`Nelson
`
`llllllllllllllllllllllIllllllllllllllllllllllllllllllllllllllllllllllllllll
`5,141,813
`Aug. 25, 1992
`
`US005141813A
`[11] Patent Number:
`[45] Date of Patent:
`
`[56]
`
`[54] MULTIFUNCI'IONAL CONTROLLED PORE
`GLASS REAGENT FOR SOLID PHASE
`OLIGONUCLEOTIDE SYNTHESIS
`[75] Inventor:
`Paul S. Nelson, Union City, Calif.
`[73] Assignee:
`Clontech Laboratories, Inc., Palo
`Alto, Calif.
`[21] Appl. No.: 399,658
`[22] Filed:
`Aug. 28, 1989
`[51] Int. Cl.5 ..................... .. C07H 1/00; C07H 21/04;
`C03C 12/00; CO7C 211/02
`[52] US. Cl. .................................. .. 428/402; 560/155;
`536/27; 536/28; 536/29; 501/33
`[58] Field of Search ..................... .. 536/27, 28, 29, 23;
`435/6; 501/33; 560/155; 428/402
`References Cited
`PUBLICATIONS
`Saili, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. R.
`Horn, H. A. Erlich', and N. Arnheim (1985) “Enzymatic
`Ampli?cation of B-glogin genomic sequences and re
`striction site analysis for diagnosis of sickle cell ane
`mia”, Science 230: 1350-1354.
`Embury, S. 1-1., S. J. Scharf, R. K. Saiki, M. A. Gholson,
`M. Golbus, N. Arnheim, and H. A. Erlich (1987)
`“Rapid prenatal diagnosis of sickle cell anemia by a new
`method of DNA analysis,” N. Engl. J. Med.
`316:656-660.
`Lin, B, B. Hjelle, R. Morgan, F. Hecht, and J. M.
`Bishop (1987) “Mutations of the Kirsten- ras proto—on
`cogene in human preleukaemia,” Nature 330:186-188.
`Rodenhuis, S., M. L. van de Wetering, W. J. Mooi, S.
`G. Evers, N. van Zandwijk and J. L. Bos (1987) “Muta
`tional activity of the K-ras oncogene,” N. Engl. J. Med.
`' 317:929-935.
`
`Agrawal, 5., C. Christondoulou, and M. J. Gait (1986)
`“Efficient methods for attaching non-radioactive labels
`to the 5' ends of synthetic ologodeozyribonucleotides,”
`Nucl. Acids Res. 14:6227-6245.
`Connolly, B. -A. (1987) “The synthesis of oligonucleo
`tides containing a primary amino group at the 5’-ter
`minus,” Nucl. Acid Res.l5:313l—3l39.
`Jablonski, E., E. W. Moomaw, R. H. Tullis, and J. L.
`Ruth (1986) “Preparation of oligodeoxynucleotide-alk
`
`aline phosphatase conjugates and their use as hybridiza
`tion probes," Nucl. Acids Res. 14:6115-6128.
`Haralambidis, J., M. Chai, and G. W. Tregear (1987)
`“Preparation of base-modi?ed nucleosides suitable for
`non-radioactive label attachment and their incorpora
`tion into synthetic oligodeoxyribonucleotides," Nucl.
`Acids Res. 15:4857-4876.
`Li, R, P. P. Medon, D. C. Skingle, J. A. Lanser, and R.
`H. Symons (1987) “Enzyme-linked synthetic oligonu
`cleotide probes: non—radioactive detection of entero
`toxigenic. Echerichia coli in faecal specimens,” Nucl.
`Acid Res. 15:5275-5287.
`Smith, L. M., S. Fung, M. W. Hunkapiller, T. J. Hun
`kapiller, L. E. Hood (1985) “The Synthesis of oligonu
`cleotides containing an aliphatic amino group at the 5'
`terminus: synthesis of ?uorescent DNA primers for use
`in DNA sequence analysis,” Nucl. Acids Res.
`13:2399-2412.
`'
`
`Sproat, B. S., B. Beijer, and P. Rider (1987) “The syn
`thesis of protected 5'~mercapto—2', 5'-dideoxyribonu
`cleoside-3'-O-phosphoramidites; uses of 5'-mercap
`to-oligodeoxyribonucleotides,” Nucl. Acids Res.
`15:4837-4848.
`Ansorge, W., B. Sproat, J. Stegemann, C. Schwager,
`and M. Zenke (1987) “Automated DNA sequencing:
`(List continued on next page.)
`
`Primary Examiner-Johnnie R. Brown
`Assistant Examiner—-Gary L. Kunz
`Attorney, Agent, or Firm--Saliwanchik & Saliwanchik
`
`ABSTRACT
`[57]
`The subject invention concerns a novel multifunctional
`solid support reagent which is useful in solid phase
`oligonucleotide synthesis. Speci?cally, the reagent is
`used in a solid phase oligonucleotide process to chemi
`cally modify the 3’ terminus of a synthetic oligonucleo
`tide with any chemical functional group. The invention
`reagent can be used to construct 3’ labeled oligonucleo
`tide hybridization probes to detect the presence of a
`target polynucleotide in biological and clinical samples.
`
`2 Claims, 6 Drawing Sheets
`
`OH
`
`1.
`2.
`
`Succinic anhydride, DMAP
`p-nitzophencl, DCC
`
`ODIIT o
`
`O
`
`O
`
`l 1. alkylamine—LC-CPG
`
`2. nczo. DMAP-PY!
`
`
`
`Page 1 of 15
`
`ILMN EXHIBIT 1011
`
`
`
`5,141,813
`Page 2
`
`OTHER PUBLICATIONS
`
`ultrasensitive detection of ?uorecent bands during elec
`trophoresis,” Nucl. Acids Res. 15:4593-4602.
`Sproat, B. S., B. Beijer, and P. Rider‘ (1987) “The syn
`thesis of protected 5'-dideoxyribonucleoside—3'-O—~
`phosphoramidites; application of 5'-aminooligodeox
`yribonucleotides,” Nucl. Acids. Res. 15:6181—6196.
`Sinha, N. D. and R. M. Cook (1988) “The preparation
`and application of functionalised synthetic oligonucleo
`tides: III. Use of H-phosphonate derivatives of pro
`tected amino-hexane] and mercapto-propanol or -hex
`anol,” Nucl. Acids Res. 16:2659-2669.
`
`Lemaitre, M., B. Bayard, and B. Lebleu (1987) “Spe—
`ci?c antiviral activity of a poly(L-lysine)—conjugated
`oligodeoxyribonucleotide sequences complimentary to
`vesicular somatitis virus N protein mRNA initiation
`site,” Proc. Natl. Acad. Sci. USA 84:648-652.
`Lemaitre, M., C. Bisbal, B. Bayard, and B. Lebleu
`(1987) “Biological activities of oligonuclotides linked to
`poly(L-lysine),”
`Nucleosides
`and
`Nucleotides
`6:311-315.
`Zuckerman, R., D. Corey, and P. Schultz (1987) “Eff
`cient methods for attachment of thiol speci?c probes to
`the 3’ ends of synthetic oligodeoxyribonucleotides,”
`Nucl. Acids Res. 15:5305-5321.
`‘
`
`
`
`Page 2 of 15
`
`
`
`US. Patent
`
`Aug. 25, 1992
`
`Sheet 1 of 6
`
`5,141,813
`
`@20 u<o
`
`.w o 0 +12 0
`
`
`
`_ :2 o-h:a
`
`H ohsmwm
`
`umu-mz
`
`o
`
`
`
`. zzuoem
`
`
`
`Page 3 of 15
`
`
`
`US. Patent
`
`Aug. 25, 1992
`
`Sheet 2 of 6
`
`5,141,813
`
`FIG.2A ‘we
`
`' r 44.866
`
`II
`
`Ill
`
`"1‘.
`
`0.606 F
`
`
`
`Page 4 of 15
`
`
`
`U.S. Patent
`
`Aug. 25, 1992
`
`Sheet 3 of 6
`
`5,141,813
`
`FIGURE 3A
`
`
`
`Page 5 of 15
`
`
`
`U.S. Patent
`
`Aug. 25, 1992
`
`Sheet 4 of 6
`
`5,141,813
`
`' FIGURE 35
`
`
`
`Page 6 of 15
`
`
`
`US. Patent
`
`Aug. 25, 1992
`
`Sheet 5 of 6
`
`5,141,813
`
`FIGURE 3C
`
`
`
`Page 7 of 15
`
`
`
`US. Patent
`
`Aug. 25, 1992
`
`Sheet 6 of 6
`
`5,141,813
`
`FIGURE 3D
`
`
`
`Page 8 of 15
`
`
`
`1
`
`5,141,813
`
`MULTIFUNCI'IONAL CONTROLLED PORE
`GLASS REAGENT FOR SOLID PHASE
`OLIGONUCLEOTIDE SYNTHESIS
`
`15
`
`20
`
`25
`
`BACKGROUND OF THE INVENTION
`Single base substitutions in human genes are the cause
`or are strongly associated with a variety of human dis
`cases such as the hemoglobinopathies (Saiki, R. K., S.
`Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A.
`Erlich, and N. Arnheim [1985] Science 230:1350-1354;
`Embury, S. H., S. J. Scharf, R. K. Saiki, M. A. Gholson,
`M. Golbus, N. Arnheim, and H. A. Erlich [1987] N.
`Engl. J. Med. 316:656-660) and cancer (Liu, E., B.
`Hjelle, R. Morgan, F. Hecht, and J. M. Bishop [1987]
`Nature 330:186-188; Rodenhuis, S., M. L. van de Wet
`ering, W. J. Mooi, S. G. Evers, N. van Zandwijk, and J.
`L. Bos [1987] N. Engl. J. Med. 317:929-935). Previ
`ously, if no convenient restriction sites were altered by
`the base change, then the only recourse has been to
`clone and sequence the affected gene. Recently, poly
`merase chain reaction (PCR) ampli?cation of the DNA
`segment in question, coupled with hybridization of spe
`ci?c oligonucleotide probes, has allowed sequence de
`termination without the need for molecular cloning.
`The applicability of the latter technique is dependent on
`the availability of versatile and inexpensive oligonucle
`otide probes.
`Methods to covalently attach labels and reporter
`molecules to oligonucleotides have permitted their use
`as non-radioactive hybridization probes. New technolo
`gies in non~isotopic gene probes (Agrawal, S., C. Chris
`todoulou, and M. J. Gait [1986] Nucl. Acids Res.
`14:6227-6245; Connolly, B. A. [1987] Nucl. Acids Res.
`15:3131-3139; Jablonski, E., E. W. Moomaw, R. H.
`Tullis, and J. L. Ruth [1986] Nucl. Acids Res.
`14:6115-6128; Haralambidis, J., M. Chai, and G. W.
`Tregear [1987] Nucl. Acids Res. 15:4857-4876; Li, R,
`P. P. Medon, D. C. Skingle, J. A. Lanser, and R. H.
`Symons [1987] Nucl. Acids Res. 15152756287), DNA
`40
`sequencing analysis (Smith, L. M., S. Fung, M. W.
`Hunkapiller, T. J. Hunkapiller, and L. E. Hood [1985]
`Nucl. Acids Res. l3:2399—24l2; Sproat, B. S., B. Beijer,
`P. Rider, and P. Neuner [1987] Nucl. Acids Res.
`15:4837-4848; Ansorge, W., B. Sproat, J. Stegemann, C.
`Schwager, and M. Zenke [1987] Nucl. Acids Res.
`15:4593-4602), electron microscopy (Sproat, B. S., B.
`Beijer, and P. Rider [1987] Nucl. Acids Res.
`15:6181-6196), and X-ray crystallography (Sproat et al.
`[1987] Nucl. Acids Res. 15:4837-4848) have provided
`impetus for the development and improvement of such
`methods. As applications continue to emerge, more
`convenient oligonucleotide labeling techniques and
`reagents will be required.
`Current methods to introduce chemical modi?cations
`into oligonucleotides employ special phosphoramidite
`reagents during solid phase synthesis. Attention has
`focused on the 5’ terminus and a number of protected
`amino-alkyl phosphoramidites have been reported
`(Agrawal et al., supra; Connolly, supra; Jablonski et al.,
`supra; Smith et al., supra; Sproat et al. [1987] Nucl.
`Acids Res. 15:6181-6l96; Sinha, N. D. and R. M. Cook
`[1988] Nucl. Acids Res. l6:2659—2669) to incorporate a
`5’ terminal aliphatic primary amine. Oligonucleotides
`modi?ed by these reagents can be subsequently deriva
`tized with fluorophores, biotin, and other molecules.
`Similarly, phosphoramidite reagents have also been
`described which incorporate a thiol functionality on the
`
`35
`
`45
`
`50
`
`55
`
`65
`
`2
`5’ terminus (Sproat et al. [1987] Nucl. Acids Res.
`15:4837-4848; Ansorge et al., supra; Connolly, B. A.
`[1985] Nucl. Acids Res. 13:4484-4502).
`Techniques modifying the 3’ terminus are inconve
`nient and tedious. Lemaitre et al. (Lemaitre, M., B.
`Bayard, and B. Lebleu [1987] Proc. Natl. Acad. Sci.
`USA 84:648-652; Lemaitre, M., C. Bisbal, B. Bayard,
`and B. Lebleu [1987] Nucleosides and Nucleotides
`6:311-315) have described the attachment of a ribonu
`cleoside to the 3‘ terminus of an oligonucleotide using
`T4 RNA ligase. Terminal 3' modi?cation was achieved
`after periodate-oxidation of the ribose ring followed by
`reductive amination. Another procedure by Zuckerman
`et al. (Zuckerman, R., D. Corey, and P. Schultz [1987]
`Nucl. Acids Res. 15:5305—532l) incorporates a 3' termi
`nal thiol group via solid phase oligonucleotide synthe
`sis. Although this procedure is more efficient, it requires
`many synthetic steps and puri?cations. Thus, there re
`mains a need for a simple and efficient method to syn
`thesize 3' labeled oligonucleotides.
`BRIEF SUMMARY OF THE INVENTION
`The subject invention concerns a reagent for use in
`solid phase oligonucleotide synthesis having the follow
`ing structure:
`
`c
`
`R|O_Y
`
`X-W
`
`wherein:
`C=carbon atom;
`W=any solid such as controlled pore glass (CPG
`[CPG Biosupport, Inc., Fair?eld, NJ]), alkylamine
`CPG, wherein alkyl can be from 1 to 50 carbon atoms,
`and isomeric forms thereof, any chemical modi?cation
`of CR6, wherein the modi?cation can be amines, hy
`droxyls, carboxyls, sulfhydryls, or disul?des, polysty
`rene and any solid support stable to all the conditions of
`solid phase oligonucleotide synthesis; W can also be a
`non-solid phosphoramidite group, —OP(OR3)NR4R5,
`wherein R3=—CH3, —CHZCHZCN, or alkane of l to
`50 carbon atoms, inclusive, and isomeric fonns thereof,
`and R4, R5=methyl, ethyl, isopropyl, or alkane as de
`?ned above (if W is a non-solid phosphoramidite group
`it is not restricted to the 3’ terminus);
`X=a cleavable linking arm connecting carbon C to
`W which can be any combination of atom groups (e.g.,
`—(CHZ)n_s —OCO—, —COZ, —NHCO—,
`—CONH—) that covalently connects to the solid phase
`(W) through a cleavable linkage, and is stable to all the
`conditions of solid phase oligonucleotide synthesis.
`Cleavable linkages include esters which are cleaved
`with ammonium hydroxide and disul?des which are
`cleaved with reducing agents. After oligonucleotide
`synthesis, cleavage of X from the solid phase results in
`the transfer of the entire multifunctional linking arm to
`the 3’ terminus of the synthesized oligonucleotide. Pref
`erably, X=—O—-CO—CH2—CH2—CO-— (succinic
`acid) which is readily cleaved from the solid phase with
`ammonium hydroxide;
`Y=a linking arm connecting carbon C to R1O— that
`is at least one carbon atom long and can be any combi
`nation of atom groups (e.g., —(CHz),,—, —OCO—,
`--CO2, —NHCO—, —CONH—) that covalently con
`
`
`
`Page 9 of 15
`
`
`
`5,141,813
`3
`4
`nects to OR] and is stable to all the conditions of solid
`Thus, the subject invention concerns a novel multi
`phase oligonucleotide synthesis;
`functional controlled pore glass reagent (MF-CPG ®)
`Z=a linking arm connecting carbon C to Rz-A
`(FIG. 1), useful to incorporate 3’ terminal primary ali
`vthat is at least one carbon atom long and can be any
`phatic amines into synthetic oligonucleotides. MF
`combination of atom groups (e.g., —(CH2),,—,
`CPG® comprises a unique succinic acid linking arm
`—OCO—, —COZ, —NHCO—-, —CONH—) that con
`which possesses both a masked primary amine for label
`valently connects to AR; and is stable to all the condi
`attachment and a dimethoxytrityl protected hydroxyl
`tions of solid phase oligonucleotide synthesis;
`for nucleotide chain elongation. Using MF-CPG ®, a
`R1O=a protected hydroxide group where R] is a
`simple and convenient technique has been devised to
`base stable-acid labile hydroxyl protecting group, e.g.,
`attach non~radioactive labels to the 3’ terminus of oligo
`R1 can be monomethoxytrityl (MMT) or dimethoxytri
`nucleotides. Bifunctional probes can then be con
`tyl (DMT);
`structed by 32P labeling the 5’ terminus with T4 kinase
`A=—NH—, —S—-, or any functional group that is
`and gamma 32P-ATP. Using such bifunctional oligonu
`capable of attaching a reporter molecule or any detect
`cleotide probes in conjunction with PCR ampli?cation,
`able complex;
`a person can detect a single base substitution in a target
`Rg=corresponding protecting group for A'that is
`DNA segment. Exempli?ed herein is the detection of a
`stable to all the conditions of solid phase oligonucleo
`single base substitution of the human‘H-ras protoonco
`tide synthesis; and '
`gene employing either functionality. The invention
`B=H, —CH3, —Z—A—R2, —Y-ORl, or any com
`technique thus expands the potential applications for
`bination of atom groups that are inert to solid phase
`oligonucleotides as hybridization probes.
`oligonucleotide synthesis.
`Speci?cally exempli?ed herein is MF-CPG ® (3'
`Amine-ON CPG) wherein, with reference to (I) above,
`W=long chain alkyl amine CPG; X=—O—CO—CH
`25
`2—CO—; B = H; Y = —CH2—-; Z = —CH2—;
`A=—NH—; Rz=9-?uorenylmethyl (Fmoc), tri?uoro
`acetyl (TFA), or any base labile-acid stable amine pro
`tecting group; and R1=DMT.
`The structure of MF-CPG ® (3' Amine-ON CPG) is
`as follows:
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`FIG. 1: The synthetic scheme for MF-CPG ®.
`FIG. 2: Analytical chromatograms of puri?ed 3’ bi
`otinylated I-I-ras oligonucleotide probes.
`FIG. 3: Detection of point mutations in the human
`I-I-ras gene using speci?c bifunctional oligonucleotide
`probes.
`
`15
`
`20
`
`DETAILED DISCLOSURE OF THE INVENTION
`Materials and Methods
`Long chain alkylamine CPG was purchased from
`Pierce Chemical Co. Biotin-XX-NHS ester, PCR am
`plimers, and the Gene-tact Non-Isotopic Detection
`System were obtained from Clontech Laboratories, Inc.
`Taq polymerase was acquired from Perkin Elmer Ce
`tus. HPLC was performed on a Rainin Rabbit HPX
`System using aquapore C8 reverse phase columns (Ap
`plied Biosystems, Inc.) for both preparative (lOOX 10
`mm) and analytical (30X4.6 mm) runs. A Biosearch
`Cyclone DNA synthesizer was used for oligonucleotide
`synthesis.
`The subject invention comprises a novel and simple
`method to synthesize 3' oligonucleotides. In conven
`tional solid phase DNA synthesis, the 3' terminal nucle~
`otide is pre-attached to the CPG support from the 3’
`hydroxyl through a succinimic acid linking arm, and the
`oligonucleotide is- synthesized from the 5’ hydroxyl
`repetitive cycles of chemical reactions. In the subject
`invention, a 3' primary aliphatic amine replaces the
`pre-attached nucleoside with a unique multifunctional
`linking arm to give a multifunctional CPG, MF-CPG ®
`(FIG. 1) which transfers a primary amine to the 3' ter
`minus of a synthesized oligonucleotide without chang
`ing any chemistry or adding extra steps. MF-CPG®
`possesses a uniquely engineered linking arm that com
`plies with four important criteria. First, the linking arm
`is attached to the CPG through an ester functionality
`that is readily cleaved with ammonium hydroxide treat
`ment. Second, the linking arm contains a masked pri
`mary aliphatic amine which is acid stable and resistant
`to all the reagents used in normal oligonucleotide syn
`thesis. Third, in addition to being acid stable, the amine
`protecting group is readily removed with ammonium
`hydroxide treatment. Fourth, the linking arm contains a
`dimethoxytrityl protected primary hydroxyl group for’
`oligonucleotide chain elongation. Hence, the method is
`
`30
`
`Fmoc-NH-Cl-lz H
`\
`/
`DMT-O-CHZ O-CO-CHZ-CHZ-CO-aIkylamine CPG
`
`35
`
`45
`
`wherein the alkyl of alkylamine can be from 1 to 50
`carbon atoms, inclusive, and isomeric forms thereof.
`The subject invention is useful in solid phase oligonu
`cleotide synthesis (both oligodeoxyribonucleotide and
`oligonucleotide) to chemically modify the 3’ terminus
`of a synthetic oligonucleotide with any chemical func
`tional group. Useful functional groups are primary
`amines, sulfhydryls, disul?des, and any other group
`typically used for conjugation of reporter molecules.
`Also, the subject invention can be used for attaching a
`label to a functional group introduced at the 3’ terminus
`of a synthetic oligonucleotide. Labels include any re
`porter molecules such as biotin, haptens, fluorophores,
`proteins, enzymes, and antibodies. Such modi?ed and
`labeled oligonucleotide probes can be used in any appli
`cation where the said probe hybridizes to complemen
`tary sequences of a target polynucleotide. Further, the
`invention can be used for detecting low copy genes by
`using the polymerase chain reaction (PCR) to amplify
`the target gene segment and then employing the inven
`tion for detecting the presence of speci?c polynucleo
`tide in samples containing the same, biological samples,
`and, for example, clinical samples such as serum and
`blood. Still further, the subject invention can be used
`for the diagnosis of infectious diseases and pathogens,
`detection of oncogenes, diagnosis of genetic disorders,
`and detection of point mutations or single base substitu~
`tions. The subject invention has utility in the areas of
`65
`anti-sense molecular biology, electron microscopy,
`X-ray crystallography, and site-speci?c cleavage of
`DNA.
`
`55
`
`
`
`Page 10 of 15
`
`
`
`20
`
`5,141,813
`5
`fully adaptable to commercial DNA synthesizers and is
`as easy as synthesizing normal oligonucleotides.
`Since a reporter molecule now can- be easily attached
`to the 3' terminus of any oligonucleotide, both the 5'
`and 3' termini can be used to label the oligonucleotide.
`Such bifunctional oligonucleotide probes are both sensi
`tive and speci?c in detecting single base substitutions in
`target DNA when used in conjunction with PCR. The
`sensitivity and speci?city are the same regardless of the
`detection system; autoradiography or colorimetric de
`tection with a streptavidin-alkaline phosphatase conju
`gate. The convenience of using MF-CPG® to non
`. isotopically label an oligonucleotide at the 3' terminus
`with subsequent 32?’ labeling at the 5' terminus makes
`this reagent an attractive alternative to current methods
`of functionalizing oligonucleotides. Thus, the invention
`technique expands the potential for applications em
`ploying functionalized oligonucleotides.
`The preparation of MF-CPG ® is outlined in FIG. 1.
`N-Fmoc-O-DMT-3-amino-l,2-propanediol was ?rst
`derivatized with succinic anhydride. The carboxyl
`group of the succinylated derivative was converted to a
`p-nitrophenyl ester and directly reacted with long chain
`alkylamine CPG to give MF-CPG ®. After capping,
`the loading capacity of MF-CPG ® was determined to
`be 27.8 pmol/ g.
`Two bifunctional oligonucleotide probes were con
`structed using MF-CPG® as follows: First, two 3’
`amino-modi?ed
`oligonucleotides,
`GGCGCCGGCGGTGTGGGCAA-X (H-ras, wild
`type) and GGCGCCGGCGATGTGGGCAA—X (H
`ras, codon 13 Asp) [X==3' primary amine modi?cation],
`were synthesized using MP-CPG. The coupling effi
`ciency of the ?rst nucleotide, which is indicative of 3'
`primary amine incorporation, was >97% in both cases.
`After standard cleavage and deprotection with ammo
`nium hydroxide, the crude 3’ amino-modi?ed oligonu
`cleotides were biotinylated with Biotin-XX-NHS ester.
`The long linking arm of Biotin-XX-NHS ester, a 14
`atom spacer (XX) consisting of two e~aminocaproic
`acid moieties linked in series, was used to make the
`biotins more available for detection. After size exclu
`sion on Sephadex G-25 (Pharmacia), the biotinylated
`oligonucleotides were puri?ed by preparative HPLC
`on a C8 reverse phase column. Analytical HPLC chro
`45
`matograms are shown in FIG. 2. The presence of biotin
`was con?rmed by a p-methylamino-cinnamaldehyde
`colorimetric test. Finally, the construction of the bi
`functional probes was completed by 32P labeling of the
`5’ ends with T4 kinase and gamma 32P-ATP.
`The applicability of these bifunctional oligonucleo
`tide probes was assessed in detecting single base substi
`tutions in the H-ras protooncogene. The probes used
`were speci?c either for the wild type H-ras sequence at
`condon 3 (GGT) or for the transforming mutant se
`quence at codon 13 (GAT) which substitutes aspartate
`for glycine. A IIO-base pair segment which includes
`codon 13 f the H-ras gene was ampli?ed from genomic
`DNA using the polymerase (PCR). By autoradiography
`(FIG. 3B), the condon 13 aspartate probe hybridized
`only with the ampli?ed DNA carrying the H-ras codon
`13 aspartate mutation and not with DNA from normal
`placenta, a transformed mouse ?broblast cell line
`(NIH3T3) harboring a mutant human H-ras gene with a
`codon 12 valine substitution (GTT), or with placental
`DNA ampli?ed in the region surround N-ras codons l2
`and 13. Hybridization with the wild type codon 13
`I-I-ras probe (FIG. 3A), however, showed a signal only
`
`6
`with ampli?ed DNA from normal placenta and the
`NIH3T3 cell line whose murine H-ras gene can also be
`ampli?ed using our current amplimers. Cross hybridiza
`tion between the human and mouse wild type H-ras
`genes was unexpected but may indicate that the sequen
`ces probed are identical in the two species.
`When the same hybridized ?lters were incubated
`with streptavidin-alkaline phosphatase and S-bromo-4
`chloro-3-indolyl-phosphate (BCIP), colorimetric sig
`nals were seen over the same slots exhibiting a radio
`graphic signal (FIG. 3C and 3D). Thus, when used in
`conjunction with PCR, these bifunctional probes are
`both sensitive and speci?c in detecting single base pair
`mismatches in target DNA. Furthermore, an oligonu
`cleotide probe from a single MF-CPG ® preparation
`can be either biotinylated or radiolabeled without com
`promising hybridization sensitivity.
`Following are examples which illustrate procedures,
`including the best mode, for practicing the invention.
`These examples should not be construed as limiting. All
`percentages are by weight and all solvent mixture pro
`portions are by volume unless otherwise noted.
`
`EXAMPLE 1
`Preparation of MF-CPG ®
`To a solution of N-Fmoc-O-DMT-3-amino-1,2
`propanediol (2.2 g, 3.5 mmol) and 4-dimethylaminopyri
`dine (200 mg, 0.9 mmol) in anhydrous pyridine (12 ml) .
`was added succinic anhydride (300 mg, 3 mmol). The
`reaction was stirred at room temperature for 17 hours.
`The consumption of starting material was followed by
`TLC using methanol-dichloromethane (1:49) as the
`mobile phase. The mixture was diluted in ethyl acetate
`(100 ml), washed with 0.5M sodium chloride (3x100
`ml) and saturated sodium chloride (1x100 ml), and
`dried over anhydrous sodium sulfate. After concentrat
`ing by rotary evaporation and drying under high vac
`uum (45° C.), 1.74 g of a yellow solid was obtained.
`The yellow solid was dissolved in dry dioxane (10 ml)
`containing anhydrous pyridine (0.5 ml) and p-nitr0-
`phenol (350 mg, 2.5 mmol). Dicyclohexylcarbodiimide
`(1.0 g, 4.8 mmol) was added and the mixture was stirred
`at ambient temperature. After a few minutes, dicy
`clohexylurea began to precipitate. The reaction was
`monitored by TLG (methanol-dichloromethane, 1:9)
`and after 3 hours, the dicyclohexylurea was collected
`by ?ltration. Long chain alkylamine CPG (5.0 g) was
`suspended in the ?ltrate containing the p-nitrophenyl
`ester derivative, triethylamine (1.0 ml) was added, and
`the mixture was shaken overnight at room temperature.
`The derivatized support was copiously washed with
`dimethylformamide, methanol, and diethyl ester and
`dried in vacuo. Before capping the unreacted alkyla
`mine groups, the loading capacity of the MF-CPG ®
`was assayed by determining the amount of dimethoxy
`trityl cation released upon treatment with perchloric
`acid according to published procedures (Oligonucleotide
`Synthesis: A Practical Approach, M. J. Gait (ed.), IRL
`Press, Oxford, 1984).
`Finally, capping of MF-CPG® was achieved by
`treatment with acetic anhydride-pyridine-DMAP
`(10:90zl. v/v/w) for one hour. The support was thor
`oughly washed with methanol and diethyl ether and
`dried under high vacuum to give 4.95 g of MF-CPG ®.
`The capped MF-CPG ® gave a negative ninhydrin test
`(Smith et al., supra).
`
`25
`
`30
`
`35
`
`40
`
`50
`
`55
`
`65
`
`
`
`Page 11 of 15
`
`
`
`5,141,813
`7
`3' Amine-ON TM CPG, prepared by the above pro
`cess, has the following structural formula:
`
`/ \
`DMT-O-CHZ O-CO- CH2—CH2— CO-alkylamine CPG
`
`>
`8
`CTCTATGGTGGGATCATATT (3’ N-ras am
`plimer) were used to amplify the same codon region of
`the N-ras gene. 1 ug of genomic DNA was ampli?ed in
`a 100 pl volume containing 50 mM KCl, 10 mM Tris
`(pH 8.3), 1.5 mM MgCIZ, 0.1 gelatin, 0.5 mM all four
`dNTPs, and 2.5 units Taq polymerase. The ?rst ampli?
`cation cycle included denaturation at 95° C. for 5 min
`utes, annealing at 55° C. for 2 minutes, and primer exten
`sion at 68° C. for 2 minutes. The remaining 35 cycles
`were performed with 2 minute incubation periods at
`each temperature.
`The generation of target DNA with an H-ras codon
`13 Asp mutation was accomplished by the method de
`scribed in Rochilitz et al. (Rochlitz, C. F., G. K. Scott,
`J. M. Dodson, and C. C. Benz [1988] DNA 71515-519).
`In this reaction, the sequence of the 3’ amplifying oligo
`mer has been noted above. The 5' amplimer, however,
`encompasses the 20 nucleotide sequence at condon 12
`and 13 of H~ras and contains a point mutation encoding
`a glycine to aspartate change in condon 13
`(GGCGCCGGCGATGTGGGCAA). DNA gener
`ated through PCR ampli?cation was used as target
`DNA in oligonucleotide hybridization analysis. In this
`manner, the ampli?ed DNA incorporates the oligonu
`cleotide with the codon 13 aspartate mutation.
`
`10
`
`25
`
`EXAMPLE 2
`Synthesis of 3' Biotinylated Oligonucleotide Probes
`Two
`3’
`amino-modi?ed
`oligonucleotides,
`GGCGCCGGCGGTGTGGGCAA-X (H-ras, wild
`type) and GGCGCCGGCGATGTGGGCAA-X (H
`ras, codon 13 Asp) [X=3’ primary amine modi?cation],
`were synthesized using MP-CPG on a Biosearch Cy
`clone DNA synthesizer. Standard columns were
`packed with l umol of MF-CPG ® and DNA synthesis
`was performed by suggested manufacturer protocols
`without any program changes. The coupling ef?ciency
`of the ?rst nucleotide was determined by measuring the
`deprotected dimethoxytrityl cation concentration.
`Solid support cleavage and deprotection were accom
`plished with concentrated ammonium hydroxide.
`Each crude amino-modi?ed oligonucleotide was dis
`solved in 0.8 ml of 0.1M NaHCO3/NaCO3 (pH 9). Bio
`tin-XX-NHS ester in dimethylformamide (100 mg/ml,
`0.25 ml) was added and the mixture as allowed to react
`for 16 hours at room temperature. The biotinylated
`30
`probes were puri?ed on Sephadex G-25 columns (1 X40
`cm) and then by preparative HPLC. Analytical HPLC
`chromatograms of the puri?ed 3’ biotinylated probes
`are shown in FIG. 2. The presence of biotin was con
`?rmed by a p-methylaminocinnamaldehyde colorimet
`ric test.
`
`35
`
`EXAMPLE 5
`Hybridization of Probe and Post Hybridization Washes
`with Tetramethylammonium Chloride (TMAC)
`40 pl of the amplifedsamples were added to 80 ul of
`0.4N NaOH, and heated to 95° C. for 2 minutes. The
`reaction mixtures were neutralized with 100 pl of 2M
`Tris-HCl (pH 7.4), and the solution slotted onto Amer
`sham Hybond nylon ?lter. The DNA was crosslinked
`onto the ?lter by UV radiation under conditions sug
`gested by the manufacturer.
`The slot blots were pre-hybridized for 2 hours at 37°
`C. with 10-15 mls of 5X SSPE, 5X Denhardt’s, 0.5%
`SDS, and 100 mM sodium pyrophosphate (pH 7.5). A
`labeled probe was then added to this solution to a ?nal
`concentration of 5X 106 cpm/ml and the ?lters were
`hybridized at 50° C. for 4 to 12 hours. Following this
`incubation, the ?lters were washed once at room tem
`perature with 6X SSC for 20 minutes, and twice at 61°
`C. in 3M TMAC, 50 mM Tris-HCl (pH 8), 2 mM
`EDTA, and 0.1% SDS. The ?lters were then washed
`once at room temperature with 6X SSC. Hybridization
`was detected both by autoradiography, and by colori
`metric detection with a streptavidin-alkaline phospha
`tase conjugate (Clontech’s Gene-tect System) on the
`same slot blot.
`
`EXAMPLE 3
`32F 5’ End Labeling of the Biotinylated Oligonucleotide
`Probes
`The H-ras biotinylated probes were 32F 5’ end labeled
`using a modi?cation of the method described by Berent
`et al. (Berent, S. L., M. Mahmoudi, R. M. Torczynski,
`P. W. Bragg, and A. P. Bollon [1985] BioTechniques
`3:208-220). 100 ng of the oligonucleotide probe were
`45
`dissolved in 30 pl of distilled water and heated to 65° C.
`for 3 minutes. The oligomers were then taken up to 50
`ul of a reaction buffer which contained 50 mM Tris
`HCl (pH 7.5), 10 mM MgCl;, 5 uM DTT, 0.1 mM
`spermidine, 10 p.l gamma 32P-ATP (speci?c activity
`50
`6000 Ci/mM), and 15-20 units of T4 kinase. This reac
`tion mixture was incubated at 37° C. for 30 minutes
`followed by the addition of another 15-30 units of ki
`nase and further incubation for 30 minutes. The labeled
`probe was then isolated using a G-25 Sephadex column.
`
`55
`
`EXAMPLE 4
`PCR Ampli?cation of the H-ras Protooncogenes
`Ampli?cation of genomic DNA by the polymerase
`chain reaction (PCR) has been previously described
`(Liu et al., supra; Saiki et al., supra). Two different sets
`of amplifying primers (amplimers) were used to amplify
`speci?c ras oncogene segments of genomic DNA. AT
`GACGGAATATAAGCTGGT (5’ H-ras amplimer)
`and CTCTATAGTGGGGTCGTATT (3' H-ras am
`65
`plimer) were used to amplify the region around codons
`l2and l3oftheH-rasgene;ATGACTGAGTA
`C A A A C T G G T (5’ N-ras amplimer) and
`
`EXAMPLE 6
`Preparation of Non-Isotopic Oligonucleotide Labeling
`Kits (NIO-Label TM Kits)
`3‘ non-isotopic oligonucleotide (NIO) labeling kits
`are complete kits designed to conveniently label syn
`thetic oligonucleotides at the 3' terminus with either
`biotin or fluorescein. The labeling process is divided
`into two procedures which are outlined in Sequence 1.
`First, an oligonucleotide is functionalized with a pri
`mary aliphatic amine at its 3' terminus using 3’ Amine
`ON CPG (Sequence 2). 3' Amine-ON CPG is a unique
`CPG that incorporates a primary amine on the 3’ termi
`nus of an oligonucleotide. It is fully compatible with
`automated DNA synthesizers. Secondly, the 3’ amino
`
`
`
`Page 12 of 15
`
`
`
`5,141,813
`modi?ed oligonucleotide is reacted with Biotin-XX
`NHS ester or FITC. All buffers and reagents are sup
`plied for this labeling procedure. Biotin-XX-NHS ester
`'is a unique product, having an extra long linking arm
`(XX) consisting of 14 atoms (Sequence 3).
`List of Components
`1. 3’ Amine-ON CPG, four 1 umol columns (Clontech
`Catalog No. 5220-1; Clontech Laboratories, Inc.,
`Palo Alto, CA).
`2. Biotin-XX-NHS ester, 100 mg (Clontech Catalog No.
`Kl072-l) or FITC, 100 mg (Clontech Catalog No.
`K1073-l).
`3. 10X labeling buffer, 1.0M sodium bicarbonate/car
`bonate (pH 9) 0.5 ml.
`4. N,N-Dimethylformamide, 1.0 ml.
`
`2.
`
`15
`
`10
`Method
`Modifying the 3' terminus with a primary aliphatic
`amine
`5 1. Attach a 3’ Amine-ON to your automated DNA
`synthesizer.
`Enter the oligonucleotide sequence you wish to syn
`thesize. Make sure you enter the 3’ terminal base of
`your sequence as the 2nd base from the