Gene, 151(1994)131-135
`© 1994 Elsevier Science B.V. All rights reserved. 0378-1119/94/$07.00
`
`131
`
`GENE08327
`
`Use of the tetracycline promoter for the tightly regulated production of a
`murine antibody fragment in Escherichia coli
`
`(Expression vector; tet repressor; anhydrotetracycline; induction; immunoglobulin; secretion; Strep tag)
`
`Arne Skerra
`
`Max-Plunck-lnstitutfur Biophysik, Frankfurt am Main, Germany
`
`Received by H.M. Krisch: 26 March 1994; Revised/Accepted: 16 June/28 June 1994; Received at publishers: 4 August 1994
`
`SUMMARY
`
`A generic vector, pASK75, was developed for the synthesis of foreign proteins in Escherichia coli under transcriptional
`control of the tetA promoter/operator. Tight regulation was achieved by placing the structural gene for the tet repressor,
`as a transcriptional fusion, downstream from the P-lactamase-encoding gene (hla) on the same plasmid. Strong expression
`of the foreign gene was conveniently induced by adding anhydrotetracycline at a low concentration. Using the production
`of a recombinant murine immunoglobulin Fab fragment as an example, the system was shown to function indepen(cid:173)
`dently of the host-strain background and to be extremely well repressed in the absence of the inducer. Thus, it represents
`an economic and independent alternative to IPTG-inducible promoter constructs. Additional features of pASK75 include
`a signal sequence and a multiple cloning site followed by a region encoding the Strep tag affinity peptide to facilitate
`purification of a bacterially produced protein.
`
`INTRODUCTION
`
`Inducible promoter systems have proven generally
`useful
`for
`the production of foreign proteins
`in
`Escherichia coli, because the synthesized recombinant
`gene product often has a deleterious effect on bacterial
`cell growth and viability. Particularly, for proteins
`secreted into the periplasm it is advisable to ensure tight
`
`Correspondence to: Dr. A. Skerra, Max-Planck-Institut for Biophysik,
`Abteilung Molekulare Membranbiologie, Heinrich-Hoffmann-StraBe 7,
`D-60528 Frankfurt am Main, Germany. Tel. (49-69) 96769-389; Fax
`( 49-69) 96769-423.
`
`Abbreviations: A, absorbance ( 1 cm); Ap, ampicillin; a Tc, anhydrotetra(cid:173)
`cycline; bla, gene encoding p-lactamase; bp, base pair(s); lg, immuno(cid:173)
`globulin; IMAC, immobilized metal affinity chromatography; IPTG,
`isopropyl-P-n-thiogalactopyranoside; lac, lactose operon; MCS, mul(cid:173)
`tiple cloning site; nt, nucleotide(s); OmpA, outer membrane protein A;
`PAGE, polyacrylamide-gel electrophoresis; PCR, polymerase chain
`reaction; R, resistance; RBS, ribosome-binding site; SDS, sodium dode(cid:173)
`cyl sulfate; Strep tag, affinity tail of 10 aa (available from Biometre; see
`Fig. lb); Tc, tetracycline; tet, TcR determinant; tetA, gene encoding TcR
`function; tetR, gene encoding tet repressor.
`
`repression of the promoter not only during vector con(cid:173)
`struction steps, but also in order to achieve high cell
`densities prior to protein production. The bacterial secre(cid:173)
`tion of antibody fragments is a typical example in this
`respect, since toxicity and lysis resulting from heterolo(cid:173)
`gous gene expression can be readily observed (Plilckthun
`and Skerra, 1989).
`Among common promoter systems, the IPTG-induc(cid:173)
`ible lac promoter and its derivatives (like the lacUV5
`mutant or the tac fusion promoter) are most prominent
`(Reznikoff and Gold, 1986) and have frequently been
`used for the bacterial production of immunoglobulin (lg)
`fragments (reviewed in Skerra, 1993 ). However, the level
`of transcription from the lac promoter depends on the
`genotype and metabolic state of the host cell because of
`the endogenous concentration of lac repressor molecules
`on one hand, and the catabolite repression effect on the
`other. Therefore, significant variations of the level of
`expression from a given vector may be observed depend(cid:173)
`ing on the host strain used. This can be either due to
`reduced inducibility - especially when the lac repressor
`
`BEQ 1048
` Page 1
`
`

`
`132
`
`(1800)
`
`b
`
`<< <
`<<<<<«<<< >>>:>->>>>>
`1 CCA.TCGAA':'GGCCAGATGATTAATTCCTAATTTTTG~CTCTA':'CATTGATAGAGT~ACCACTCCC
`-35
`-10
`+l
`
`75
`
`<<<:<<>>>>>>>>
`~
`76 TATCAGTGJ.\.TAGAGAAAAGTGAAATOMTACTTCGACAAAAATCTAGATAACG"'GGGCAAAJ.AI\TGAAAAAGACA
`•*** ornpA: MetLysLysThr
`tetA: MetAsnSerSerThrLyslleEnd
`
`lSC
`
`6::.a.I EcoRI SstI KpnI
`StuI
`l'::il GCTATCGCGAT7GCAG'l'GGCAC?GGC'l'GG'l"l~rcc-CT.~CCGTAGCOCAGGCCTGAGACCAGAATTCGAGCTCGGTA 225
`AlaileAlaileAlaValAlaLeuAlaGlyPheAlaThrValAla.GlnAlaEnd
`
`HiruillI
`Eco47III
`S.11a! BamHI XhoI Sall PstI
`2 2 6 (".CCGC::JGATCCC'I'CGAGGTSGACCTCCAGGCAGCGCTTGGCGTCACCCGCAGTTCGGTGGTTAA":'AAGCTTGACC
`8trf'!p t.-.g: SPrAJaTrpArgHii;ProGlnPheGiyGlyEnrl
`
`~ G 0
`
`1r:1
`
`'"'GTr.A;.C:'TC::AAAAATGCTC:GCACAT'IGTCCGACA'M'TTT'M'TGTC'J'GCCGTTTA:::cccTACTGCGTCACC'.GATC'TC
`mRNA End
`
`17 5
`
`c
`
`1 ~ 91 "'GAGA'T'A.C..GTGCC":'CACTGATTAAGCATTGGTAGGA.~TTAA'IGATGTCTCGTTTAGATAAAAGTAAAGTGATTAA 1R6 ">
`bla: ... SerLeuileLyEHisTrpEnd
`tetR: MetSerArgLeuAspLysSerLrys.
`
`Fig. 1. Features of the pASK75 vector for the expression of foreign
`genes in E. coli under control of the tetA promoter/operator. (a)
`pASK75. tetPl 0
`, TnJO TcR promoter/operator region; t,PP' lipoprotein
`transcription terminator; ori, origin of DNA replication (Co!EI); fl-JG,
`intergenic region of filamentous phage fl. The unique restriction sites
`flanking the expression cassette, XbaI and HindIII, as well as useful
`restriction sites for the precise insertion of foreign genes between the
`ompA signal sequence and the Strep tag affinity peptide are indicated.
`(b) The nt sequence of the tet regulatory region on pASK75, beginning
`with the tetA promoter (- 35 and -10 consensus sequences, as well as
`the transcription start point ( + 1) are indicated) and ending with the
`transcription terminator. Palindromic patterns corresponding to the
`two tet repressor-binding sites in the promoter region and to the termi(cid:173)
`nator structure are labeled by arrowed brackets. Putative RBS elements
`are marked by asterisks. Unique restriction sites in the MCS are shown.
`Due to conservation of the unique Xbal and Hi11dIII sites (underlined),
`compatibility with earlier and more specialized constructs, e.g., for the
`expression of lg fragments (Essen and Skerra, 1993; Skerra, 1994;
`Schmidt and Skerra, 1994b) or lipocalin proteins (Muller and Skerra,
`1993; Schmidt and Skerra, 1994a), was maintained. (c) Artificial inter(cid:173)
`cistronic region between the bla and tetR genes. The putative RBS
`sequence of tetR is indicated by asterisks. Constructions: pASK 75 was
`constructed from pASK60-Strep (Schmidt and Skerra, 1993) in several
`steps using PCR and site-directed mutagenesis according to standard
`methods (Sambrook et al., 1989). All critical regions were confirmed
`by dideoxy sequencing. The segment on pASK60-Strep comprising the
`lac repressor gene and the lac promoter/operator was replaced by a
`short fragment that was amplified from pWH10!2 (Sizemore et al.,
`1990), and contained the tet promoter/operator region (see Fig. lb).
`Efficient translational initiation was ensured (cf., Flache et al., 1992) by
`keeping the start region of tetA, which was followed by a stop codon.
`the XbaI restriction site, and the segment encoding the OmpA signal
`peptide endowed with its own RBS. In order to avoid interference of
`transcription and translation from the two tetR promoters with the
`plasmid ori, the double Met codon at the 5' end of the original tetR
`reading frame was removed, together with a XbaI restriction site
`
`is both chromosomally and plasmid encoded, or to cell
`death pnor
`to
`induction because of
`insufficient
`repression.
`Other promoters were also utilized, but most of them
`suffer from disadvantages, particularly when moderate
`secretion of the gene product or expression at lower tem(cid:173)
`perature is desired. Thus, there is still demand for a
`system that is independent of individual host properties
`and that is reversibly inducible by means of a commer(cid:173)
`cially available chemical compound. Here the promoter/
`operator of the TnJO TcR gene (reviewed in Hillen and
`Berens, 1994) has been successfully employed for the
`tightly regulated bacterial secretion of a recombinant lg
`F ah fragment and a corresponding generic vector for the
`cloning and expression of foreign genes is described.
`
`EXPERIMENTAL Al"D DISCUSSION
`
`(a) Vector construction
`Plasmid pASK75 (Fig. la), which carries the tet
`promoter region and the tet-repressor-encoding gene
`(tetR), was derived from the lac promoter plasmid
`pASK60-Strep (Schmidt and Skerra, 1993), which was
`previously developed for the bacterial secretion of pro(cid:173)
`teins carrying the Strep tag affinity peptide at their C
`terminus (Schmidt and Skerra, 1994b). The expression
`cassette on pASK75 (i.e., the sequence flanked by the
`Xbal and HindlII sites; see Fig. 1 b) is identical to that
`on pASK60-Strep, and consists of a gene fragment encod(cid:173)
`ing the OmpA leader peptide with its translational initia(cid:173)
`tion region, an MCS and the sequence coding for the
`Strep tag.
`On pASK75, the expression cassette was put under
`transcriptional control of the tetA promoter. The transla(cid:173)
`tional initiation site and the first seven codons of the tetA
`structural gene were kept, followed by a stop codon and
`the nt sequence from pASK60-Strep (Fig. lb). Thus, a
`tandem RBS for efficient initiation of translation was cre(cid:173)
`ated. A foreign gene can be inserted in several different
`ways (see Schmidt and Skerra, 1993) to achieve either
`protein production in the cytoplasm or its secretion to
`the pcriplasm via precise fusion with the signal sequence.
`
`following behind. The tetR structural gene itself, which was amplified
`from pWH520 (Berens et al., 1992), was inserted directly downstream
`from a modified translational stop for the bla gene. The tetR RBS was
`retained, but the XbaI site at the beginning of the reading frame was
`eliminated by mutagenesis of the codon for Arg3 (see panel c). The
`translational initiation region of tetR was found to he rather sensitive
`to sequence variation, since other mutational variants tested during
`construction of pASK75 led to significantly poorer repression of the
`tetA promoter. Downstream of the tetR reading frame, a unique Spel
`site was introduced, and the internal Eco47III site (as well as Asel in
`the hla gene) was removed.
`
`BEQ 1048
` Page 2
`
`

`
`On transposon TnJ 0, the three promoters of the tet
`control region act bidirectionally (Hillen and Berens,
`1994 ): the tetA promoter transcribes the structural gene
`for the TcR protein in one direction, and two overlapping
`weaker promoters direct transcription of the tetR gene,
`encoding the repressor, in the opposite direction. In this
`arrangement the repressor regulates both its own syn(cid:173)
`thesis and transcription of tetA, so that a basal level of
`promoter activity is retained even in the absence of tetra(cid:173)
`cycline (Tc), the natural inducer.
`In order to establish tight repression of the tetA pro(cid:173)
`moter, the tetR gene was introduced into pASK75 uncou(cid:173)
`pled from the tet control region. For this purpose the
`tetR gene, including its RBS, was placed downstream
`from the constitutively expressed bla gene (Fig. la),
`resulting in a transcriptional fusion (Fig. le).
`
`(b) Recombinant gene expression
`The characteristics of the pASK75 vector were exem(cid:173)
`plified using a recently described system for the functional
`secretion of a murine Fab fragment-His6 fusion in E. coli
`(Skerra, 1994 ). The expression plasmid pASK85-Dl.3
`was constructed from pASK 7 5 by inserting via X bal and
`Hindlll the corresponding cassette from the published
`vector pASK84-Dl.3 (Skerra, 1994), which carries the
`structural genes for the two chains of the F ab fragment.
`Thus, the heavy chain and the light chain-encoding
`
`133
`
`sequences, both preceded by a bacterial signal peptide,
`were placed under transcriptional control of the tetA pro(cid:173)
`moter as part of an artificial operon.
`The time-course of induction was investigated by a
`Western blot of total E. coli cell protein using commercial
`antisera directed against mouse lg (Fig. 2a). The cells
`were grown to a mid-log phase, and the promoter was
`then induced by adding 200 µg a Tc/I. 1 h thereafter both
`chains of the F.b fragment could be clearly detected. Their
`amount increased progressively during 4 h and became
`even larger after overnight incubation. Comparison with
`the purified recombinant Fah fragment revealed that both
`chain precursors were quantitatively processed, and it
`was estimated that 3-4 h post induction, roughly 20 mg
`lg protein/I had been synthesized.
`In order to confirm the formation of correctly folded
`lg protein, preparative expression was performed on the
`1-litre scale as described before (Skerra, 1994), with the
`exception that a Tc was used for induction. Employing E.
`coli K-12 JM83 (Yanisch-Perron et al., 1985) as expres(cid:173)
`sion host, the yield obtained using the tetA promoter on
`pASK85-Dl.3 was indistinguishable from that of the
`lacUV5 promoter on pASK84-Dl.3, when the functional
`Fab fragment was purified from the periplasmic cell frac(cid:173)
`tion via IMAC (not shown). Furthermore, the time(cid:173)
`course of induction and the total amount of lg protein
`synthesized were essentially identical between both sys-
`
`a
`
`M
`
`0
`
`2
`
`3
`
`4
`
`5
`
`b
`
`M
`
`2
`
`3
`
`4
`
`5
`
`6
`
`7
`
`8
`
`,,,..,..,,._ ......... ~ ...... "
`
`----·
`
`--~- ~~---
`
`-······-··
`
`Fig. 2. Bacterial synthesis of an Ig Fab fragment from the tet promoter plasmid pASK85-Dl.3, a derivative of pASK75. (a) Time-course of induction.
`Detection of recombinant F.b fragment by Western blot of total E.coli cell protein using the K-12 strain JM83 (Yanisch-Perron et al., 1985). Lanes:
`0, sample taken immediately before induction; 1 to 4. samples from 1-4 h after induction; 5, sample after overnight incubation; M, I µg purified F.b
`fragment. LC and HC denote the light and heavy chain of the Ig fragment, respectively. (b) Comparison of host strains. Detection of recombinant
`Fah fragment by Western blot of total E.coli cell protein 3 h after induction. Lanes: 1, JM83 (Yanisch-Perron et al., 1985); 2, WK6 (Zell and Fritz,
`1987); 3, E.coli B (ATCC 11303); 4, BL21 (Studier and Moffatt, 1986); 5, MG1655 (Jensen, 1993); 6, W3110 (Jensen, 1993); 7, W3110 in glucose
`minimal medium; 8, XU-Blue (Bullock et al., 1987); M, 1 µg purified Fab fragment. Methods: Cells were grown in Luria-Bertani medium (or M9
`glucose minimal medium; Sambrook et al., 1989) in the presence of 100 µg Ap/ml. For expression at the analytical scale, as shown here, 100 ml
`medium in a 250-ml shaking flask was inoculated with 2 ml ( 4 ml in the case of minimal medium) of an overnight culture and incubated at 22°C
`(30°C for XU-Blue; 25°C for W3110 grown in minimal medium) until an A550 =0.5 was reached. Expression was then induced by the addition of
`a Tc (Janssen Chimica, Neuss, Germany), dissolved in dimethylformamide, to a final concentration of 0.2 µg/ml. At the time indicated, cells from 1 ml
`culture were spun down and resuspended in 80 µl 100 mM Tris-HCI pH 8.0/5 mM MgS04 in the presence of 1 unit benzonase (Merck, Darmstadt,
`Germany). After adding 20 µl 5 x SDS gel loading buffer, the samples were kept on ice ( 1 h) to break down the chromosomal DNA. 5 µI of the
`solution (equivalent to 0.05 ml of the culture) were then heated to 95°C and subjected to 0.1 % SDS-12% PAGE in the presence of 6 M urea (Skerra,
`1994). Transfer onto nitrocellulose membrane (Schleicher&Schiill, Dassel, Germany), immunodetection with rabbit-anti-mouse lg and swine-anti(cid:173)
`rabbit lg-alkaline phosphatase conjugate (Dako. Hamburg, Germany) and staining were performed as described (Schmidt and Skerra, 1993).
`
`BEQ 1048
` Page 3
`
`

`
`134
`
`terns. However, trace amounts of the F ab fragment could
`be clearly detected in the absence of IPTG in the case of
`the lacUV5 plasmid.
`Because of the toxicity of secreted lg fragments in E.
`coli the degree of repression in a promoter system can be
`assessed qualitatively based on the viability and growth
`behavior of the transformed bacteria. For this purpose a
`variety of different host strains were transformed with
`pASK85-Dl.3. In contrast to the lacUV5 promoter plas(cid:173)
`mid, no indication of toxicity, as the appearance of satel(cid:173)
`lite colonies on Ap-containing plates or lysis of overnight
`cultures, was observed when strains different from JM83
`were used. In addition, cell densities of overnight cultures
`(grown at 37°C) were usually higher and plasmid prepa(cid:173)
`rations gave consistently good yields, as expected for a
`high-copy-number vector. The routine preparation of
`rather large amounts of single-stranded phagemid DNA
`was also possible from the tet promoter vectors.
`When small-scale expression experiments were per(cid:173)
`formed with pASK85-Dl.3, almost identical amounts of
`the F ab fragment were detected in the different E. coli
`host strains, irrespective whether belonging to class K-12
`or B (Fig. 2b). No influence was observed when an epi(cid:173)
`somal copy of the TnJO TcR gene was present, as in the
`case of XU-Blue (Bullock et al., 1987), or when cell
`growth and induction were performed in glucose minimal
`medium.
`The inducer aTc, utilized here for induction of expres(cid:173)
`sion, is commercially available. Since it is active at an
`extremely low concentration, its use is much more eco(cid:173)
`nomical as compared to IPTG. Furthermore, the anhy(cid:173)
`dro-derivative binds more strongly to the tet repressor
`(Degenkolb et al., 1991) and is less antibiotic (Oliva et al.,
`1992) than the natural inducer Tc.
`
`( c) Conclusions
`The tetA promoter was shown to be useful for the
`tightly regulated high-level synthesis of a foreign gene
`product in a variety of E. coli K-12 and B strains. Its
`strength was comparable to that of lacUV5, but its
`repression on pASK75 and derivatives thereof is signifi(cid:173)
`cantly better. Cell lysis effects, which were otherwise fre(cid:173)
`quently observed in the work with recombinant antibody
`fragments, were thus prevented.
`In contrast to practical experience with lac-based regu(cid:173)
`lons the tet promoter system was found to be largely
`independent of the E. coli strain used. Therefore, the host
`strain can be mainly chosen, for example, according to
`optimized growth characteristics in the high cell density
`fermentation. The tetA promoter is inducible even when
`cells are grown in a minimal medium; thus, the system
`appears to be well suited for the large-scale production
`of recombinant proteins.
`
`Although the potential advantages of the tet promoter
`for the expression of foreign genes in E. coli were recog(cid:173)
`nized, in principle, 10 years ago (De la Torre et al., 1984)
`the development of a convenient expression system has
`not been described to date. The vector pASK75 has the
`tetA promoter/operator, as well as its cognate repressor
`gene, implemented in a way that makes it useful under a
`variety of circumstances. In conjunction with the recently
`established Strep tag purification technology (Schmidt
`and Skerra, 1994b) it should significantly facilitate the
`expression and isolation of heterologous gene products
`in E.coli.
`
`ACKNOWLEDGEMENTS
`
`The author wishes to thank Christina Wardenberg for
`expert technical assistance and Prof. Wolfgang Hillen for
`an inspiring discussion and providing the plasmids
`pWH520 and pWH1012. This work was supported by
`the Deutsche Forschungsgemeinschaft.
`
`REFERENCES
`
`Berens, C., Altschmied, L. arid Hillen, W.: The role of the N terminus
`in Tet repressor for tet operator binding determined by a mutational
`analysis. J. Biol. Chem. 267 (1992) 1945-1952.
`Bullock, W.O., Fernandez, J.M. and Short, J.M.: XU-Blue: a high effi(cid:173)
`ciency plasmid transforming recA t:scherichia coli strain with beta(cid:173)
`galactosidase selection. BioTechniques 5 ( 1987) 376-379.
`Degenkolb, J., Takahashi, M., Ellestad, G.A. and Hillen, W.: Structural
`requirements of tetracycline-Tel repressor interaction: determina(cid:173)
`tion of equilibrium binding constants for tetracycline analogs with
`the Tet repressor. Antimicrob. Agents Chemother. 35 (1991)
`1591-1595.
`De la Torre, J.C., Ortin, J., Domingo, E., Delamarter. J., Allet, B.,
`Davies, J., Bertrand, K.P., Wray Jr., L.V. and Reznikoff, W.S.:
`Plasmid vector based on TnlO DNA: gene expression regulated by
`tetracycline. Plasmid 12 (1984) 103-110.
`Essen, L.-0. and Skerra, A.: Single-step purification of a bacterially
`expressed antibody Fv fragment by metal chelate affinity chroma(cid:173)
`tography in the presence of betaine. J. Chromatogr. A 657 (1993)
`55-61.
`Flache. P., Baumeister, R. and Hillen, W.: The TnlO-encoded tetracy(cid:173)
`cline resistance mRNA contains a translational silencer in the 5'
`nontranslated region. J. Bacteriol. 174 ( 1992) 2478-2484.
`Hillen, W. and Berens, C.: Mechanisms underlying expression of TnJ 0
`encoded tetracycline resistance. Annu. Rev. Micro biol. 48 ( 1994)
`345-369.
`Jensen, K.F.: The Escherichia coli K-12 "wild types" W3110 and
`MG1655 have an rph frameshift mutation that leads to pyrimidine
`starvation due to low pyrE expression levels. J. Bacteriol. 175 (1993)
`3401-3407.
`Muller. H.N. and Skerra, A.: Functional expression of the uncomplexed
`serum retinol-binding protein in Escherichia coli: ligand binding and
`reversible unfolding characteristics. J. Mol. Biol. 230 ( 1993) 725-732.
`Oliva, B., Gordon, G., McNicholas, P., Ellestad, G. and Chopra, I.:
`Evidence that tetracycline analogs whose primary target is not the
`
`BEQ 1048
` Page 4
`
`

`
`bacterial ribosome cause lysis of Escherichia coli. Antimicrob.
`Agents Chemother. 36 (1992) 913-919.
`Pliickthun, A. and Skerra, A.: Expression of functional antibody Fv
`and Fab fragments in Escherichia coli. Methods Enzymol. 178
`(1989) 497-515.
`Reznikoff, W. and Gold, L.: Maximizing Gene Expression. Butterworth,
`Stoneham, MA, 1986.
`Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A
`Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press,
`Cold Spring Harbor, NY, 1989.
`Schmidt, T.G.M. and Skerra, A.: The random peptide library-assisted
`engineering of a C-terminal affinity peptide, useful for the detection
`and purification of a functional Jg Fv fragment. Protein Eng. 6
`(1993) 109-122.
`Schmidt, F.S. and Skerra. A.: The bilin-binding protein of Pieris /Jrassi(cid:173)
`cDNA sequence and regulation of expression reveal distinct
`cae
`features of this insect pigment protein. Eur. J. Biochem. 219
`(1994a) 855-863.
`Schmidt, T.G.M. and Skerra, A.: One-step affinity purification of bacte(cid:173)
`rially produced proteins by means of the "Strep tag" and immobi-
`
`135
`
`lized recombinant core streptavidin. J. Chromatogr. A 676 ( 1994b)
`337-345.
`Sizemore, C., Wissmann, A., Giilland, U. and Hillen, W.: Quantitative
`analysis of TnlO Tet repressor binding to a complete set of tet
`operator mutants. Nucleic Acids Res. 18 ( 1990) 2875-2880.
`Skerra, A.: Bacterial expression of immunoglobulin fragments. Curr.
`Opin. Immunol. 5 (1993) 256-262.
`Skerra, A.: A general vector, pASK84, for cloning, bacterial production
`and single-step purification of antibody Fab fragments. Gene 141
`( 1994) 79-84.
`Studier, F.W. and Moffatt, B.A.: Use of bacteriophage T7 RNA poly(cid:173)
`merase to direct selective high-level expression of cloned genes.
`J. Mo!. Biol. 189 (1986) 113-130.
`Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved M 13 phage
`cloning vectors and host strains: nucleotide sequences of the
`Ml3mpl8 and pUC19 vectors. Gene 33 (1985) 103-119.
`Zell, R. and Fritz, H.-J.: DNA mismatch-repair in Escherichia coli
`counteracting the hydrolytic deamination of 5-methyl-cytosine resi(cid:173)
`dues. EMBO J. 6 (1987) 1809-1815.
`
`BEQ 1048
` Page 5