`Printed in U.S.A
`
`Tile ,Journal of Climcul Endocnnology & :'lr1Ptabolism 87( 12J:5714 -G721
`Copynuht V 2002 by Ttw Endocr11W Socwty
`dm.10.1210/.J('2001-011&AO
`
`Differential Inhibition of 17 a-Hydroxylase and 17,20-
`Lyase Activities by Three Novel Missense CYP17
`Mutations Identified in Patients with P450c17 Deficiency
`
`ERICA L. T. VAN m;N AKKER, JAN W. KOPER, ANNEMIE L. M. BOEHMER, AXEL P. N. THEMMEN,
`MIRIAM VERHOEF-POST, MARIANNA A. TIMMERMAN, BARTO J. OTTEN, STENVERT L. S. DROP,
`AND FRANK H. DE JONG
`
`Department of Pediatrics, Division of Endocrinology !E.L.T.u.d.A., A.L.M.B., S.L.S.D.), and Department of Internal
`Medicine, Section of Endocrinology (J. W.K., A.P.N. T., M. V.-P., M.A. T., F.H.D.J.J, Erasmus Medical Center, 3000 DR
`Rotterdam, The Netherlands; and Department of Pediatrics, Division of Endocrinology, Radboud University Hospital
`(B.J.O.J, 6500 HB Nijmegen, The Netherlands
`
`The microsomal enzyme cytochrome P450cl7 is an important
`regulator of steroidogenesis. The enzyme has two functions:
`17a-hydroxylase and 17,20-lyase activities. These functions
`determine the ability of adrenal glands and gonads to syn(cid:173)
`thesize 17a-hydroxylated glucocorticoids (17a-hydroxylase
`activity) and/or sex steroids (17,20-lyase activity). Both en(cid:173)
`zyme functions depend on correct steroid binding, but it was
`recently shown that isolated lyase deficiency can also be
`caused by mutations located in the redox partner interaction
`domain. In this article we present the clinical history and
`molecular analysis of two patients with combined 17 a-hydrox(cid:173)
`ylase/17,20-lyase deficiency and four patients with isolated
`17,20-lyase deficiency. In these six patients, four missense
`CYP17 mutations were identified. Two mutations were lo(cid:173)
`cated in the steroid-binding domain (Fll4V and Dll6V), and
`the other two mutations were found in the redox partner
`
`interaction domain (R347C and R347Hl. We investigated the
`activity of these mutated proteins by transfection experi(cid:173)
`ments in COS-I cells using pregnenolone, progesterone, or
`their hydroxylated products as a substrate and measuring
`17n-hydroxylase- and 17,20-lyase-dependent metabolites in
`the medium. The mutations in the steroid-binding domain
`(F114V and Dll6Vl of P450c17 caused combined, complete
`(FU4V), or partial (Dl16V) 17n-hydroxylase and 17,20-lyase
`deficiencies, whereas mutations in the redox partner inter·
`action domain (R347C and R347Hl displayed less severe 17a·
`hydroxylase deficiency, but complete 17 ,20-lyase deficiency.
`These findings are consistent with the clinical data and sup(cid:173)
`port the observation that the redox partner interaction do(cid:173)
`main is essential for normal 17,20-lyase function of P450cl7.
`(J Clin Endocrinol Metab 87: 5714-5721, 2002)
`
`I N THE STEROIDOGENIC pathway, cholesterol is con(cid:173)
`
`verted into pregnenolone, which subsequently can be
`processed to either mineralocorticoids (no 17a-hydroxyla(cid:173)
`tion) or glucocorticoids (17 a-hydroxylation) in adrenal
`glands or to sex steroids in adrenals and gonads (17a(cid:173)
`hydroxylation and 17,20-lyase activity). The microsomal en(cid:173)
`zyme cytochrome P450c17 is an important switchpoint in this
`steroidogenic pathway because it has both 17n-hydroxylase
`and 17,20-lyase activities (Fig. 1). The first step necessary for
`P450c17 enzyme activity is steroid binding; then electron
`transfer occurs, enhanced by oxidoreductase to catalyze the
`hydroxylase reaction. The lyase activity is dependent on
`facilitation of the interaction of oxidoreductase with the re(cid:173)
`dox partner-binding site (1). This interaction is enhanced by
`cytochrome b5 (2) or phosphorylation of phosphoserine res(cid:173)
`idues (3). Optimal functioning of the redox partner-binding
`site is especially essential for the lyase reaction.
`The P450c17 enzyme is encoded by the CYP17 gene, which
`is located on chromosome 10q24.3 (4). CYP17 gene mutations
`are known to cause either complete or partial, combined, or
`isolated 17a-hydroxylase/ 17,20-lyase enzyme deficiencies.
`The study of these mutant enzymes found in patients with
`17a-hydroxylase/ 17,20-lyase enzyme deficiencies can help
`
`Abbreviations: AIS, Androgen insensitivity syndrome; DHEA, de(cid:173)
`hydroepiandrosterone; hCG, human chorionic gonadotropin~ Vrno~x'
`maximum velocity.
`
`us to understand the factors involved in P450c17 enzyme
`function. Until now 15 single base pair CYP17 gene muta(cid:173)
`tions have been found, causing combined 17a-hydroxylase
`and 17,20-lyase deficiencies (Table 1) (5-19). Only 2 muta(cid:173)
`tions identified in patients with isolated complete 17,20-lyase
`deficiency were examined in vitro (Table 1) (14). These 2
`mutations (R347H and R358Q) are located in the redox part(cid:173)
`ner interaction domain. The observation of differential re(cid:173)
`sidual enzyme activity in naturally occurring mutations in
`various regions of the CYP17 gene supports the hypothesis
`that 17,20-lyase activity depends on normal function
`of the redox partner interaction site of the P450c17 enzyme
`(Fig. 1) (20).
`In this article we present the clinical and molecular data of
`six patients with 17,20-lyase deficiency. In the CYP17 gene of
`these patients four different missense mutations were iden(cid:173)
`tified. Two mutations were located in the steroid-binding
`domain and two in the redox partner interaction domain. The
`effects of these four mutations on the enzymatic activity of
`the protein were examined by in vitro expression studies.
`
`Subjects and Methods
`
`Patients
`
`The clinical picture and hormone levels of patient I have been de(cid:173)
`scribed previously (21). This 17-yr-old female patient was referred be~
`
`5714
`
`Thl.' Endocrmc Snc1cty Downloaded fiom press endOCJineorg by ['51mdJVJdua!User.dJsplayN<IIllC)) \Hl II Junuary 2017 ill 21 ·()(, Fnr personal usc nnly No nthe1 llscs Wlthnlll rx:rmJSSI<lD All11ghts rcJ;c1vcd
`
`JANSSEN EXHIBIT 2131
`Wockhardt v. Janssen IPR2016-01582
`
`
`
`van den Akkcr et a!. • 17 ,20-Lyasc Deficiency
`
`J Clin Endocrinol Metab, December 2002, 87(12):5711-5721 5715
`
`Pregn enolo nff-c====;,..., 170H-pregnenolone
`DHEA
`170H-progesterone OR+b5 Androstenedione
`Progesterone
`OR
`
`FIG. 1. Model of the mechanism of action of micro(cid:173)
`somal P450c17 and its differential regulation of 17-
`hydroxylase and 17,20-lyase activities. OR. Oxi(cid:173)
`doreductase; b5, cytochrome 66; e--. electron
`transfer [adapted from Auchus et al. 12)].
`
`Steroid
`hormone
`binding
`site
`
`microsome
`
`Phoop-.oserine
`residt.e
`
`TABLE 1. All single base pair missense mutations in the CYP17 gene described until now, their location, and their residual enzyme
`activity studied in vitro
`
`Mutation
`
`17 n-llyd roxylase
`(%)
`
`17,20-Lyase
`(%)
`
`Site of mutatiod'
`
`keJE:rence
`
`33
`
`Membrane
`Membrane
`
`R35L
`Y64S
`G90N
`F93C
`R96W
`Sl06P
`Fll4V
`DI16V
`N177D
`P342T
`R347H
`
`38
`15
`10
`8
`<1
`<1
`11
`10
`11
`19
`25
`25
`12
`<1
`<1
`5
`2.2
`<1
`This article
`87.7
`This article
`10.7
`10
`10
`15
`20
`20
`6
`<5%
`65
`14
`<1
`44.1
`This article
`13.6
`R347C
`<1
`This article
`Redox
`R358Q
`<5
`65
`14
`Redox
`<1
`<1
`H373L
`9
`Heme
`<1
`P409R
`<1
`16
`Steroid
`Heme(?)
`10
`R415C
`18
`8
`F417C
`13 and 14
`<1
`Heme
`<1
`<1
`R440H
`Heme
`<1
`10
`• 10
`R496C
`7
`Heme
`' 10
`as
`R496H
`Heme
`33
`15
`···-·--------. ------------ --·-----------·- ----------------------------------------------------
`., Membrane, Membrane attachment domain; Steroid. steroid binding domain; Redox, redox partner interaction domain; Heme. heme binding
`domain; and Hemel'~l, uncertainly of affected domain 1281.
`
`Steroid
`
`Steroid
`Steroid
`Steroid
`Steroid
`
`Redox
`
`cause of primary amenorrhea ,md lack of secondary sexual development
`(Tanner stage Mli'J ). She had one sister with normal secondary sexual
`d<~velopment. The patient had female external genitalia, but no uterus
`and a 46,XY karyotype. Based on these results, the presumptive diag(cid:173)
`nosis of androgen insensitivity syndrome (AIS) was made. Secondary
`sexual development began after the start of estrogen substitution ther(cid:173)
`apy. The patient underwent a hormonal evaluation before undergoing
`bilateral gonadectomy at the age of 20 yr. With the exception of fatigue,
`she had no complaints. Her blood pressure was elevated (150/110 mm
`I! g) despite low renin levels. Basal levels of androgens were low, and
`progesterone levels were high; basal cortisol was within the normal
`range, but rose insufficiently after ACTH (Table 2). These findings Jed
`to the diagnosis of combined 17a-hydroxylase/17,20-lyase deficiency.
`Results of in uitro studies of testis tissue of this patient, using preg(cid:173)
`17-hyclroxyprcgnenolonc,
`and
`dehydroepiandrosterone
`nenolone,
`(Dl lEA) as substrate, followed by measmemcnt of metabolites confim1cd
`the absence of 17a-hydroxylase and 17,20-lyasc activities (21).
`Patient 2 is a 46,XY individual, who was born with an enlarged clitoris
`and no uterus. Her gonads were removed when she was 3 yr old. Based
`
`on the combination of ambiguous genitalia, lack of pubic hair at puberty,
`low-normal levels of androgens, and cortisol (Table 2), combined partial
`17n-hydroxylase/l7,20-lyase deficiency was diagnosed.
`Patient 3 was born with complete female external genitalia and raised
`as a girl. She was the first child of consanguineous parents. The family
`history did not reveal any sexual differentiation disorders. At the age of
`2 months, she had bilateral inguinal hemias, which contained testes, and
`subsequently, her karyotype was shown to be 46,XY. The presumptive
`diagnosis of AIS was made, and gonadectomy was performed. She was
`reevaluated at the age of 10 yr. Her blood pressure was 140/80 mm Hg
`despite normal renin levels. She underwent uneventful surgery twice.
`Basal levels of androgens were low, and progesterone was elevated. An
`ACIH test showed a low-normal basal level of cortisol that did not
`respond to ACTH (Table 3), suggesting partial 17a-hydroxylase defi(cid:173)
`ciency with complete 17,20-Jyase deficiency.
`Patient 4, raised as a girl, was evaluated at age 14 yr because of
`delayed puberty. She had a 46,XY karyotype and complete female ex(cid:173)
`ternal genitalia with an absent uterus. The presumptive diagnosis of AIS
`was made, and she underwent gonadectomy. At age 28 yr she was
`
`The Endocnnc Soctety Downloaded from ptcs~ endoctme org hy j${mdJVtdua!Uset dt~playNamc) Jon I I Januat)' 2017 at 21·06 Fm pets<J!lalu~e only. No other u~es wtthout penmsston .. All nghts reserved.
`
`
`
`TABLE 2. Serum hormone concentration; of patient; 1 and :Z with CYP17 mututiono in the steroid binding domain
`
`IIormone
`
`FSH (U/liter)
`Progesterone (nmollliter)
`170H-progesterone (nmollliter)
`Cortisol (nmollliter)
`DHEA (nmollliter)
`Androstenedione (nmollliter J
`Testosterone i mnolfliter)
`Renin (pg(mJ)
`
`Patient 1 IF! HVt"
`
`flagaJ
`
`107.4 (1.5-9.4)
`38.4 (2.6-7.4)
`14.5 (0 5-2)
`0.29 (<10)
`220 (200-800)
`<0.1 (3.5-25)
`<0.1 (2-10)
`<0.2 <0.5-3)
`<0.1 W-2.5)
`
`ACTil
`
`14.9
`0.31
`240 (>500)
`<0.1
`<0.1
`<0.2
`<0.1
`
`Patient 2 ID!16Vl"
`flagaJ
`
`3.2 (0.5-2)
`0.1 ( <10)
`248 (200-800)
`3.6 (3.5-251
`1.67 (2-10)
`0.3 (0.5-3!
`
`Normal age-adjusted reference values are shown in parentheses. In the ACTH test, venous catheters were inserted, and serum levels of several
`hormones were rletermined in blood samples taken before and at 60 min after the iv administration of 0.2fi mg AC'l'H.
`"Age: patient 1, 17 yr; patient 2, 27 yr.
`
`TABLE 3. Serum hormone concentrations of patients 3 and 4 with CYP17 mutation R347C in the redox partner interaction domain
`
`Hormone
`
`LH
`FSH (Ufliter)
`Progesterone (nmollliter)
`170H-progesterone (nmol!liter)
`Cortisol (nmol/liter)
`DHEA (nmollliter)
`Androstenedione (nmol/literl
`Testosterone (nmollliter)
`Renin
`
`Patient 3 (R34 7C)"
`
`Basal
`
`6.4
`41.5(<1)
`7.4 (0.5-2.0)
`2.4 (0.4-2.1)
`216 (200-800)
`0.3 (0.4-4.9)
`0.11 (0.24-0.8)
`0.1 (<1)
`12.5 (60-8001
`
`ACTH
`5.4
`46.5
`8.4
`2.6 (3.5-6.0)
`228 (>fi00)
`0.5 0.2-9.4)
`0.13 !0.4-1.6)
`0.1
`
`Patient1 tR317CJ"
`Basal
`10.6 (1.5-8)
`37.3 (2-7)
`6.1 (0.5-2)
`1.9 ( <10)
`232 (200-800)
`0.0 (3.5-25)
`0.57 <2-10)
`0.1 <0.5-3.0)
`10.2 (60-3001
`
`ACTJ-1
`
`12.2
`2.4
`285 (>500)
`0.0
`0.51
`
`Normal age-adjusted reference values are shown in parentheses. 'l'he ACTH lest is describt>d in the legend to 'l'abl<' 2.
`"Ag·e: patient 3, 10 yr; paliml 4, 28 yr
`
`reevaluated. Her blood pressure was !70/90 mm Hg despite normal
`renin levels. She underwent surgery several times without complica(cid:173)
`tions. She developed breasts on estrogen substitution. Her main com(cid:173)
`plaint was the complete absence of pubic hair, which developed with
`testosterone propionate ointment therapy. Basal levels of androgens
`were extremely low with elevated progesterone. She had low-normal
`basal levels of cortisol, which did not rise after ACT! I stimulation (Table
`3). These data are consistent with partial17 a-hydroxylase deficiency and
`complete 17,20-lyase deficiency.
`Patients 5 and 6 arc siblings from consanguineous parents. Both 46,XY
`siblings were born with ambiguous external genitalia (l'rader stage Ill).
`Patient 5 was assigned the male sex, and patient 6 was assigned the
`female sex on the basis of the sex designated by the parents at birth.
`There were no clinical signs of insufficient cortisol secretion. Both sib(cid:173)
`lings underwent surgery several times without complications. Their
`basal serum levels of androgens were low and rose insufficiently after
`human chorionic gonadotropin (hCG) stimulation. Basal plasma renin
`activity was normaL Progesterone and 17-hydroxyprogesterone levels
`were high after hCG stimulation, and basal serum levels of cortisol were
`normal with some, but insufficient, rise during ACTH treatment (Table
`4). On the basis of these observations the diagnosis of isolated 17,20-lyase
`deficiency was made.
`
`Mutation analysis of the CYP 17 gene
`
`Genomic DNA was isolated from leukocytes according to standard
`procedures (22). Exons 1-8 and their flanking intron sequences of the
`CYP17 gene were amplified individually by PCR using the primers and
`PCR conditions described by Mom1o ef a/. (5), followed by single strand
`conformation polymorphism analysis (23) and sequencing oi the frag(cid:173)
`ments that showed abnormal single strand conformation polymorphism
`patterns. To determine whether two mutations identified in the same
`patient were on separate alleles, allele-specific amplification was carried
`out (patient 3), or DNA of the parents was sequenced (patients l, 2,
`and 4).
`
`Construction of mutant expression plasmids
`
`Mutant CYP17 expression plasmids were constructed using the con(cid:173)
`ditions described previously for the LH receptor (24). pcDNA3 was used
`as the expression vector. For the exchange of fragments containing the
`mutation in the wild-type CYP17 expression vector, flanking primers
`were used: T7 forward, AAT ACGI\CTCACTATAG; and 638 reverse,
`CTGTATGACATTCAACTC for the F114V and D116V mutants; and 670
`forward, GCAAAGACACCCTGGTGGACC; and SP6 reverse, CTAT(cid:173)
`AGTGTCAC:CTAAAT for the R347C and R347H mutations. The frag(cid:173)
`ments were digested with the restriction enzymes Bam HI and IJstEil for
`the Fll4V and Dl H1V mutants and IJspEl and Xhol for the R347C and
`R347I-l mutations, respectively, and subsequently ligated into the ex(cid:173)
`pression vector that had been digested with the same enzymes. Primers
`that carry the mutation were as follows: F114V, GGGTA1:CGC(cid:173)
`CGTCGCTGACTCTG; Dll6V, CGCCTTCGCTGTCTCCGGAGCA(cid:173)
`CACTGG; R347C, CAGTGACTGTAATC:GATTGCTCCTGCTG; and
`R347C, CCAACTATCAGTGATCATAACCGTCTC and their reverse
`complements.
`
`Culture and transfection of cells
`
`COS-1 cells were grown in 24-well plates to 50% confluence and
`transfected with 0.4 !J.g/well (four wells per plasmid) of pcDNA ex(cid:173)
`pression plasmid containing wild-type or mutant CY£'17. Transfection
`efficiency was monitored by cotransfection with a {3-galactosidase ex(cid:173)
`pression plasmid. The transfected cc•lls were washed and incubated in
`fresh medium. After 40 h wlwn the C:OS-1 cells were 80-90% confluent,
`1 !J.M pregnenolone, progesterone, 17-hydroxypregenenolone, or 17-
`hydroxyprogesteront' was added to the medium. After H h, i.e. during
`the period of linear steroid production against time (data not shown), the
`mediun1 was rcn1ovl'd and assayed for products using RlAs fur 17,
`hydroxyprcgncnolone (DRC Diat,rnostics, Marburg, Germany) and
`DIIEA or 17-hydroxyprogesterone and androstenedione (Diagnostic
`Products, Los Angeles, CA). All transfections were performed at least
`twice.
`
`The Endm.:nne SocJcty Downloaded fmm p1ess.cndocnne mg by ISlmdJVidualll~cr di~playNamcf Inn II Janttat)' 2017 at 21·1)6 1'01 pcr>nm1l usc only Nt> oth~1 us~" Without pcnn1sswn All nghts rc>clvcd
`
`
`
`van den Akkcr ct al. • 17 ,20-LyasC' DeC!cJency
`
`,J Clin Endocrinol Mctab, December 2002, 871121:5714-5721 5717
`
`In separate experiments, Krn and maxin1un1 velocity (Vm,1x) were
`measured for the 17a-hydroxylase and 17,20-lyase activities of the en(cid:173)
`zyme by culturing the cells in the presence of 0.1, 0.2, 0.5, 1, or 2 fLM
`pregnenolone or 17-hydroxypregnenolone, respectively, and measuring
`the concentration of the above-mentioned products using the same
`assays. Results were obtained with three or four wells of transfected cells
`per dose and were corrected for the concentrations measured in the
`medium of cells transfectcd with the empty vector.
`
`Results
`
`Mutations
`The mutations identified in the CYP17 gene of our six
`patients are shown in Table 5. Mutation analysis of patients
`l, 2, and 4 revealed compound heterozygosity for three novel
`mutations: F114V (TTC->GTC), Dl16V (GAC-->GTC), and
`R347C (CGT--•TGT), combined with a frameshift mutation
`on the other allele: a 4-base duplication near codon 480. This
`duplication has previously been observed in several families
`of Dutch and German Mennonite descent and is known to
`completely abolish all P450c17 enzyme activity (25). The
`novel mutations identified in patients 1 and 2 (F114V and
`D116V) are in the steroid-binding domain. Patient 3 was a
`compound heterozygote for two new mutations: R347C
`(CGT-> TGT) and a 25-bp deletion in ex on 1 (nucleotides
`204-228 of the coding sequence, counting from the A of the
`start codon). This deletion renders the message out of frame,
`resulting in a premature stop codon located at 28 residues
`after the deletion. We therefore expect that this deletion in
`allele 2 does not lead to the production of any functional
`protein. Patient 4 showed the same R347C mutation in one
`allele, whereas the 4-bp dup exon 8 mutation that was also
`present in patients 1 and 2 was present in the other. The
`mutation R347C is located in the redox partner interaction
`domain. Localization of two different mutations identified in
`the CYP17 gene in patients 1-4 on separate alleles was con(cid:173)
`firmed by determining that each of their parents carried only
`one of these mutations (patients 1, 2, and 4) or by allele(cid:173)
`specific amplification (patient 3). Finally, patients 5 and 6
`(siblings) were homozygous for the R347H (CGT-;.CAT)
`mutation that has been described previously (14).
`
`Expression of mutant proteins in COS-1 cells
`The 17n-hydroxylase and 17,20-lyase activities of the mu(cid:173)
`tated proteins were estimated using transient transfection in
`COS-1 cells and compared with those of the wild-type en(cid:173)
`zyme, The conversion of various concentrations of preg(cid:173)
`nenolone to 17-hydroxypregnenolone and DHEA was used
`as a measure for 17u-hydroxylase activity. Results are shown
`in Fig. 2A. Lineweaver-Burk plots calculated from these data
`are shown in Fig. 3. The r values for the regression lines were
`
`TABLE 5. Mutations identified in the CYP17 gene of six patients
`
`;z(i;
`~ ~1
`co~~
`0
`,_
`~~
`
`0
`~G
`lc-1
`o l
`,....;~
`-<J:J
`lC'::lJ':)'-
`Cr'),.....;,.....;
`0')
`~t:-06~
`rlOO
`rl
`
`Patient
`
`Site of mutationn
`
`Allele 1
`F114V
`Steroid
`1
`D116V
`Steroid
`2
`Redox partner
`3
`R347C
`Redox partner
`R347C
`4
`Redox partner
`5 and 6
`R347H
`a Steroid indicates steroid binding domain; redox partner indicates
`redox partner interaction domain (Z8).
`
`Allele 2
`4-bp duplication exon 8
`4-bp duplication exon 8
`25-bp deletion exon 1
`4-bp duplication exon 8
`R347H
`
`Th.: Emlocrmc Soc1cty Duwn[o,~tlcd ftom prcss.endo!:11!1C org by !S{I!ld!VtduaiUscr.displayNamc) jon II J;mumy 2017 . .It 11 06 Fur personal usc only No othc1 uses Without perrms~mn. All tight:; teserved
`
`
`
`5718 J Clin Endocrinol Yletah, fk•cPJUbPr 2002. 87!l2l:5711-fJ721
`
`van d('Jl Akker eta/. • 17,20-LyaS(' Dt'ficH'ncy
`
`20
`
`16
`
`12
`
`8
`
`4
`
`I
`
`00
`'0
`c:
`(\1
`(/)
`::l
`0
`
`(i)
`Q)
`"5
`c
`.E
`.__..
`.s:: < !::.
`
`..-
`
`I
`
`0 1
`I
`
`"'
`
`;:,
`
`1200
`
`1000
`
`800
`
`800
`
`400
`
`200
`
`:2
`g;
`0
`E
`-S
`~
`UJ
`J:
`Ci
`+
`0>
`[I!
`q.
`J:
`0 ,__
`
`:2
`!!2
`0
`E
`-S
`~
`UJ
`J:
`Ci
`
`600
`
`450
`
`300
`
`150
`
`R347H
`R347C
`F114V
`wild type
`D116V
`FIG. 2. Production of 17-hydroxypregnenolone (170H-PregJ and
`DHEA after 8-h culture oftransfected COS-1 cells in the pres.mce of
`various concentrations of steroid precursors as a measure of 17u(cid:173)
`hydroxylase activity (A; culture with pregnenolone) and of 17 ,20-lyase
`activity (B; culture with 17-hydroxypregnenolone). The cells were
`transiently transfected with wild-type CYP17 and the CYP17 mu(cid:173)
`tants. Substrate concentrations were 0. 1, 0.2, 0.5, 1, or 2 !J.M. Data are
`the mean ::':: SEM (n = 3 in A and n = 4 in Bl.
`
`all above 0.95. Resulting apparent values for Km and V max
`have been summarized in Table 6. All Vmax values for the
`mutated proteins were lower than that for the wild-type
`protein, whereas Km values of the proteins with mutations in
`the steroid-binding domain were comparable to that of the
`wild-type protein, and the Km values for the other two pro(cid:173)
`teins were lower. As an example for the separate amounts of
`17-hydroxypregnenolone and DHEA produced, the data ob(cid:173)
`tained with 1 f..LM pregnenolone are plotted in Fig. 4. The use of
`a logarithmic axis allows a more clear indication of the amounts
`of DHEA. The wild-type enzyme and the F114V and D116V
`mutants converted between 10=20% of 17-hydroxypreg(cid:173)
`nenolone to DHEA, whereas the R347C and R347H mutants did
`not produce measurable concentrations of DHEA despite the
`production of 17-hydroxypregnenolone.
`Similar results were obtained using 17-hydroxypreg(cid:173)
`nenolone as the substrate (Fig. 2!3). Significant amounts of
`DHEA were only produced by the wild-type enzyme and the
`D116V mutant. The apparent Vmax and Km values for the
`wild-type enzyme were 1.55 min 1 and 0.35 f..LM, respectively.
`The production of DHEA by the mutated enzymes was too
`low to calculate Vmax and Km for the 17-hydroxypreg(cid:173)
`nenolone to DHEA conversion by these enzymes. Conver(cid:173)
`sion percentages at
`the highest concentration of 17-
`hydroxypregnenolone (2
`f..LM) were 31.3%, 0.15'Yo, 4.8%,
`0.03%, and 0.12% for wild-type, F114V, Dll6V, R347C, and
`R347H, respectively.
`
`0
`-15
`
`-10
`
`-5
`5
`0
`1/S ( micromol)
`FIG. 3. Lineweaver-Burk plot for the conversion of pregnenolone to
`17-hydruxypregnenolone plus DHEA, shown in Fig. ~A, by wild-type
`CYPJ7 1e1. and the D116V L.\1. R347C 10), and R347H (£)mutants.
`Resull:; for the• F114V mutant are nut shown. l>ecause all nwasured
`values are outside the axes Llsed
`
`10
`
`15
`
`TABLE 6, Enzyme kinetic data on the 17<x-hydroxylase activity of
`the CYP17 mutants investigated
`
`Wild
`O.!J7
`3.0
`
`Fll4V
`0.76
`0.04
`
`D116V
`0.95
`0.56
`
`H:l47C
`0.08
`0.10
`
`H:l47Il
`0.27
`0.50
`
`Kmi!J.M)
`Vmax (min-
`
`1000
`
`:2
`~ 100
`0
`E
`-S
`u
`" '0
`E'
`0..
`
`10
`
`R347H
`F114V
`R347C
`wt
`D116V
`F11;. 4. Separate productions of 17-hydroxypregnenolone 1•1 and
`DHEA (~)from 1 !J.M pregnenolone by the COS-I cells described in
`Fig. 2A. Note the logarithmic y-axis
`
`When progesterone was used as a substrate for testing the
`:.-~-steroid biosynthetic pathway, the production of 17-
`hydroxyprogesterone, indicative of hydroxylase activity,
`showed a similar pattern as
`the production of 17-
`hydroxypregnenolone from pregnenolone, but at lower lev(cid:173)
`els (Fig. 5). With neither progesterone nor 17-hydroxypro(cid:173)
`gesterone (results not shown) as substrate did we observe
`significant production of androstenedione by the mutant
`
`The Endocnn~ SocJCty Down!oa.:lcd fmm pres~ cndocnnc nrg by{~ jmdivnluulU~cr.displayNanw} Jon 11 hnuary 2017 at 21·06 Fm personalu~c only No utlwr use~ W1lh\l\J! pern11sston All nght> n:-scrved
`
`
`
`van den Akkcr et al. • 17 )20-Lyasc DC'f1ueucv
`
`J Clin Endocrinol Metab, December 2002, 87112):5711-5721 5719
`
`125
`
`100
`
`75
`
`50
`
`25
`
`(!)
`D.
`.2.:'
`:!2
`·~ ._
`0
`~ 0
`
`0
`
`CYP17 wt F114V
`R347H
`D116V R347C
`FIG. 5. Relative production of 17·hydroxyprogesterone as a measure
`of 17 <>-hydroxylase activity (0) and androstenedione as a measure of
`17 ,20-lyase activity (t!2i) in COS-1 cells that were transiently trans(cid:173)
`fected with wild-type lwtJ CYP 17 or the CYPJ7 mutants and cultured
`with 1J.LM progesterone as substrate. For CYPI7 wild-type transfected
`cells, the 17-hydroxyproge:;teronc concentration was ?GO nmol/liter,
`and the androstenedione concentration was 33 nrnol!liter. Data are
`the mean ·• SEM In - 4).
`
`proteins, indicating the absence of 17,20-lyase activity under
`these conditions.
`
`Discussion
`
`Combined 17 a-hydroxylase /17,20-lyase deficiency (pa(cid:173)
`tients 1 and 2) is a well defined disorder (26). Isolated 17,20-
`lyase deficiency (patients 3-6) with subnormal17a-hydrox(cid:173)
`ylase function leading to a female phenotype or ambiguous
`genitalia, absence of sexual development, and normal basal
`cortisol levels without hypertension is extremely rare, with
`few clinical data. Isolated 17,20-lyase deficiency can be dif(cid:173)
`ferentia ted from combined 17 a-hydroxy lase /17,20-1 yase
`deficiency by an ACTH test, showing elevated progesterone
`in 17a-hydroxylase-deficient patients and elevated 17-
`hydroxyprogesterone with subnormal rise of cortisol in pa(cid:173)
`tients with isolated 17,20-lyase deficiency. All of our patients
`had normal basal cortisol serum levels, but insufficient re(cid:173)
`sponse to stimulation by ACTH. No guidelines are available
`for the hydrocortisone substitution treatment in these pa(cid:173)
`tients. In our view, daily hydrocortisone substitution treat(cid:173)
`ment is not needed when there are no complaints, but in case
`of stress, a hydrocortisone stress dose is advised. Neverthe(cid:173)
`less, some of our patients underwent uneventful surgery
`without a hydrocortisone stress scheme.
`In four of our six patients (patients l-4), one allele of the
`CYJ'17 gene was completely inactive due to insertions or
`deletions resulting in a frameshift. Patient 1 had a missense
`mutation in the steroid-binding dornam in the other Jllele:
`F114V. This resulted in a combined complete 17a-hydrox(cid:173)
`ylase/17,20-lyase deficiency, with a complete female phe(cid:173)
`notype. Patient 2 also had a mutation in the steroid-binding
`domain in the second allele (Dll6V), but had milder com(cid:173)
`bined 17a-hydroxylase/17,20-lyase deficiency with low, but
`measurable, levels of androgens, explaining her ambiguous
`genitalia. The F114V mutation (patient 1) appears to affect
`steroid binding more seriously than the Dll6V mutation
`(patient 2) both in vivo as well as in the in vitro transfection
`
`experiments. Neither of these mutations has been described
`before. Like these two mutations, all other known mutations
`in the steroid-binding domain cause defects that affect 17a(cid:173)
`hydroxylase and 17,20-lyase activities to a similar extent.
`With regard to the patients with mutations in the redox
`partner interaction domain, special attention should be paid
`to the genotypic and phenotypic differences. Complete 17,20-
`lyase deficiency results in a complete female phenotype in
`46,XY individuals (patients 3 and 4), but is theoretically not
`expected to result in ambiguous genitalia (patients 5 and 6).
`Patients 5 and 6 are, just like one of the previously described
`patients (10), homozygous for the R347H mutation and sim(cid:173)
`ilarly had ambiguous genitalia at birth, indicating slight re(cid:173)
`sidual capacity for androgen synthesis. In contrast to this,
`patients 3 and 4 were heterozygous for another mutation in
`the same codon (R347C), the other allele being completely
`inactive due to a frameshift mutation. These two patients
`(both with an 46,XY genotype) showed female genitalia at
`birth and had barely detectable androgen levels. The differ(cid:173)
`ences between patients 5 and 6, on the one hand, and patients
`3 and 4, on the other, indicate that the R347C mutation is
`more deleterious for the 17 a-hydroxylase and I or 17,20-lyase
`reaction than the R347H mutation, as is also shown by the
`results of the transfection experiments. To explain the large
`difference in 17a-hydroxylase activity of mutations R347C
`and R347H, we hypothesize that the change of arginine to
`cysteine disrupts the function of the whole protein more
`seriously than a change to histidine, because of the possibility
`of the formation of abnormal cysteine dimers, causing not
`only disruption of 17,20-lyase activity, but also of 17a(cid:173)
`hydroxylase. In addition, the functional allele in patients 3
`and 4 may be haplo-insufficient and result in residual en(cid:173)
`zyme activity that is too low to stimulate male genital dif(cid:173)
`ferentiation, whereas the homozygous presence of the R347H
`mutation may cause the residual presence of sufficient 17,20-
`lyase activity.
`The partially virilized genitalia of patients 5 and 6 and the
`ability to synthesize some testosterone in the hCG test are not
`in accordance with our finding of absence of lyase activity in
`vitro. As described previously, R347 and R358, which are
`located in the redox partner interaction domain and contrib(cid:173)
`ute to the positive charges on the proximal surface of
`P450c17, are known to be key residues involved in the in(cid:173)
`teraction with redox partner proteins. Geller et al. (20) re(cid:173)
`ported that the absence of these charged amino acids selec(cid:173)
`impairs 17,20-lyase activity without substantial
`tively
`reductions
`in 17ct-hydroxylase activity or 17-hydroxy(cid:173)
`pregnenolone binding. Coexpression of the R347 and R358
`mutants with P450 oxidoreductase did not result in a sig(cid:173)
`nificant increase in 17,20-lyase activity, but addition of excess
`cytochrome b5 partially restored 17,20-lyase activity (20).
`Thus, the ambiguous genitalia in R347H homozygous pa(cid:173)
`tients might be explained by a partial rescue of the R347H
`mutation through in vivo accumulation of cytochrome bS in
`these patients.
`To obtain a more detailed view of the P450c17 enzyme
`function in our patients, we compared the clinical data with
`in vitro expression studies. The Km values obtained for the
`wild-type enzyme are in line with reported values (18, 27),
`and the R347H mutation yields a lower value as described
`
`rlw Emlonme So~·tcty Downloaded !rom pte~~ cnducrme mg by [$1mdJVIdualllwr.di'iplayNarnc} I on II Janual)' :!017 at 21 0(> F1H pcl~tmaltl~!' on I> No qthc1 u~e'> Without pernu~~!On All nghb reserved
`
`
`
`5720 J Clin Endocrinol Ml'!,;b, December 2002, H71 I21:G7!·1-G721
`
`van den Akker eta!. • 17,20.Lyase Deficiency
`
`previously (20); these researchers also described an approx(cid:173)
`imately 3-fold reduction of the V m<lx for this mutant enzyme.
`The enzyme activities of the mutated proteins in vitro were
`consistent with the clinical data and the hypothesis that
`mutations in the steroid-binding domain result in combined
`complete or partial 17a-hydroxylase and 17,20-lyase defi(cid:173)
`ciency, whereas mutations in the redox partner interaction
`domain result in isolated 17,20-lyase deficiency. The latter
`point becomes especially clear from the results of the con(cid:173)
`version of pregnenolone to DHEA; although the production
`of 17-hydroxypregnenolone by the cells transfected with the
`R347C and R347H mutated CYP17 was larger than or com(cid:173)
`parable to that of the F114V and D116V cells, the amount of
`DHEA produced by the former two cell types was much
`lower than that secreted by the latter.
`The in vitro results of the present study were obtained
`using the conversion of nonradioactive precursors to prod(cid:173)
`ucts, which were measured by RIA. Using this type of de(cid:173)
`tection, Biason-Lauber eta/. (13) showed that the F417C m