., Bernstein, F. C., Bryant, S. H., Koetzle, T. F.
`& Weng, J. (1987) In Crystallographic Databases: Information
`Content, Software Systems, Scientific Applications, eds. Allen,
`F. H., Bergerhoff, G. & Sievers, R. (Data Commission of the
`Int. Union of Crystallography, Bonn), pp. 107-132.
`Amit, A. G., Mariuzza, R. A., Phillips, S. E. V. & Poljak,
`R. J. (1986) Science 233, 747-753.
`Colman, P. M., Laver, W. G., Varghese, J. N., Baker, A. T.,
`Tulloch, P. A., Air, G. M. & Webster, R. G. (1987) Nature
`(London) 326, 358-363.
`Jeske, D., Milner, E. C. B., Leo, O., Moser, M., Marvel, J.,
`Urbain, J. & Capra, J. D. (1986) J. Immunol. 136, 2568-2574.
`Sharon, J., Gefter, M. L., Manser, T. & Ptashne, M. (1986)
`Proc. Natl. Acad. Sci. USA 83, 2628-2631.
`Jeske, D. J., Jarvis, J., Milstein, C. & Capra, J. D. (1984) J.
`Immunol. 133, 1090-1092.
`Stevens, F. J., Chang, C. H. & Schiffer, M. (1988) Proc. Natl.
`Acad. Sci. USA 85, 6895-6899.
`
`PETITIONER'S EXHIBITS
`
`Exhibit 1060 Page 5 of 5