Page 1 of 23
`
`ILMN EXHIBIT 1013
`
`
`
`Page 1 of 23
`
`ILMN EXHIBIT 1013
`
`

`
`SUbSCl‘lDtlOl1S
`
`An annual subscription to Nucleic Acids Research
`comprises 24 issues plus one supplement. with an
`Annual Author and Subject Index. Subscriptions
`are entered on a calendar year basis only. Price
`includes handling and delivery, by air beyond
`Europe.
`
`Annual subscription rate (Volume 16. I988):
`US$650. Not applicable to the UK and Japan-
`please write for separate details. Back volume
`prices and subscription rates for individuals are
`also available on request.
`
`Orders. Orders and payments from. or on behalf
`of, subscribers in the various geographical areas
`shown below should be sent to the IRL Press
`office indicated.
`
`IRL Press Inc.. PO Box Q,
`The Americas.‘
`McLean. VA 22l0|-0850. USA.
`
`Japan: payment in Yen to sole agents (details on
`request), USACO Corporation. Tsutsumi
`Building.
`l3—l2 Shimbashi I-chorne, Minato-lru.
`Tokyo 105. Japan.
`
`Rest of the World.‘ IRL Press Ltd. PO Box. 1.
`Eynsham. Oxford. OX8 1]}, UK.
`Tel: (0365) 882283; telexz 83147 (IRL);
`fax: (0865) 882890.
`
`Advertising. To advertise in Nucl'et'c Acids
`Research contact IRL Press Inc.
`in the Americas
`or [R1, Press Ltd in the rest of the world (see
`addresses above).
`
`Authorization to photocopy items for internal or
`personal use. or the internal or personal use of
`specific clients.
`is granted by IRL Press Ltd for
`libraries and other users registered with the
`Copyright Clearance Center (CCC) Transactional
`Reponing Service. provided that the base fee of
`$3.00 per copy is paid directly to CCC.
`21 Congress St. Salem. MA 0I9'i(}. USA.
`0305-l048f8S $3.00 + 0. Special requests. such
`as copying for general distribution. or for
`advertising or promotional purposes. should be
`addressed to the Production Editor. Nm1'eic- Acids
`Re.-.-mr<'h. IRL Press Ltd. PO Box I. Eynshani.
`Oxford OX8 11.], UK.
`
`I988 IRL Press Ltd. All rights reserved by the
`publisher.
`
`Typeset by Infntype and printed by [nfonnatinn
`Printing Ltd. Oxford. England on Pcnrianent Paper.
`
`
`
`Page 2 of 23
`
`
`
`Page 2 of 23
`
`

`
`_.
`
`= 16 Number 9 1988
`
`Nucleic Acids Research
`
`"a - of oligonucleotides to nucleic acids or proteins via disnlfide bonds
`
`-.= C.F.Chu and Leslie E.Orge|
`
`{Salk Institute for Biological Studies. PO Box 85800. San Diego, CA 92138. USA
`
`February 15. I988; Accepted March I8, 1988
`
`1
`- C1‘
`f':I_!if
`" -ve developed general methods for joinin together, via cleavable disulfide bonds,
`unprotected polynucleotides or a polynuc eottde and a pedptide or
`rotein.
`net in w
`.;- join two oligonucleotides, each is first converted to an ad
`ich cystamine is
`-= to the 5’-terminal phosphate of the oli onuclcotide by a phosphorarnidate bond. The
`: are mixed and reduced with dithiot reito]. The dithiothreitol is then removed by
`Oxidation by atmospheric oxygen occurs to yield the required dimer.
`a join an oligonucleotide to a cysteine-contaimng peptide or protein, the 5 '--cystamine
`‘o1
`is first converted to a 2’-
`dyldisulfide adduct and then reacted with an excess of
`-=3:
`e or
`rotein. If the peptr e does not contain a free cysteine residue, it is first treated
`. thioliane to introduce one or more sulfh dryl groups.
`___J_§
`ehave used these rocedures to join a 1 mer deoxynucleotide probe and MDV-1
`:a substrate of Qfi NA polymerase. This adduct hybridizes with a complementary
`DNA. We have also joined a lémer probe to peroxidase and MDV—1 RNA to human
`The probe-peroxidase adduct maintains enzymatic activity and the MDV-1 RNA-IgG
`--2» binds to a complementary anti—IgG.
`
`
`
`1.1 DUCTION
`
`_ -- ures for attaching oligodeoxynucleotides to biopolymers, particularly proteins, are
`_.'3';-n increasingly important in molecular biology and biotechnology (1-5). One
`
`Ijfa ch that has been widely used involves the incorporation of a linker group into a
`
`ll.» oligodeoxynucleotide. A suitably protected 1inker—containing nucleotide—analogue
`7:7-rv one of the standard monomers in a solid-phase synthetic procedure. After
`‘T
`‘on the oligonucleotide can be coupled. for example to a protein, via the linker.
`
`.:-;_~« that introduce a thiol group at the 5 ’-terminus (6) or the 3'—terminus (7) have
`
`. _ ported, and in one case the product has been coupled to a protein, rnicrococcal
`(4)-
`
`_ 1-:
`
`:-' synthetic procedures are not applicable when it is necessary to attach a ligand to an
`
`ted oligonucleotide or nucleic acid that has been synthesized cnzymatically or
`
`from natural sources. We have developed an alternative methodology for linking an
`
`- - c oligonucleotide or polynucleotide via a 5 ’-terminal phosphate to any of a wide
`
`_-- fligands (8-10). The chemistry is simple and rapid and may be applied to short
`1
`- M tides, short oligodeoxynucleotides, RNA or DNA.
`
`I
`
`this paper we first present a very simple procedure for joining together pairs of
`
`5_-«Press Limited, Oxford, Engiand.
`
`3571
`
`Page 3 of 23
`
`
`
`Page 3 of 23
`
`

`
`Nucleic Acids Research
`
`otigonucleotides of any length via cleavable disulfide linkages. We have also used previously L
`described methods for linking together proteins via disulfide bonds (11, 12) to Iigate an
`
`oligonucleotide or nucleic acid to a. thiol-containing peptide or protein. Applications include '
`
`the linking of an arnplifiable reporter, MDV—1 RNA (221 bases) (13), to either a probe
`
`oligodeoxynucleotide or an antibody and the formation of a probe-peroxidase adduct. Some
`
`of these products could not easily be prepared using standard methods.
`
`MATERIALS AND METHODS
`
`Materials
`
`The following were purchased: calf intestine alkaline phosphatase and peroxidase»-
`
`(Boehringer Mannheim), T4 polynucleotide kinase and single—stranded M13mp18 DNA (New
`England Biolabs), [1r—32P]—ATP (Amersham). cystamine (2.2'—dithiobis(ethyl-7
`arnine)dihydroehloride) (C.T.C. Organics), 2,2’-dipyridyldisulfide (Aldrithiol-2) (Aldrich),
`
`bradykinin (arg-pro-pro-gly-phe-ser-pro-phc-arg) and fatty acid free bovine serum albumin
`(BSA) (Sigma), 2—iminothiolane (Pierce), human IgG and affinity purified goat anti—human‘
`IgG (Cappel), 3,3 '—diaminobenzidene (Bio-Rad), DEAE Sephadex A~50—120 (Sigma);
`
`Immulon-2 ELISA removeawell strips (Dynatech).
`
`The deoxyribonucleotide sequence. 5 ‘-CACAATTCCACACAAC (16n-ier), comp1e--
`
`mentary to residues 6170-6185 of the M13mp18 DNA (+) strand, and the 37mer
`
`I
`
`
`
`U
`
`OLIGONUCLEDTIDE'5"U§NHCH.CH,5H
`0.
`ii)
`
`E‘
`OLIGONUCLEDT IDE 05'D$NHCH,CH,55CI'I.cH,NH,
`0'
`.3.
`(HI
`
`.
`9
`. 9
`OLIGONUCLEOTIDE A'§'OéHHCH,CH,55CH,CH,NHe°'5'DLIGONUCLEOTIDE B
`0-
`0-
`‘Hill
`
`<..>
`,
`OLIGONUCLEOTIDE'5'OeII-HCH,CH,55 I
`o_
`(‘V3
`
`\
`1
`
`0
`
`OLIGONUCLEOTIDE -s’-o§nncn,cn,ss—rrr~nn: rpnoram
`O.
`['1
`
`stamina-P-.
`Figure 1: The structures of (i) 5 ’-thio-ethylamino-P-oligonucleotides. (ii) 5"-
`-py_r -ss-P-
`oligonucleotides,(iii)5'-P-q1igonucleqttde—ss—5’-If-oltgonucleotides, (1\f)5 -
`oligonucleotides. (V)
`’-P-oli onucleotide-ss-protein or p'eptldC.' The oligonucleoti es can,
`have any length and belong eit er to the nbo- or the deoxynbo- series.
`
`Page 4 of 23
`
`
`
`Page 4 of 23
`
`

`
`TATGTTGTGTGGAATTGTGAGCGGATAACAATPT, which corresponds to
`
`Nucleic Acids Research
`
`-< 6164-6200 of the M13mp18 (+) strand, were synthesized on an Applied Biosystems
`
`«izer Model 380. The purification of the lémer and 37mer and their conversion to the
`n.- phates has been described (9). 5 ’-ppp-MDV-1 (+) RNA was a gift from Dr. Fred
`
`:.-e , Public Heailh Research Institute, New York. Its propagation, dephosphorylation,
`'
`fcnnversion to the 5 ’-[3zP]-MDV-1 RNA and 5’-cystamine-[32P]-MDV—1 RNA (Fig. 1 ii)
`
`
`
`E254
`
`5'-cystamina-P- 1 Emm-
`
`5'-P—16rrIer
`
`I D
`
`H 12 PEFICHLORATE
`
`E254
`
`5'—(2—pyr)—ss—16rnar
`J
`
`5'-cystamine-P-16n}or
`
`pH 3
`PEFICHLDRATE :-
`
`
`
`"-
`
`3673
`
`Page 5 of 23
`
`-
`
`' 2: HPLC elutionsprofile of reaction mixtures showing:
`Conversion of
`'-P-lfimcr to 5 ’ -
`stamine-P-16mer. 5 ‘ -P-ltimer was treated with
`Frnethyiilnidazole, 0.15 M 1—ethyl-3,
`,-dimethylarninopropylcarbodiimide, and 0.5 M
`'
`for 2 hours at &H 7.2 and 50°C. Oligonucleotides were eluted from an R.PC—5
`_ at pH 12, usin 0.
`6 M-0.066 M rchloratezgradtent in 30 rnms.
`.
`Conversion 0 S '
`tamine-P-1 met to 5 ‘-
`-pyr)-ss-P-16mer. 5’-cystantunc-P-16n1er
`=--- with 5 mM D for 1 hour at pH 7.2. 2. ’-dipyrid 1-disnlfide was then added to a
`ntration of 1.6 mM. The reaction mixture was mcu ated at room temperature for 2
`Oligonucleotidcs were eluted from an RPC-5 column at pH 8. using a 0.024 in-0.40 I11
`,2: H legfadiflnl in
`III_i_[lS.
`
`
`
`Page 5 of 23
`
`

`
`
`
`Nucleic Acids Research
`
`
`
`
`2
`3?;
`
`5%.’;ti
`gist
`023%
`Ifllfllfl
`
`--—x-o
`
`1:
`‘I
`
`Figure 3: Autoradiogram of denaturing 20% gel showing
`migration of 5 '-WP]-16mer, Sficystamine-[32P]-16mer, 5'-thio-
`ethylamino-Pi’-P]-lfimer. and 5 ’—(2—pyr)-ss-[32P]'-16mer. The
`markers are bromophenol blue (BPB) and xylene cyanol (X~C).
`
`—3'’3
`
`have been previously described (13). The peptide gly-lcu—gIu—cys-glun-gly-arg-val—asn—Ieu~ala-
`
`gly-tyr (Peptide A) was a gift from Dr. J. Rivier, Salk Institute.
`
`Synthesis of5‘flsmm|ne adducts of short ollgonueleotides (Fig. 1 ii)
`0.01-0.5 O.D.U. (260 nn1)of5‘-P-l6rner or 5 '-[32P]-16rner was reacted with 0.1M
`
`1-methylimidazoie (pH 7), 0.15 M I-ethyl~3.3-dimethylaminopropylcarbodiimide
`
`(carbodiimide) and 0.5 M cystamine (pH 7.2) in a volume of 50-250 pl at 50°C for 2 hours.
`The product was separated from reactants by HPLC on RPC-5 (Fi g. 2 A). The yield ranged
`between 75% and 35%. 5 ’-cystamine-[32P]-lfimer and 5 ’-[32P]-16mer are also readily
`separated by electrophoresis on 20% polyacrylamide containing 7 M urea (Fig. 3). The
`corresponding cystamine adduct of 5 ’-[32P]-37mer was obtained by analogous procedures.
`s utests Of5'- 32? -16mer-ss-5'- 32? -16mer ot-5‘-P-iamt.-t-ss.s'. 331» -37mer (Fig. 1 iii)
`
`
`
`
`
`
`A 5 pM solution (25-50 pl) of5‘-cystamine-[WP]-lfimer (104406 cpm). or a 5 pM
`solution of 5 ’—cystarnine—P-lfimer and 103-10‘ cpm of 5 Ccystamine-[32P]~37mer, were treated
`with 6 mM dithiothreitol (DTT) in 10 mM Tris buffer containing 1 mM EDTA (Tris-EDTA)
`
`
`
`at pH 7 for 1 hour at 25°C. The reaction mixture was then dialyzed against one liter of buffer
`
`containing 1 mM Tris, pH 7.2, 1 mM EDTA and 0.1 mM DTT for 30 minutes at 4°C. It was
`
`next dialyzed against fresh buffer containing 1 mM Tris, pH 7.2, and 1 mM EDTA for
`
`.
`
`further 30 minutes. After concentration in a speed-vac concentrator. the products were‘:
`
`separated from reactants by electrophoresis on 20% poiyacrylantide under denaturin
`
`conditions (Fig. 4 A, B). Yields of dimerized 16mer ranged from 30% to 40% and of 5 ’—P-
`ismsr-ss-[331=]-37tnet from 45% to 55%.
`
`
`
`
`
`Page 6 of 23
`
`
`
`Page 6 of 23
`
`

`
`Nucleic Acids Research
`
`-X43
`
`dli
`
`
`
`-9-
`
`4: Autoradiograrns of denaturin 20% gels showing:
` -:
`_' A. lane 1) 5’— stamine-E3P]— 6mer; lane 2
`ormation of the slower moving
`' -Iémer-ss-5 '—[¥zP]-16Iner y reduction of a 5 fl
`solution of 5 ’-cystamine—[32P]-16rner
`D , removal of thio-ethylamine and D'I'I‘ by dialysis, and air oxidation for 30 rnins;
`_ -3) same as lane 2, except oxidation allowed to continue for a further 12 hours;
`lane 4)
`fin : 'n of 5 ‘-thio-ethylamino-P?-P]-lfimer by treatment of 5 ‘-[HP]-16me r-ss-5 ’-[WP]-16tner
`_‘i - 5 mM DTT for 1 hour.
`__ B. lane 1 5 '-cystamine-[32P]-37mer;
`lane 2) formation of the slower moving 5 '-P~16mer-
`[”P]—3 met’ after reduction of a mixture of 5 ’—cystamine—[-'*3P]l;37mer and 5 pM
`mine-P-lfimer with DT1", removal of DTT and thimethylamine y dialysis. and air
`me for 30 mins. Marker is xylene eyanol (X-C).
`
`-
`
`
`
`s of5'-P-16Iner-ss-5'- 331» -MDV-1 RNA (Fig. 1 iii)
`'1»
`10‘-10‘ cprn (5-sou ng) of5'-cystamine-{32P]-MDV-1 RNA (Fig. 1 ii) and a 5 pM
`of 5‘-cystaminc-P-lérner (total volume 25-50 pl) was treated for 1 hour with 6 mM
`in Tris—EDTA buffer at pH 7. The reaction mixture was then dialyzed against one liter
`[ am 1' containing 1 mM Tris, pH 7.2, 1 mM EDTA and 0.1 mM D'I'I‘ at 4°C for 30 minutes.
`-‘solution was next dialyzed against buffer containing 1 mM Tris, pH 72, and 1 mM EDTA
`
`.:: further 30 mins at 4°C. The reaction solution was then concentrated in a speed-vac
`_-'~«-
`- tor, and the product separated from reactants on 6% polyacrylamide containing 7 M
`. "‘(Fig. 5 A). The yield ranged from 45% to 55%.
`:L--. 5 of5'- 2-
`-ss- 32P -16mer (Fig. 1 iv)
`0.02-02 OD. (254 rim) offi’-cystamine-[RP]-lfimer was reacted with 5 mM DTT in 11 iii
`EDTA buffer at pH 7.2 for 1 hour at room temperature. 1.5 pl of buffer containing
`':—=- Tris (pH 7.2) and 1 mM EDTA, and 51 pl of a 3 mM solution of 2,2’—di—
`-.- ' llide in water were then added. The final reaction mixture contained 0.8 mM DTT
`n1M 2,2-dipyridyldisulfide. It was incubated at room temperature for 2 hours.
`The 5 '-(2-pyr)-ss-[32P]-16rner was then separated from the starting 5 ’-cystarnine-
`
`3675
`
`Page 7 of 23
`
`
`
`Page 7 of 23
`
`

`
`Nucleic Acids Research
`
`
`
`—-x-c
`
`Figure 5: Autoradiograms of denaturin%6% el showing:
`A. lane 1) 5’— stan1ine—[”P —MD -1 NA;
`lane 2) formation of the slower movin
`5 ’-P-ldmer-ss~5 ‘-[I33 ]-MDV-1
`A by reduction of a mixture of 5 ‘-
`stantine-PIP -MDV-
`RNA and 5 ;;M 5 -cystamine-P-16mer with DTT, removal of thio-et ylamine an DTT by t
`dialysis, and air oxidation for 30 mins;
`lane 1) before DTT treat-
`B. 5 '-P-lfimer-ss-5'-[32P]-MDV-1 RNA extracted from gel;
`ment;
`lane 2) after treatment with 10 111M DTT at pH 7.2 for 1 hour at room temperature.
`
`[32P]-16mer either by HPLC on RPC-5 at pH 8 (Fig. 2 B) or by denaturing gel electrophoresis
`on 20% polyacrylamide (Fig. 3). The yield ranged from 70% to 90%.
`smtttests ol’5 '—[2-1111;]-ss-[33P| -MDV-1 RNA (Fig. 1 iv)
`10-100 ng of5 ’-cystamine-[32P]-MDV—1 RNA were treated with 5 mM DTT in 4.5 pl of
`Tris-EDTA buffer at pH 7.2 for 1 hour at room temperature. 2 pl of a 1 mM solution of
`
`EDTA and 24 pl of a 3 IIIM solution of 2,2'—dipyridyldisulfide were then added to the reaction
`mixture. The resulting solution contained 0.8 mM D'I'I' and 2.4 mM 2,2’ -dipyridyldisulfide.
`After 2 hours at room temperature, the 5 ’—(2wpyr)—ss-[HP]-MDV-1 RNA, mixed with"
`
`unreaeted MDV-1 RNA, was separated from reagents by denaturing gel electrophoresis am
`
`6% polyacrylamide. The product was then extracted from the gel and purified as described.
`Thiolatlon of Bradgklnlg, Peroxidase and Human Igg
`
`200 pg (0.15 prnole) of bradykinin in 100 pl of buffer containing 100 mM phosphate and
`
`0.1 mM EDTA at pH 7.6 was added to 2 mg (14.5 prnole) of iminothiolane. The final
`
`
`
`Page 8 of 23
`
`
`
`Page 8 of 23
`
`

`
`Nucleic Acids Research
`
`‘-
`
`-393
`
`-393
`
`H
`
`6: Autoradiogram of denaturing 20% gel showing:
`A. lane 1) 5 ‘-S2-pyr)-ss-g”P]-l6n1er;
`__
`lane 2) formation of 5 ’-[3"-P]-16mer-ss-peptide A
`reaction of
`'-(2—pyr -as-[”P]-16mcr with 3 mM peptide A overnight at room
`Tm! Ifltllrfl and pH 7.2.
`lane 1) before DTT treatment; lane
`B. 5 ‘-[HP]-lfimer-ss-peptide A extracted from gel:
`'___i'after treatment with 10 mM DTT at pH 7.2 for 1 hour at room tern
`rature.
`'.
`C. formation of 5 '- 3P_}—16mer—ss-bradykinin after reaction of
`‘-92-pyr)—ss—[33P]—16mer
`'f'__n
`» 1mM thiolated bra ylonin overnight at room temperature and pH .2.
`
`(‘Eu ntration of iminothiolane was 0.15 M. The pH was adjusted to 8.5 and the reaction
`
`" «- d to proceed at room temperature for 1 hour. The thiolated bradykinin was then
`
`= ed from the reagents by HPLC on a Synchropack GPC 60 gel filtration column, eluting
`",3-,_u.=u
`_'.i-=~ 0.1 mM EDTA at pH 6.9.
`
`.
`
`The thiolation of peroxidase was carried out as described in reference 12. 34 pg of
`
`_._1 m (~1 nmole) in 40,141 of 50 mM sodium borax buffer, pH 8.5, was added to 2 mg
`i" ' pmoles) of iminothiolane. The final concentration of iminothiolane was 0.3 M. The pH
`
`adjusted to 8.4 and the reaction allowed to proceed at room temperature for 1 hour. The
`
`._=lated peroxidase was separated from reagents by HPLC on a Synchropalr GPC 60 gel
`tion column, eluting with buffer containing 50 mM sodium phosphate, pH 6.9, and 1 mM
`A. The product, collected in -V0.5 ml of buffer, contained an average of 3 moles of thiol
`
`.,;|-J mole of peroxidase. The thiolated peroxidase was as active as native peroxidase in the
`.2ldia1niriobenzidi11e assay on nitrocellulose (14).
`The thiolation of human IgG followed the procedure described in reference 15. 400 pg of
`
`:--I :
`
`IgG (2.5 nrnoles) was dissolved in 180 pl of buffer containing 60 mM triethanolamine,
`potassium phosphate, 100 111M NaCl and 1 rnM EDTA at pH 8. The tube was flushed
`
`Q-.5: argon. and 20 pl of a 10 mM solution of itninothiolane in 1 M triethanolarnine at pH 8
`_.' added. The final concentration of iminothiolane in the reaction mixture was 1 mM. The
`
`3677
`
`Page 9 of 23
`
`
`
`Page 9 of 23
`
`

`
`Nucleic Acids Research
`
`—x—c
`
`_
`_
`Figure 7: Autoradiogram of denaturin;P6% lshowinlé:
`A.
`lane 1
`formation of 5 ’-[3
`]-
`V-1 R A—ss—peptrde A after reaction of
`5 ’-(;Z-
`)-ss- 3 Pl]-MDV-1 RNA with 5 mllgqpeptide A at room temperature overnight at
`pH .
`; lane2 5 - 2‘-Pyr -m-[33P]—MDV-1
`A.
`_
`B. 5 '-
`1-
`-1
`A-ss-pe tide A extracted from gel:
`lane 1) before treatment with
`DTT;
`lane ) after treatment with 1tl'mM DTI‘ at pH 7.2 and room temperature for 1 hour.
`
`reaction was allowed to proceed at 0°C for 1 hour. The thiolated human IgG was then
`
`separated from the reagents by HI’LC on a Synchropack GPC 60 gel filtration column, eluting
`
`with 5 111M bis—tris acetate buffer containing 50 mM NaCl and 1 111M EDTA at pH 5.8. The
`
`preparation of thiolated IgG contained an average of 1 mole of thiol per mole of IgG.
`Smtllesis of 5‘-(“P1-ismer-ss-gegtide A (Fig. 1 v)
`A. 2-5 ng of 5 '-(2-pyr)-ss—[32P]-16mer was reacted with 3 g_iM peptide A in 12 pl of
`buffer containing 50 mM Tris and 1 mM EDTA (pH 7.2) at room temperature overnight. The
`
`product was separated from starting materials by denaturing gel electrophoresis on 20%
`
`polyacrylarrride (Fig. 6 A). The yield ranged from 70% to 90%.
`B. 2-5 ng of 5’-cystamine-[32P]-16mer was used in place of the 5 ’-(2—pyr)-ss~[32P]-16n1er
`in procedure A described above. The yield of 5 ’-[32P}-16mer-ss—peptide Awas only 10%.
`c. 30 ng of5 ’-cystamine-[32P]-lfimer and a 4 mM solution of peptide A in Tris-EDTA
`buffer at pH 7.2 was treated with 10 mM DTT for 1 hour at room temperature. The reaction
`
`mixture was then dialyzed against 1 mM Tris (pH 7.5) for 1 hour at 4°C and the resulting
`
`solution lyophilized. The product was resuspended in 5 pl of Tris-EDTA buffer at pH 7.2 and
`allowed to stand at room temperature overnight. The product, 5 ’-[32P]-16n1er-ss—peptide A.
`
`was separated from starting materials by denaturing gel electrophoresis on 20% polyacryl-
`
`amide. The yield ranged from 80% to 100%.
`Smtlresis of 5'-|nP|-MDV-1 RNA-as-peptide A (Fig. 1 v)
`3,000-5,000 cpm (0.1-05 ng) of5 ’-(2-pyr)-ss-[32P]-MDV-1 RNA was reacted with 5 mM
`
`peptide A in 9 pl of buffer containing 100 mM Tris and 1 mM EDTA at pH 7.2. The reactions-
`
`proceeded overnight at room temperature. The product was separated from reactants by
`
`
`
`Page 10 of 23
`
`
`
`Page 10 of 23
`
`

`
`Nucleic Acids Research
`
`—xc
`
`-BPB
`
`lane 1)
`
`lane 1) 5 ’-(2-pyr)-ss-
`j:~,u 8: A. Autoradiogram of denaturing 20% gel showing:
`- " 16mer; lane 2 formation of 5 ’-[”P]-16mer-ss-peroxidase after overnight reaction of
`-
`-
`ss—[31'P]-1 met with 15 pM thiolated
`roxidase at pH 7.2 and room temperature.
`.
`toradiogram of denaturing 6% gel s win? same reaction as A.
`C. Denaturing 6% gel stained with Coumassie b ue showing same reaction as A:
`- removal of 5 ’-[3zP]-lémer-ss-peroxidase band; lane 2) 5 pg peroxidase marker.
`D. Color development of nitrocellulose filters showin
`roxidase activity in the
`.-- of diaminobenzidine and 0.003% 02. Lane 1) 0.06,
`0.008 and 0.004 pmoles
`_i » roxidase; lane 2) 0.05 pmoles of S '—[5‘3P mer—ss—p-eroxidase.
`
`=..—-.«
`
`
`
`‘ '- l
`
`I
`
`' 3 gel electrophoresis on 6% polyacrylamide (Fig. 7 A). The yield of 5 ’-[RP]-MDV-1
`
`j‘ - ' -m-peptide A ranged from 40% to 50%.
`;=_,; of5'- 32!’ -I6mer-ss-hr-ad kinln
`
`' 20-30,153 of lhiolated bradykiuin in 60 pl of HPLC buffer (0.1 mM EDTA at pH 6.9)
`.mM) was mixed with 1-5 ng of 5 ’-(2-pyr)-ss-[32P]-16mer and concentrated in a speed-vac
`" ' ntrator. The reaction mixture was suspended in 10 pl of Tris-EDTA buffer at pH 7.2
`
`__f'»a]]owed to stand ovemight at room temperature. The product was purified by denaturing
`electrophoresis on 20% polyactylarnide (Fig. 6 B). The yield of 5 ‘-[32P]-16mer-ss-
`_' ~ .ll ‘ ranged front 30% to 50%.
`r --.- ol5‘- 32!’ -16mer-ss- eroxldase
`_- 4-5 pg of thiolated peroxidase («-0.1 nmolc) in 60 pl of eiution buffer (50 mM sodium
`
`3679
`
`Page 11 of 23
`
`
`
`Page 11 of 23
`
`

`
`Nucleic Acids Research
`
`
`
`'-BPB
`
`I
`
`re 9: Autoradio arns of A. denaturing 20% gel showing formation of 5’~[32P]—16mer-ss-.
`Fi
`after reaction of
`'-(2-
`)-ss-[RP]-16mer with ~20 pM thiolatedll G overnight at pH 7.2"
`Ig
`and room temperature.
`e faster migrating band has same rnobi ity as a S -(2-pyr)-ss-
`[-VP]-16mer marker (not shown).
`B. 6% denaturing el showing fractions of the above reaction mixture eluted from a
`DEAE column:
`lane 1% fraction eluted with 0.5 M TEAB buffer. H 7.3 before D'I'I‘
`treatment; lane 2) same as lane 1 after reaction with 10 mM DTT at pH .2 for 1 hour;
`lanes‘-'
`3) and 4) fractions eluted successively with 1 M TEAB, pH 7.8.
`
`phosphate pH 6.9 and 1 mM EDTA) (-2 ;:M) were mixed with 3-30 ng of 5 ’—(2-pyr)-ss-.
`[32P]-16mer and concentrated in a speed-vac concentrator. The reaction mixture was then
`
`suspended in 10 pl of Tris-EDTA buffer at pH 7.2 and incubated overnight at room
`
`temperature. An aliquot of the reaction mixture was analyzed by gel electrophoresis on 20%
`polyacrylamide to determine the yield of product. The product is visualized at the origin
`(Fig. 8 A). The remaining 5 ’-[RP]-16mer-ss-peroxidase was separated from peroxidase and
`S '-(2-pyr)-ss-[32P]-16mer by denaturing gel electrophoresis on 6% polyacrylamide (Fig. 8 B).
`The electrophoresis was not terminated until the xylene cyanol marker had migrated at least
`3'7 cm from the origin. The band oontaining 5 ’—[33P]-lémer-ss-peroxidase was then removed:
`
`'
`Urea was removed from the gel by extracting for several hours with extraction buffer that
`not contain SDS. 5 ’-[32P]-16mer-ss-peroxidase was extracted with the same buffer containing:
`
`3680
`
`Page 12 of 23
`
`
`
`Page 12 of 23
`
`

`
`Nucleic Acids Research
`
`1
`
`In
`
`—x-c
`
`10: Autoradiograrns of denaturi\nfi)6% gel showing:
`_‘--
`_ _A. Lane 1) formation of 5 ’—[”P —
`V-1 RNA—ss—HgG after treatment of 5 ’—(2—pyr)—ss—
`__ji* V-1 RNAD:r1]'_-t‘l"1,~%(g}‘;Ir..Il\‘évIx.thiolated gG overnight at p
`7.2 and room temperature; lane 2)
`h?
`-$-
`—
`_ mane reaction mixture as lane 1 (above ap lied to a DEAE column. Fractions were
`-_
`'
`- from the DEAE column with 50 mM ris- mM EDTA pH 7.5 buffer containing
`:
`'
`concentration of NaCl; lane l)Frac1ion eluted with 0 M Na 1, before treatment
`DTF; lane 2) same as lane 1 after treatment with 10 mM DTT for 1 hour at pH 7.2;
`lane
`.“ -t =.- .- n eluted with buffer containing 0.6 M NaCl.
`
`
`
`L; SDS. The remaining 6% gel was then stained with Coumassie blue. 5 pg of a
`marker in a neighboring lane that was stained with Coumassie blue had a lower
`; 'ty than the product, 5 ’-[32P]-l6rner-ss-peroxidase (Fig. 3 C).
`is of5'- 331' —1tsmet-—ss—r
`10-100 pmoles of 5’-(2-py'r)—ss—[32P}—16mer (1n,00o—1oo,mo cpm) were dialyzed against a
`._'= of buffer containing 1 mid Tris and 0.1 mM EDTA at pH 7.0 for 30 minutes. 40 pg of
`
`tr :1 human IgG in 0.2 ml of HPLC elution buffer (5 mM bis-tris acetate pH 5.8, 50 mM
`and 1 mM EDTA) (1 pm IgG) was then added to the 5 ’-(2-pyr)~ss—[32P}-lémer in the
`
`.
`
`_--wt. bag. The mixture was dialyzed against 1 liter of buffer containing 1 mM Tris, 0.1 mM
`A and 2 mM NaCl at pH 7.0 for 30 minutes and then concentrated in a speed-vac
`
`mater. The reaction mixture was then dissolved in 10 pl of Tris-EDTA buffer at pH 7.2,
`
`3681
`
`Page 13 of 23
`
`
`
`Page 13 of 23
`
`

`
`
`
`Nucleic Acids Research
`
`
`
`
`Coumassie blue. The column was then washed with 5 H113 of the same buffer containing 0.2 M
`NaCl and then again with buffer containing 0.4 M NaCl. 5 ’—[32P]—MDV—1 RNA—ss—IgG was
`eluted with 5 H115 of buffer containing 0.5 M NaCl and unreacted 5 "'-"(Z-pyr)-ss-[32P}-MDV-1
`RNA with buffer containing 0.5 M NaCl. The yield of 5 ’-[32P]—MDV—1 RNA-ss-IgG ranged
`from 30% to 50%. Fractions containing 5 ‘-[MP]-MDV-1 RNA-ss-IgG or 5 ’-(2-pyr)-ss-
`PIP]-MDV-1 RNA were pooled and desalted and concentrated with 20 pg BSA carrier in an
`Amicon 30 microconcentrator.
`
`and allowed to stand overnight at room temperature. An aliquot was analyzed by denaturing
`gel electrophoresis on 20% polyacrylamide to determine the yield of 5 '-[32P]-lfirner-ss-IgG
`(Fig. 9 A). The remainder was applied to an 0.7 it 4 cm DEAE column. Elution of product
`
`and starting materials was carried out with increasing concentrations of tricthylammoniurn
`
`bicarbonate (TEAB) buffer. pH 7.8. The unreacted protein eluted with 5 rnls of 0.25 M
`
`TEAB. This was confirmed by gel electrophoresis of an aliquot of this traction on 6%
`polyacrylamide followed by staining with Coumassie blue. The 5 '-[3213]-lémer-ss-IgG was
`
`eluted with 5 mls of 0.5 M TEAB and the unreacled oligomer with 5 mls of 1 M TEAB. The
`
`volatile buffer was evaporated from the product in a speed-vac concentrator in the presence of
`50 pg of carrier BSA. 5’-[32P]—16mer-ss-IgG and 5 ’~(2-pyr)-ss—[32I’]-16mer could also be
`eluted off the DEAE column with 5 n1ls of 50 mM Tris buffer, pH 7.5, containing 0.25 M and
`
`0.4 M NaCl, respectively.
`
`Smthesls ors'.[3“-P]-Mnv-1 RNA-se-Igg
`20.000.40.000 cpm ot‘ 5 ‘-(2-pyr)~ss-[32P]-MDV-1 RNA were treated with thiolated IgG
`using the same procedure described for the synthesis of 5 ’-[32P]—16mer-ss-IgG. After
`
`completion of the reaction. an aliquot of the reaction mixture was analyzed by gel
`electrophoresis on 6% polyacrylamide to determine the yield of 5’-[32P]-MDV-1 RNA-ss-IgG
`(Fig. 10 A). The remainder of the reaction mixture was loaded onto an 0.7 it 4 cm DEAE
`
`column packed with buffer containing 50 mM Tris. pH 7.5, and 1 mM EDTA. Protein
`
`unattached to MDV-1 RNA was eluted with 5 mls of the starting buffer. This was confirmed
`
`by gel electrophoresis of an aliquot on 6% polyacrylamide followed by staining with
`
`Methods
`
`High performance liquid chromatography (HPLC) of oligonucleotides was usually.
`
`performed on RPC—5 at pH 12, using a perchlorate gradient as previously described (16)._
`
`5 '-(2—pyr)—ss—16tner was separated from 5 '-cystamine—16rner by HPLC on RI-‘C-5 at pH 8,4
`
`using a 0.02-0.4 M perchlorate gradient in 30 mins. The 5 ’-cystamine MDV-1 RNA was
`
`separated from unreacted cystamine by gel electrophoresis or by HPLC on a SynChropak,-
`
`GPC 60 gel exclusion column (Western Analytical Products) by elution with 0.1 mM EDTA at;
`
`pH 7. DEAE Sephadex was converted to the bicarbonate form by incubation with 1
`
`'
`
`sodium bicarbonate overnight and then repeatedly washed with water. Electrophoresis was-
`
`carried out on 0.5-1.0 mm thick 6% or 20% polyaerylamide gels, cast and run in 90 min T '
`
`borate. pH 8.0, and 1 mM EDTA, with or without 7 M urea. Autoradiographs of gels were;
`
`Page 14 of 23
`
`
`
`Page 14 of 23
`
`

`
`Nucleic Acids Research
`
`It « by exposure to Kodak X-Omat AR film at ~80°C with or without a Du Pont Cronex
`
`WI ‘g Plus intensifying screen.
`
`‘ RNAS were precipitated from solution by the addition of 2 volumes of ethanol at -80°C
`'f.=l. presence of 100 mM NaCl. All RNA and oljgonucleotide adducts were extracted from
`_‘
`_ with 500 mM ammonium acetate, pH 7.2, 0.1 mM EDTA, and 0.01% SDS, except the
`
`I
`
`"'2 2-pyr)-ss-adducts, which were extracted with buffer containing 100 mM Tris and 1 mM
`-- A at pH 7. They were then purified by passage through 21 Du Pont Nenscrbzo nucleic
`": purification cartridge. RNA and 16mer peptide or protein adducts were purified after gel
`
`Z :
`
`tion or cluticn from DEAE by passage through an Amicon 10 or Amicon 30
`
`tubing (Spectrum) 1000 m.w. cutoff was treated with acetic anhydride for 1 hour
`
`ithen washed with 2% NaHCO3 and 1 mM EDTA (17).
`(ms with Dithiothreitol
`
`
`
`i e - t ncentrator.
`
`Adducts linked via a disulfide bond were reduced by reaction for 1 hour at room
`
`rature with 10 mM DTT in Tris—EDTA buffer at pH 7.2. Reduction of disulfide bonds
`
`cl :1 minimum concentration of 5 mM DTT and could be maintained in the reduced
`
`_-_. with 0.1 111M D'IT.
`__; lntien tits‘. “P -l6|ner and s‘-P-renter-ss.s’. “P -MDV-1 RNA to Ml3m18 DNA
`
`":-
`
`Hybridization procedures described by Meinlcoth and With] (18) were used to immobilize
`
`'« as = ded M13mp18 (+) DNA on nitrocellulose filters. Filters containing 100, 10 and 1
`-, -single-stranded M13mp18 DNA and 100 ng 1 DNA were pre-hybridized for 1 hour at
`in hybridization buffer (900 mM NaCl. 6 rnM EDTA, 90 mM Tris, pH 7.5, 0.1% SDS)
`
`.~v= "mg 200 pgfml honiiochrornatography mix I (randomly cleaved RNA) (19).
`'._.i=t
`'dization was carried out overnight at 32°C with approximately 7,000 cpm of
`P]-ltimer ((10045 pmole or 0.025 ng per ml). 5‘-P-16mer-ss-S '-[3‘3P]-MDV-1 RNA
`H on H ately 0.0045 pmole or 0.36 ng RNA per ml), or 5 '-[32P]-cystamine-MDV-1 RNA
`1
`pmolc or 0.34 rig RNA per ml). The filters were then washed several times with
`
`(180 mM NaCl, 10 mM Nazl-IP04 and 1 mM EDTA, pH 7.5) containing 0.1% SDS
`-N!’
`‘_‘i- rm temperature. After drying, the filters were autoradiographed.
`
`. After removal of the filters. the hybridization fluid containing unhybridized material was
`
`’
`
`-
`
`.
`
`through an Amicon 30 microconcentrator. An aliquot of the recovered material was
`d by gel electrophoresis to test the stability of 5 '-P-ltimer-ss-5 ’-[32P]-MDV-1 RNA
`
`.0 _ hybridization conditions.
`H‘... -lntlnn of 5 '—P-16mer-ss-5 '- RP -MDV-1 RNA to a com lementa
`
`37mer
`
`0.03 pmoles of the target 37mer, or 0.03 pmole of a non-complementary 25mer were
`
`"at at 95°—100°C for 1 minute and rapidly chilled before addition of 0.02 prnole of 5 ’-P-
`‘-[3213]-MDV-1 RNA or 5 '-cystamine—[32P]-MDV-1 RNA. Hybridization was
`- out for 7 hours at 25°C in buffer (10 pl) containing 50 mM Tris at pH 7.2, 1 mM
`
`500 mM NaCl and 20 pg randomly cleaved RNA (19). The 5 ’—P—16rner—ss—
`
`3683
`
`Page 15 of 23
`
`
`
`Page 15 of 23
`
`

`
`Nucleic Acids Research
`
`
`5 ‘-[33P]-MDV-1 RNA!37n-ier hybrid was separated from non—hybridized 5 '—P—16mer—ss—
`5 '«[3zP]-MDV-1 RNA by electrophoresis on a 6% gel under non-denaturing conditions at
`120 v. (6 me) for 15 hours.
`Measurement of Thtol Concentrations
`
`Thiol concentrations were measured acmrdjng to the method of Ellrnan (20).
`
`Measurement of Peroxidase Activity
`
`Nitrocellulose filters were pre—wetted with buffer containing 10 mM Tris (pH 8) and
`
`150 mM NaCl and then dried. 1 pl aliquots containing up to 10 ng of peroxidase or tltiolated
`
`peroxidase were then spotted on the filters. The filters were then submerged in 20 mls of
`
`phosphate—buffered saline at pH 7.2 containing 0.5 mg/ml diaminobenzidine and 0.003%
`
`H202 (14). In this assay spots containing 0.5 ng or more of peroxidase were seen as colored
`brown spots.
`Bindin of 5‘-
`
`32p
`
`
`
`-16mer-ss-human I G or 5'-
`
`
`
`
`
`“P -MDV-1 RNA-ss-human-I G to: __
`
`
`
`Complententag anti-human IgG
`
`Antibody-binding assays were carried out by coating wells of an ELISA plate with 100 pl
`of goat anti—hurnan IgG (5 pg/ml) in borate-buffered saline containing 1D‘3 EDTA at pH 8.4.
`The wells were incubated overnight at 4°C. The anti-1gG solution was then removed and the-
`
`.
`
`wells blocked by the addition of 200 pl of borate-buffered saline containing 1 mM EDTA and ;
`
`1% BSA. After incubation for 1 hour at room temperature, the wells were emptied and-
`
`washed twice with 100 pl of borate-buffered saline containing 1 mM EDTA. 100 pl of DEAE
`purified 5 ‘-[32P]-16rner-ss-IgG, 5 '-(2-pyr)-ss-[32P]-16mer, 5 '-[31p]-1vmv—1 RNA-ss-IgG or-
`5 ’-(2-pyr)-ss-[32P]~MDV-1 RNA (300-600 cpm) were then added to the coated wells and the
`wells incubated overnight at 4°C. The solutions were then removedand the wells washed with
`100 pl of borate buffered saline. The amount of radioactivity contained in the supernatant
`fraction and the amount attached to the wells were measured in a scintillation counter.
`
`RESULTS AND DISCUSSION
`
`Formation of 5 '£1stan1Ine-P-16rner
`
`The 5 ‘-cystamine-P-16mer could be made directly from the 5’-P-lfirner in a one-step
`
`synthesis in the presence of carbodiimidc. Lmcthylimidazole and cystamine. The
`
`1-methylirnidazole adduct of 5 '-P-ltimer is formed as a transitory intermediate, and
`
`subsequently reacts with cystamine to form a stable product. The yield of the 5 ’-eystamine-P-‘i
`16mer from the S '-P-16mer was 75 % to 85%.
`
`To show that carbodiirnide does not react with the disulfide group, a sample of
`
`5 ‘-cystamine-P-16mer was made by first isolating the stable 5 ’-irnidazolide adduct of 5 ‘-1’
`
`16me