`& 2006 Cancer Research UK All rights reserved 0007 – 0920/06 $30.00
`
`www.bjcancer.com
`
`Sorafenib in advanced melanoma: a Phase II randomised
`discontinuation trial analysis
`
`ClinicalStudies
`
`T Eisen*,1, T Ahmad1, KT Flaherty2, M Gore1, S Kaye1, R Marais1, I Gibbens1, S Hackett1, M James1,
`LM Schuchter2, KL Nathanson2, C Xia3, R Simantov3, B Schwartz3, M Poulin-Costello3, PJ O’Dwyer2
`and MJ Ratain4
`1Royal Marsden Hospital, Downs Road, Surrey SMT 5PT, UK; 2Abramson Cancer Center of the University of Pennsylvania, Philadelphia, PA 19104, USA;
`3Bayer Pharmaceuticals Corporation, West Haven, CT 06516, USA; 4Department of Medicine, University of Chicago, Chicago, IL 60637, USA
`
`The effects of sorafenib – an oral multikinase inhibitor targeting the tumour and tumour vasculature – were evaluated in patients with
`advanced melanoma enrolled in a large multidisease Phase II randomised discontinuation trial (RDT). Enrolled patients received a
`12-week run-in of sorafenib 400 mg twice daily (b.i.d.). Patients with changes in bi-dimensional tumour measurements o25% from
`baseline were then randomised to sorafenib or placebo for a further 12 weeks (ie to week 24). Patients with X25% tumour
`shrinkage after the run-in continued on open-label sorafenib, whereas those with X25% tumour growth discontinued treatment. This
`analysis focussed on secondary RDT end points: changes in bi-dimensional tumour measurements from baseline after 12 weeks and
`overall tumour responses (WHO criteria) at week 24, progression-free survival (PFS), safety and biomarkers (BRAF, KRAS and NRAS
`mutational status). Of 37 melanoma patients treated during the run-in phase, 34 were evaluable for response: one had X25%
`tumour shrinkage and remained on open-label sorafenib; six (16%) had o25% tumour growth and were randomised (placebo, n¼ 3;
`sorafenib, n¼ 3); and 27 had X25% tumour growth and discontinued. All three randomised sorafenib patients progressed by week
`24; one remained on sorafenib for symptomatic relief. All three placebo patients progressed by week-24 and were re-started on
`sorafenib; one experienced disease re-stabilisation. Overall, the confirmed best responses for each of the 37 melanoma patients who
`received sorafenib were 19% stable disease (SD) (ie n¼ 1 open-label; n¼ 6 randomised), 62% (n¼ 23) progressive disease (PD) and
`19% (n¼ 7) unevaluable. The overall median PFS was 11 weeks. The six randomised patients with SD had overall PFS values ranging
`from 16 to 34 weeks. The most common drug-related adverse events were dermatological (eg rash/desquamation, 51%; hand-foot
`skin reaction, 35%). There was no relationship between V600E BRAF status and disease stability. DNA was extracted from the
`biopsies of 17/22 patients. Six had V600E-positive tumours (n¼ 4 had PD; n¼ 1 had SD; n¼ 1 unevaluable for response), and 11 had
`tumours containing wild-type BRAF (n¼ 9 PD; n¼ 1 SD; n¼ 1 unevaluable for response). In conclusion, sorafenib is well tolerated
`but has little or no antitumour activity in advanced melanoma patients as a single agent at the dose evaluated (400 mg b.i.d.). Ongoing
`trials in advanced melanoma are evaluating sorafenib combination therapies.
`British Journal of Cancer (2006) 95, 581 – 586. doi:10.1038/sj.bjc.6603291 www.bjcancer.com
`Published online 1 August 2006
`& 2006 Cancer Research UK
`
`Keywords: Sorafenib; multikinase inhibitor; advanced melanoma; V600E BRAF; randomised discontinuation trial
`
`
`
`The incidence of malignant melanoma is rising, and the current
`treatment options for patients with metastatic disease are limited
`and noncurative in the majority of cases (Alexandrescu et al, 2005;
`Danson and Lorigan, 2005). According to the American Joint
`Committee on Cancer, patients with advanced metastatic melano-
`ma (stage IV) have a 5-year survival rate of only 2% (Balch et al,
`2001).
`Increased signalling through the RAF/MEK/ERK pathway, as
`a result of autocrine stimulation by basic fibroblast growth
`factor and hepatocyte growth factor, is implicated in melano-
`cytic tumorigenesis (tumour growth,
`invasion and metastasis)
`(Satyamoorthy et al, 2003). Furthermore, the activity of ERK,
`which is downstream of RAF, has been shown to increase from
`
`*Correspondence: Dr T Eisen, Urology, Skin and Lung Units, The Royal
`Marsden Hospital, Sycamore House, Downs Road, Sutton, Surrey SMT
`5PT, UK. E-mail: tim.eisen@icr.ac.uk
`Received 10 April 2006; revised 27 June 2006; accepted 27 June 2006;
`published online 1 August 2006
`
`early- to advanced-stage melanoma (Satyamoorthy et al, 2003).
`This increased ERK activity may be the consequence of activating
`BRAF mutations, which are present in up to 80% of human
`melanomas (Davies et al, 2002; Chang et al, 2004; Garnett and
`Marais, 2004). The most prevalent oncogenic BRAF mutation is the
`V600E BRAF mutation (previous terminology, V599E), which is
`present in 63% of melanomas (Brose et al, 2002). The increased
`apoptosis, observed in human melanoma cell lines when BRAF
`expression is downregulated using RNA interference, supports a
`role for oncogenic BRAF-driven MEK/ERK overactivation in
`maintaining the transformed phenotype of malignant melanoma
`cells (Hingorani et al, 2003; Karasarides et al, 2004). This
`observation also suggests that BRAF is a rational target for the
`design of targeted agents to treat melanoma.
`The orally administered targeted-agent sorafenib (Nexavars,
`Bayer Pharmaceuticals Corporation, West Haven, CT, USA) was
`originally developed as an inhibitor of the RAF serine/threonine
`kinases (RAF-1, wild-type BRAF, V600E BRAF) (Wilhelm et al,
`2004). However, results of in vitro studies have since shown that
`
`NOVARTIS EXHIBIT 2101
`Par v. Novartis, IPR 2016-01479
`Page 1 of 6
`
`
`
`sorafenib monotherapy in a cohort of patients with progressive
`advanced (ie unresectable or metastatic) melanoma, who partici-
`pated in this Phase II RDT.
`
`Efficacy and safety assessments
`
`As described previously (Ratain et al, 2006), the primary end point
`was the percentage of patients remaining progression free at 12
`weeks postrandomisation. Secondary endpoints included PFS after
`randomisation, overall PFS,
`tumour response rate and safety
`(Ratain et al, 2006). This analysis will focus on the changes from
`baseline in bidimensional tumour measurements after the run-in
`phase, tumour responses for the entire treatment period, PFS and
`safety findings for a cohort of patients with advanced melanoma.
`Tumour response was assessed at 12 weeks, and every 6 weeks
`thereafter, using standard bidimensional measurements in accor-
`dance with WHO guidelines for partial response (PR), stable
`disease (SD) and PD. Objective responses (ie minor response and
`PR only) were confirmed at least 4 weeks after the original
`documentation.
`Safety was assessed for the entire treatment period (run-in plus
`randomisation). All patients who received at least one dose of
`study drug were evaluable for safety. Safety assessments were
`performed every 3 weeks during the run-in and randomised
`phases, and every 4 weeks thereafter. Toxicities were graded
`according to the National Cancer Institute Common Toxicity
`Criteria version 2.0 (NCI-CTC v2.0), and relationship to study drug
`was recorded.
`
`Biomarkers: BRAF and RAS oncogenes
`
`DNA extracted from the tumour biopsies of patients was screened
`for the presence of oncogenic BRAF and RAS mutations. Owing to
`the majority of oncogenic BRAF mutations in melanoma patients
`are likely to occur within the kinase domain (eg the prevalent
`V600E BRAF mutation), exon 15 was analysed first. Exon 11 of
`BRAF was also screened for the presence of common mutations in
`the glycine-rich loop. In addition, exons 2 and 3 of NRAS
`(University of Pennsylvania and Royal Marsden Hospital Melano-
`ma Unit) and KRAS (Royal Marsden Hospital Melanoma Unit)
`were screened for common oncogenic mutations. Fresh tumour
`samples, obtained from patients at The Royal Marsden Hospital
`Melanoma Unit and the University of Pennsylvania, were snap-
`frozen and stored at 801C until use. Genomic DNA from snap-
`frozen samples, or from paraffin-embedded blocks, was then
`extracted by lysing tumour samples with proteinase K and tissue
`lysis buffer, and treatment with RNAse to eliminate residual RNA.
`The extracted genomic DNA was then purified on a silica-gel
`membrane column. BRAF and RAS exons of interest were then
`amplified by the polymerase chain reaction (PCR) using the
`following primers, under optimised conditions:
`
`Forward
`
`Reverse
`
`BRAF exon 15: TCATAATGCTTGCTCTGATAGGA GGCCAAAAATTTAATCAGTGGA
`BRAF exon 11: TCCCTCTCAGGCATAAGGTAA
`CGAACAGTGAATATTTCCTTTGAT
`NRAS exon 2: GAACCAAATGGAAGGTCACA
`TGGGTAAAGATGATCCGACA
`NRAS exon 3: GGTGAAACCTGTTTGTTGGA
`AACCTAAAACCAACTCTTTCCCA
`KRAS exon 2: GTGTGACATGTTCTAATATAGTC GAATGGTCCTGCACCAGTAA
`KRAS exon 3:
`TCAAGTCCTTTGCCCATTTT
`TGCATGGCATTAGCAAAGAC
`
`Polymerase chain reaction products were then purified by
`agarose gel electrophoresis, and automated dideoxy DNA sequen-
`cing was performed using the primers that were used for the
`amplification step and Big-Dye Terminator RR mix. DNA
`sequences were analysed using the Sequencher 4.2.1 programme.
`
`Phase II sorafenib analysis in melanoma patients
`T Eisen et al
`
`sorafenib is a potent multikinase inhibitor, which also targets
`receptor tyrosine kinases associated with tumour angiogenesis
`(VEGFR-2, VEGFR-3, PDGFR-b) and tumour progression (c-KIT,
`FLT-3) (Wilhelm et al, 2004). Sorafenib has also been shown to
`inhibit the growth of several human tumour xenograft models by
`targeting tumour cell proliferation and/or endothelial cell-
`mediated tumour angiogenesis (Wilhelm et al, 2004).
`Sorafenib monotherapy has been shown to have a manageable
`side effect profile in Phase I/II/III studies (Strumberg et al, 2003,
`2005; Ratain et al, 2004, 2006; Awada et al, 2005; Escudier et al,
`2005). The most common toxicities associated with sorafenib are
`hand-foot skin reaction (HFS), rash and diarrhoea (Strumberg
`et al, 2003, 2005; Ratain et al, 2004, 2006; Awada et al, 2005;
`Escudier et al, 2005). However,
`these adverse events are
`predominantly mild to moderate in severity and easily manage-
`able. The efficacy of sorafenib monotherapy in patients with
`advanced,
`refractory renal cell carcinoma (RCC) was
`first
`demonstrated in a Phase II randomised discontinuation trial
`(RDT), which showed a significantly longer progression-free
`survival (PFS) relative to placebo. Sorafenib received marketing
`approval
`in the US in December 2005 for the treatment of
`advanced RCC, based on the results of the RDT as well as the
`Phase III placebo-controlled TARGETs (Treatment Approaches
`in Renal cancer Global Evaluation Trial). The Phase III trial
`demonstrated a statistically significant doubling of PFS and
`longer overall survival (hazard ratio¼ 0.72 for sorafenib over
`placebo) in patients treated with sorafenib relative to placebo
`treatment
`(Nexavar prescribing information, 2006)
`(Escudier
`et al, 2005).
`Here, we present an analysis of the efficacy and safety of
`sorafenib monotherapy in a cohort of patients with progressive
`advanced melanoma.
`
`MATERIALS AND METHODS
`
`Patients’ characteristics and study design
`
`This Phase II, placebo-controlled RDT was conducted at five
`centres in two countries (four centres in the US, one centre in the
`UK). Enrolment began on 25 September 2002. All patients
`participating in the RDT provided written,
`informed consent.
`The trial protocol received institutional ethics committee approval
`at each participating centre, and was conducted in accordance with
`Good Clinical Practice guidelines and the Declaration of Helsinki.
`The design of this RDT, including patients’ details and inclusion
`and exclusion criteria, has been described previously (Ratain et al,
`2006). Briefly, eligible patients had histologically or cytologically
`confirmed, progressive advanced unresectable, or metastatic
`cancer. Sorafenib was initially administered to all patients in a
`12-week, open-label, run-in period using continuous oral dosing at
`400 mg twice daily (b.i.d.). After the 12-week run-in period, disease
`status was assessed based on change in bidimensional tumour
`from baseline. Patients with X25% tumour
`measurements
`shrinkage continued to receive sorafenib open label until they
`experienced disease progression or unacceptable toxicity, whereas
`patients with progressive disease (PD; X25% tumour growth or
`other clinical evidence of progression) were discontinued. Those
`patients who had an unconfirmed change in tumour size of o25%
`were randomised in a double-blind fashion to receive either
`sorafenib 400 mg b.i.d., continuously, or matching placebo from
`week 12 onwards. Patients with progression of disease – defined as
`a change in bidimensional tumour measurement from randomisa-
`tion of X25%, or clinically assessed progression – at any time after
`randomisation, were unblinded. Progressors from the placebo
`group were given the opportunity to crossover to sorafenib,
`whereas those who progressed while on sorafenib were discon-
`tinued. In this analysis, we evaluated the efficacy and safety of
`
`582
`
`Clinical Studies
`
`British Journal of Cancer (2006) 95(5), 581 – 586
`
`& 2006 Cancer Research UK
`
`NOVARTIS EXHIBIT 2101
`Par v. Novartis, IPR 2016-01479
`Page 2 of 6
`
`
`
`583
`
`ClinicalStudies
`
`Phase II sorafenib analysis in melanoma patients
`T Eisen et al
`
`four patients who discontinued before the 12-week assessment all
`withdrew because of adverse events: three had dermatological
`events of grade 3 in severity (skin toxicity, n¼ 1; plantar – palmar
`erythema, n¼ 2), one had a grade 4 cerebral embolic event.
`At week 12, investigator-assessed bidimensional tumour mea-
`surements were available for 34 (92%) of the 37 patients. One
`patient (3%) achieved tumour shrinkage X25% compared with
`baseline and consequently continued with open-label sorafenib
`treatment. This patient had an overall duration of treatment of 16
`weeks, and PFS of 15 weeks. This patient had three measurable
`lung metastases. The first lung metastasis showed 75% shrinkage
`after 106 days of treatment and 84% shrinkage after 136 days. The
`second metastatic lung lesion had shrunk by 80% after 106 days of
`treatment and had disappeared by 136 days. The third lung
`metastasis had completely disappeared after 106 days’ treatment.
`Six patients (16%) had tumour measurements that remained
`within 25% of baseline levels. The first patient had SD after 89 days
`of treatment; there was no change in tumour size until PD was
`proven after 194 days of treatment. The second patient had SD
`after 79 days’ treatment; there was a 5.9% change in tumour size.
`After 115 days of treatment this patient was proven to have PD.
`However, at a confirmatory scan after 176 days this patient had SD
`again. After 428 days this patient was considered to have PD by
`clinical judgment, but a scan at 512 days revealed that the patient
`still had SD. The third patient developed SD after 85 days of
`treatment (24% change in tumour size), was considered to have PD
`after 113 days (53% tumour growth), but had re-stabilised after 184
`days’ treatment (9.9% tumour shrinkage). This patient finally
`progressed after 249 days’ treatment. The fourth patient had SD
`after 96 days’ treatment (0.6% change in tumour size) and was still
`stable after 138 days (6.4% tumour shrinkage). At 404 days this
`patient still had SD (4.6% tumour shrinkage), but then progressed
`after 453 days. The fifth patient with SD had progressed after 81
`days on treatment, while the sixth patient had SD after 84 days
`treatment (15% tumour shrinkage), and at day 124 (8.8% tumour
`growth) but had PD confirmed after two scans after 237 (2.9%
`growth) and 321 days’ (20.6% growth) treatment.
`The patients with SD at week-12 were then randomised: three
`received placebo and three received sorafenib. Twenty-seven
`patients (73%) had PD (ie tumour growth X25% or other clinical
`evidence of progression), and were discontinued.
`
`Antitumour activity: randomised phase
`
`three patients with melanoma randomised to
`Although all
`sorafenib progressed at 12 weeks postrandomisation (24 weeks
`from initiation); only two were discontinued. The third patient was
`considered by the investigator to be deriving clinical benefit and
`was, therefore, continued on sorafenib monotherapy. At 12 weeks
`postrandomisation, all three melanoma patients who received
`placebo had progressed and, therefore, were crossed over to
`sorafenib monotherapy in accordance with the study protocol.
`After crossing over,
`the three patients had further disease
`progression at 11, 15 and 22 weeks, respectively. The patient
`who progressed after 15 weeks remained on sorafenib for a total
`duration of 73 weeks because, in the opinion of the investigator,
`the patient was continuing to derive clinical benefit.
`
`Statistical analysis
`
`The PFS attributable to sorafenib was estimated by combining
`information from the various treatment groups and treatment
`periods. All patients contributed to the estimate of PFS for the first
`12 weeks of therapy. The estimate of PFS for the first 12 weeks was
`combined with an estimate of PFS after 12 weeks, the latter
`assuming a patient was alive and progression free at 12 weeks.
`Progression-free survival was estimated after 12 weeks as a
`weighted average of group-specific PFS for the two groups (ie
`open-label and randomised groups). This methodology has been
`fully described previously (Ratain et al, 2006).
`
`RESULTS
`
`In total, 502 patients with a variety of tumour types, including RCC
`and melanoma, were enrolled in this RDT; 501 of these patients
`received sorafenib. This report focusses on the 37 treated patients
`who had progressive advanced melanoma at the time of study
`enrolment. The baseline characteristics of these patients are shown
`in Table 1. Forty-one percent of these patients had an Eastern
`Cooperative Oncology Group performance status (ECOG PS) of 0,
`and 57% of patients had an ECOG PS of 1. At baseline, 70% of
`these patients had failed at least one prior systemic therapy, and
`27% had also received prior radiotherapy.
`
`Twelve-week response assessment
`
`The 12-week sorafenib run-in phase was completed by 33 (89%) of
`patients with advanced unresectable or metastatic melanoma. The
`
`Table 1 Baseline characteristics for all treated patients with advanced
`melanoma
`
`Characteristics
`
`Gender (n (%))
`Male
`Female
`Median age (years (range))
`
`ECOG PS (n (%))
`0
`1
`2
`3
`
`AJCC stage at study entry (n (%))
`III
`IV
`
`Most common sites of disease (all lesions)a (n (%))
`Lung
`Lymph node
`Liver
`Adrenal
`Median duration of diseaseb (years (range))
`
`Prior therapy (n (%))
`Systemic anticancer therapy
`Surgery
`Radiotherapy
`
`Patients (n¼ 37)
`
`23 (62)
`14 (38)
`53 (18 – 85)
`
`15 (41)
`21 (57)
`0 (0)
`1 (3)
`
`4 (11)
`21 (57)
`
`24 (65)
`20 (54)
`12 (32)
`8 (22)
`2.7 (0.2 – 12.9)
`
`26 (70)
`36 (97)
`10 (27)
`
`Number of prior systemic regimens
`None
`11 (30)
`1
`13 (35)
`2
`8 (22)
`X3
`5 (13)
`AJCC¼ American Joint Committee on Cancer; ECOG PS¼ Eastern Cooperative
`Oncology Group performance status. aAll target and nontarget lesions occurring with
`a frequency X20%. bYears from initial diagnosis to first study treatment.
`
`Antitumour activity: entire treatment period
`
`the confirmed
`the entire treatment period,
`the end of
`At
`investigator-assessed best responses (WHO criteria) to sorafenib
`were 19% SD, 62% PD and 19% unevaluable. The median PFS for
`the entire treatment period, based on investigator-assessed data,
`was 11 weeks (n¼ 32; range 9 – 12 weeks). The six randomised
`melanoma patients with SD had overall PFS durations of 16
`(n¼ 3), 18 (n¼ 1), 28 (n¼ 1) and 34 (n¼ 1) weeks. The median
`
`& 2006 Cancer Research UK
`
`British Journal of Cancer (2006) 95(5), 581 – 586
`
`NOVARTIS EXHIBIT 2101
`Par v. Novartis, IPR 2016-01479
`Page 3 of 6
`
`
`
`Phase II sorafenib analysis in melanoma patients
`T Eisen et al
`
`time to disease progression for all melanoma patients over the
`entire treatment period was 11 weeks (n¼ 30; range 9 – 13 weeks).
`
`interruptions were reported in 12 patients, of which 10 were due to
`drug-related adverse events.
`
`Biomarkers
`
`DNA was successfully extracted and screened from 17 of 22
`tumour biopsies. Six biopsies had oncogenic V600E BRAF
`mutations within exon 15, while the remaining 11 had wild-type
`BRAF. Of the six V600E BRAF-positive tumour biopsies, four were
`obtained from patients with PD, one from a patient with SD and
`one from a patient who was unevaluable for response. Only one
`wild-type BRAF-positive tumour biopsy was derived from a patient
`with SD, nine were from patients with PD, and one from an
`unevaluable patient. BRAF mutational status data for 15 patients
`who were evaluable for response are shown in Figure 1. No
`oncogenic BRAF mutations were identified in exon 11 in any of the
`tumour biopsies evaluated, and only one oncogenic NRAS (61K)
`mutation was detected. No other oncogenic NRAS or KRAS
`mutations were identified.
`
`DISCUSSION
`
`The efficacy and safety of sorafenib monotherapy were evaluated
`in patients with advanced melanoma, who participated in a large
`Phase II RDT involving patients with several advanced solid
`tumour types (Ratain et al, 2006). An analysis focussing on
`melanoma patients was performed in the light of evidence
`supporting a role for increased signalling through RAF/MEK/
`ERK in the onset and progression of melanoma (Davies et al, 2002;
`Chang et al, 2004; Garnett and Marais, 2004), and the prevalence of
`oncogenic V600E BRAF mutations in melanoma biopsies (Brose
`et al, 2002). Recent preclinical evidence, showing that blocking
`V600E BRAF expression promotes apoptosis in human melanoma
`cells, provided a rationale for targeting signalling through RAF/
`MEK/ERK in the treatment of melanoma (Hingorani et al, 2003;
`Karasarides et al, 2004). Despite this rationale, the data in this
`study at the 400 mg b.i.d. dose studied were disappointing, and are
`most consistent with a conclusion that the drug has little or no
`activity as a single agent in this disease.
`In human xenograft models, sorafenib has been shown to act on
`tumour cells to exert an antiproliferative effect, and on endothelial
`
`SD PD
`
`Wild-type BRAF
`
`Oncogenic BRAF V600E
`
`10
`
`0123456789
`
`Number of patients (n)
`
`Figure 1 BRAF mutational status of advanced melanoma patients is not
`associated with disease status (status of 15 patients evaluable for response).
`These patients were also evaluated for oncogenic BRAF mutations within
`exon 11 and oncogenic NRAS and KRAS mutations. One oncogenic NRAS
`(61K) mutation was found. No other oncogenic NRAS or KRAS mutations
`were detected. Two patients were unevaluable for response (n¼ 1 wild-
`type BRAF; n¼ 1 BRAF V600E) and are not included in the above
`histogram. DNA could not be extracted from a further five biopsies. The
`mutational status of the biopsies from five patients was, therefore, not
`determined (n¼ 3 PD; n¼ 2 SD).
`
`Safety
`
`Safety was assessed across the entire treatment period for all 37
`patients with advanced melanoma. The most common treatment-
`emergent adverse events, regardless of attribution, were fatigue
`(81%); pain (73%); gastrointestinal adverse events,
`including
`diarrhoea (51%) and constipation (46%); and dermatological
`reactions (dermatology/skin – other, 49%; alopecia, 38%; HFS,
`35%). The majority of these events were NCI-CTC v2.0 grades 1 – 2.
`For example, seven patients (18.9%) had grade 1 alopecia and a
`further seven (18.9%) had grade 2 alopecia; none had grade 3, 4 or
`5 alopecia. Grade 3/4 hypertension was observed in 14% of
`patients. Serious adverse events were reported in 51% of the
`melanoma patients, and were attributed mostly to disease
`progression rather than study drug. Hypertension was not
`reported as a serious adverse event, and none of the melanoma
`patients discontinued therapy because of hypertension. Adverse
`events of any grade attributed by the investigator to study drug (ie
`drug-related adverse events) were reported in 89% of patients
`(Table 2). The most common drug-related adverse events among
`melanoma patients were dermatological (rash/desquamation, 51%;
`HFS, 35%; and alopecia, 35%); gastrointestinal (diarrhoea, 32%;
`and stomatitis/pharyngitis, 22%); or constitutional (fatigue, 43%)
`(Table 2). The majority of drug-related adverse events were grades
`1 – 2 in severity. In total, 8% of patients experienced serious drug-
`related adverse events (all Xgrade 3). No grade 4 drug-related
`adverse events were reported. Six patients required dose reduc-
`tions because of drug-related dermatological adverse events. Dose
`
`Table 2 Incidence of drug-related adverse events reported in X10% of
`all treated patients (n¼ 37)
`
`Adverse event
`
`Any event
`
`Cardiovascular
`Hypertension
`
`Dermatology
`Rash/desquamation
`Hand-foot skin reaction
`Alopecia
`Flushing
`Other
`
`Constitutional symptoms
`Fatigue
`Weight loss
`
`Gastrointestinal
`Diarrhoea
`Anorexia
`Stomatitis/pharyngitis (oral/pharyngeal)
`Nausea
`Otherb
`Constipation
`
`Neurology
`Neuropathy – sensory
`
`All grades
`n (%)
`
`Grade 3a
`n (%)
`
`33 (89.2)
`
`12 (32.4)
`
`6 (16.2)
`
`5 (13.5)
`
`19 (51.4)
`13 (35.1)
`13 (35.1)
`4 (10.8)
`12 (32.4)
`
`16 (43.2)
`6 (16.2)
`
`12 (32.4)
`5 (13.5)
`8 (21.6)
`5 (13.5)
`5 (13.5)
`4 (10.8)
`
`2 (5.4)
`4 (10.8)
`0 (0.0)
`0 (0.0)
`0 (0.0)
`
`0 (0.0)
`0 (0.0)
`
`0 (0.0)
`0 (0.0)
`0 (0.0)
`0 (0.0)
`0 (0.0)
`0 (0.0)
`
`5 (13.5)
`
`0 (0.0)
`
`aNo grade 4 drug-related adverse events were reported. bThis included: sore gums
`(grade 1; n¼ 1), ulcers on gums (grade 2; n¼ 1), mouth soreness (grade 1; n¼ 1),
`and one patient with intermittent stomach upset (grade 1), indigestion (grade 1), and
`diarrhoea (grade 2).
`
`British Journal of Cancer (2006) 95(5), 581 – 586
`
`& 2006 Cancer Research UK
`
`584
`
`Clinical Studies
`
`NOVARTIS EXHIBIT 2101
`Par v. Novartis, IPR 2016-01479
`Page 4 of 6
`
`
`
`585
`
`ClinicalStudies
`
`Phase II sorafenib analysis in melanoma patients
`T Eisen et al
`
`inhibition of Raf kinase, a known mediator of taxane resistance
`(Britten and Klein, 2000). In another Phase I trial, the combination
`of sorafenib with dacarbazine induced a PR in three, and SD in five
`of 10 evaluable patients with advanced melanoma (Eisen et al,
`2005). Further investigations are warranted to determine whether
`sorafenib may significantly increase response to chemotherapy
`and prolong PFS in patients with advanced melanoma.
`Given the preclinical and clinical evidence supporting a role for
`oncogenic BRAF in driving melanoma progression, it is unclear
`why sorafenib 400 mg b.i.d. did not demonstrate significant
`activity as a monotherapy in advanced melanoma patients. It is
`conceivable that
`this
`lack of effect
`is due to insufficient
`concentrations of sorafenib being achieved within the plasma,
`and more importantly within the tumours of these patients. The
`IC50 of sorafenib in humans is approximately 5 mM (Clark et al,
`2005), and may not have been achieved in these melanoma
`patients. However, pharmacokinetic trials of sorafenib monother-
`apy have demonstrated steady-state concentrations consistently
`over the IC50 of 5 mM for the recommended dosage of sorafenib
`(Clark et al, 2005). Therefore, further studies are required to
`investigate this possibility. It is plausible that proliferation of
`melanoma cells could be driven by an alternative signalling
`pathway, after
`signalling through RAF/MEK/ERK has been
`blocked. A further possibility is that a feedback mechanism could
`negate the effect of sorafenib in these melanoma patients. This
`contention is supported by the recent observation that sorafenib
`administration is associated with increased RAF-1 phosphoryla-
`tion at Ser338 in human melanoma and other tumour cell types
`(Adnane et al, 2005). However,
`it remains to be determined
`whether such a feedback mechanism impairs clinical response to
`sorafenib monotherapy in melanomas with V600E BRAF muta-
`tions.
`In conclusion, sorafenib is well tolerated but has little or no
`antitumour activity in advanced melanoma patients as a single
`agent at
`the dose evaluated (400 mg b.i.d.). Ongoing trials
`in advanced melanoma are evaluating sorafenib combination
`therapies.
`
`Clark JW, Eder JP, Ryan D, Lee R, Lenz H-J (2005) The safety and
`pharmacokinetics
`of
`the multi-targeted
`tyrosine
`kinase
`inhi-
`bitor (including Raf kinase and VEGF kinase), BAY 43-9006,
`in
`patients with advanced, refractory solid tumors. Clin Cancer Res 11:
`5472 – 5480
`Danson S, Lorigan P (2005) Improving outcomes in advanced malignant
`melanoma: update on systemic therapy. Drugs 65: 733 – 743
`Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J,
`Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R,
`Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A,
`Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H,
`Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K,
`Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G,
`Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber
`BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster
`R, Stratton MR, Futreal PA (2002) Mutations of the BRAF gene in human
`cancer. Nature 417: 949 – 954
`Eisen T, Ahmad T, Marais R, Gibbens I, James M, Affolter A, Chao D,
`Bergamini L, Schwartz B, Gore ME (2005) Phase I trial of sorafenib (BAY
`43-9006) combined with dacarbazine (DTIC) in patients with metastatic
`melanoma. Eur J Cancer Suppl 3(2): 349
`Escudier B, Szczylik C, Eisen T, Stadler WM, Schwartz B, Shan M, Bukowski
`RM (2005) Randomized phase III trial of the Raf kinase and VEGFR
`inhibitor sorafenib (BAY 43-9006) in patients with advanced renal cell
`carcinoma (RCC). J Clin Oncol 23(16_suppl): LBA4510 1-6-2005
`Flaherty KT, Brose M, Schuchter L, Tuveson D, Lee R, Schwartz B, Lathia C,
`Weber B, O’Dwyer P (2004) Phase I/II trial of BAY 43-9006, carboplatin
`(C) and paclitaxel (P) demonstrates preliminary antitumor activity in the
`
`cells of the tumour vasculature to inhibit angiogenesis (Wilhelm
`et al, 2004). Sorafenib also induces apoptosis in several human
`cancer cell lines (Rahmani et al, 2005; Yu et al, 2005), including
`melanoma cells (Panka et al, 2006b). Sorafenib downregulates Mcl-
`1 protein levels in a time- and dose-dependent manner to induce
`apoptosis in renal, colon and breast tumour lines (Rahmani et al,
`2005; Yu et al, 2005). This effect involves enhanced proteasomal
`degradation of Mcl-1, which could be the consequence of RAF-1
`inhibition. Finally, sorafenib induces caspase-independent apop-
`tosis in A2058 and SKMEL5 melanoma cell lines (Panka et al,
`2006a). However, the multiple molecular targets of sorafenib, and
`its dual effects on the tumour cell and the vascular endothelium,
`make it difficult to determine the mechanism of effect of this
`multikinase inhibitor in different tumour types, particularly in the
`absence of validated biomarkers.
`In the present analysis, sorafenib monotherapy was well
`tolerated. Seven patients had PFS lasting between 16 and 34
`weeks, although it is not clear whether or not this was an effect of
`sorafenib. Restabilisation of disease was also observed in one
`patient who was crossed over to sorafenib after progressing on
`placebo during the randomised 12-week treatment phase. This
`patient received sorafenib for a total of 73 weeks. There was no
`apparent relationship between the presence of an oncogenic V600E
`BRAF mutation within exon 15 and the modest antitumour activity
`of sorafenib monotherapy. This latter observation is consistent
`with the lack of a clear relationship reported in another sorafenib
`trial (Eisen et al, 2005). Larger randomised clinical trials are
`ongoing and will more definitively explore the relationship
`between response and BRAF mutational status.
`Despite showing little activity as a monotherapy in this RDT
`cohort, recently published observations suggest that sorafenib may
`enhance the antitumour activity of carboplatin and paclitaxel
`against melanoma (Flaherty et al, 2004). In an expanded Phase I
`study predominantly in melanoma patients,
`this combination
`induced one complete response (o1%), 27 PRs (26%) and 61 SDs
`(58%) in patients with advanced melanoma (Flaherty et al, 2004).
`It is possible that
`these findings may be due to sorafenib’s
`
`REFERENCES
`
`Adnane L, Trail PA, Wilhelm S (2005) Sorafenib (BAY 43-9006) antagonizes
`Raf function not only by inhibiting Raf kinase activity but also by
`sequestering Raf protein into non-functional complexes. Presented at
`AACR-NCI-EORTC, November 2005, Philadelphia, PA
`Alexandrescu DT, Dutcher JP, Wiernik PH (2005) Metastatic melanoma: is
`biochemotherapy the future? Med Oncol 22: 101 – 111
`Awada A, Hendlisz A, Gil T, Bartholomeus S, Mano M, de Valeriola D,
`Strumberg D, Brendel E, Haase CG, Schwartz B, Piccart M (2005) Phase I
`safety and pharmacokinetics of BAY 43-9006 administered for 21 days
`on/7 days off in patients with advanced, refractory solid tumours. Br J
`Cancer 92: 1855 – 1861
`Balch CM, Soong SJ, Gershenwald JE, Thompso