American Journal of Pathology, Vol. 157, No. 4, October 2000
`Copyright © American Society for Investigative Pathology
`
`Short Communication
`
`Mutation and Expression Analyses Reveal
`Differential Subcellular Compartmentalization of
`PTEN in Endocrine Pancreatic Tumors Compared to
`Normal Islet Cells
`
`Aurel Perren,*† Paul Komminoth,*
`Parvin Saremaslani,* Claudia Matter,*
`Seraina Feurer,* Jacqueline A. Lees,‡
`Philipp U. Heitz,* and Charis Eng†§
`From the Department of Pathology,* University of Zu¨ rich, Zurich,
`Switzerland; the Clinical Cancer Genetics and Human Cancer
`Genetics Programs,† Comprehensive Cancer Center, and Division
`of Human Genetics, Department of Internal Medicine, The Ohio
`State University, Columbus, Ohio; the Department of Cancer
`Biology,‡ Massachusetts Institute of Technology, Cambridge,
`Massachusetts; and the Cancer Research Campaign Human
`Cancer Genetics Research Group,§ University of Cambridge,
`Cambridge, United Kingdom
`
`The pathogenesis of sporadic endocrine pancreatic
`tumors (EPTs) is still primarily unknown. Compara-
`tive genomic hybridization studies revealed loss of
`10q in a significant number (nine of 31) of EPTs. The
`tumor suppressor gene PTEN lies on 10q23, and so, is
`a candidate to play some role in EPT pathogenesis.
`Germline PTEN mutations are found in Cowden and
`Bannayan-Riley-Ruvalcaba syndromes, whereas so-
`matic mutations and deletions are found in a variety
`of sporadic cancers. The mutation and expression
`status of PTEN in EPTs has not yet been examined.
`Mutation analysis of the entire coding region of PTEN
`including splice sites was performed in 33 tumors,
`revealing one tumor with somatic L182F (exon 6).
`Loss of heterozygosity of the 10q23 region was de-
`tected in eight of 15 informative malignant (53%) and
`in none of seven benign EPTs. PTEN expression was
`assessed in 24 available EPTs by immunohistochem-
`istry using a monoclonal anti-PTEN antibody. Of these
`24, 23 tumors showed strong immunoreactivity for
`PTEN. Only the EPTs with PTEN mutation lacked PTEN
`protein expression. Although normal islet cells always
`exhibited predominantly nuclear PTEN immunostain-
`ing, 19 of 23 EPTs had a predominantly cytoplasmic
`PTEN expression pattern. Exocrine pancreatic tissue
`
`was PTEN-negative throughout. PTEN mutation is a rare
`event in malignant EPTs and PTEN protein is ex-
`pressed in most (23 of 24) EPTs. Thus, intragenic
`mutation or another means of physical loss of PTEN
`is rarely involved in the pathogenesis of EPTs. In-
`stead, either an impaired transport system of PTEN to
`the nucleus or some other means of differential com-
`partmentalization could account for impaired PTEN
`function. Loss of heterozygosity of the 10q23 region is
`a frequent event in malignant EPTs and might suggest
`several hypotheses: a different tumor suppressor
`gene in the vicinity of PTEN might be principally
`involved in EPT formation; alternatively, 10q loss,
`including PTEN, seems to be associated with malig-
`nant transformation, but the first step toward neopla-
`sia might involve altered subcellular localization of
`(Am J Pathol 2000, 157:1097–1103)
`PTEN.
`
`The etiology and pathogenesis of sporadic endocrine
`pancreatic tumors (EPTs) remain primarily unknown. Mu-
`tations of the MEN1 gene responsible for the autosomal
`dominantly inherited MEN 1 syndrome are found only in
`;15 to 30% of sporadic EPTs.1,2 Oncogenes (such as
`FOS, C-MYC, M-MYC, and SIS) or tumor suppressor
`genes (such as TP53 or RB1) which are frequently acti-
`vated or mutated in other human tumors seem not to be
`involved in the neoplastic transformation of EPTs.3,4
`Comparative genomic hybridization analysis of EPTs re-
`vealed losses of Y, 6q, 11q, 3p, 3q, 11p, 6p, 10q, and Xq.
`The frequency of 10q loss was 25% of all EPTs with a
`
`Supported in part by the American Cancer Society RPG98 –211-01CCE
`(to C. E.) and the National Cancer Institute (P30 CA16058 to The Ohio
`State University Comprehensive Cancer Center).
`Accepted for publication July 1, 2000.
`Address reprint requests to Charis Eng, Human Cancer Genetics Pro-
`gram, The Ohio State University Comprehensive Cancer Center, 420 W.
`12th Avenue, Room 690C Medical Research Facility, Columbus, OH
`43210. E-mail: eng-1@medctr.osu.edu.
`
`1097
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 001
`
`

`
`Perren et al
`1098
`AJP October 2000, Vol. 157, No. 4
`
`frequency as high as seven of nine of nonfunctioning
`EPTs.5 The tumor suppressor gene PTEN maps to
`10q23.3.6 – 8
`Germline PTEN mutations are responsible for the au-
`tosomal dominantly inherited Cowden and Bannayan-
`Riley Ruvalcaba syndromes as well as a Proteus-like
`syndrome.9 –13 Relatively high frequencies of somatic in-
`tragenic PTEN mutations and deletions are found in non-
`cultured endometrial carcinomas14 –17 and malignant gli-
`omas.18,19 Despite the frequency of structural PTEN
`mutations in noncultured endometrial carcinomas, we
`have shown that epigenetic silencing of PTEN not only
`plays a prominent role in its pathogenesis, but also in the
`pathogenesis of the earliest endometrial precancers.17
`Further, we have demonstrated that loss of PTEN protein
`expression in the absence of mutations occurs in breast
`carcinogenesis.20 To examine whether 10q loss in EPTs
`points to involvement of the tumor suppressor PTEN, we
`analyzed a series of 33 EPTs for intragenic mutations and
`deletions of PTEN and PTEN protein expression.
`
`MaterialsandMethods
`
`Tumor Samples
`
`Thirty-three EPTs were drawn from the files of the Depart-
`ment of Pathology, University Hospital Zu¨rich, Switzer-
`land. The tumors were classified according to the most
`recent World Health Organization classification.21 They
`comprised 19 insulinomas (six malignant, 12 benign, one
`MEN 1-associated, and one of uncertain clinical behav-
`ior), two malignant glucagonomas, three malignant VIP-
`omas, three malignant gastrinomas (one MEN 1-associ-
`ated), and six nonfunctioning (five malignant, one
`benign) EPTs. Except for one gastrinoma and one insu-
`linoma as noted, all of the EPTs were sporadic and not
`associated with MEN 1 or von Hippel-Lindau (VHL) syn-
`drome. Comparative genomic hybridization analysis of
`these tumors has been performed previously.5
`Fresh-frozen tissue was snap-frozen in liquid nitrogen
`and stored at 280°C. Paraffin samples were fixed by
`immersion in 4% buffered formalin and embedded in
`paraffin according to standard procedures.
`
`DNA Extraction
`
`Genomic DNA from fresh-frozen tissue was isolated us-
`ing the D-5000 Purgene DNA Isolation Kit (Gentra Sys-
`tems, Minneapolis, MN) according to the manufacturer’s
`instructions. DNA from these fresh-frozen tissues was
`used for mutation analysis. Where no nonneoplastic
`fresh-frozen tissue was available, DNA was extracted
`from paraffin blocks for loss of heterozygosity (LOH) analy-
`sis. For this purpose, 10-mm sections of formalin-fixed par-
`affin-embedded tumor specimens were microdissected
`and DNA extraction was performed as described.2,22
`
`LOH Analysis
`
`To assess LOH of the PTEN region at 10q23, we used the
`centromeric marker D10S579,
`the intragenic markers
`AFMa086wg9 and D10S2491, and the telomeric marker
`D10S1735. Polymerase chain reaction (PCR) was per-
`formed according to standard procedures and the prod-
`ucts were electrophoresed through polyacrylamide gels
`containing 7 mol/L urea followed by silver staining as
`previously described.2 LOH was defined as a complete
`absence or reduced signal of one of the constitutional
`alleles in the tumor tissue compared to the corresponding
`nonneoplastic tissue.
`
`Mutation Analysis
`
`PCR amplification was performed in a 50-ml mixture 13
`PCR buffer (Perkin Elmer Europe, Rotkreuz, Switzerland)
`containing 400 ng of template DNA, 200 mmol/L of dNTP
`(Roche Diagnostics, Rotkreuz, Switzerland), 1 mmol/L
`each of intronic-based primers flanking each exon (Table
`1), and 0.2 ml ofTaq polymerase (AmpliTaq Gold; Perkin
`Elmer Europe). A touchdown PCR was performed with
`denaturation at 95°C for 1 minute, annealing at 55 to 48°C
`(with 1°C decrements per cycle) for 1 minute, and exten-
`sion at 72°C for 1 minute followed by additional 30 cycles
`at 48° annealing temperature and a final extension at 72°
`for 10 minutes. Varying concentrations of MgCl2 and
`dimethylsulfoxide were used (Table 1).
`For the single-strand conformation polymorphism anal-
`ysis, 10 ml of denatured PCR products in stop buffer (95%
`formamide, 20 mmol/L ethylenediaminetetraacetic acid,
`0.05% xylene cyanol, 0.05% bromophenol blue) were
`loaded onto nondenaturing polyacrylamide gels. Electro-
`phoresis was performed at 40 W for 5 hours at room
`temperature. After electrophoresis, the DNA was visual-
`ized by silver staining as described.23
`
`Immunohistochemistry
`
`The monoclonal anti-human PTEN antibody 6H2.1 raised
`against the last 100 C-terminal amino acids was used in
`immunohistochemical analysis.20,24 Specificity and
`all
`characterization of 6H2.1 has previously been demon-
`strated by Western blot, immunohistochemistry on cell
`lines with known PTEN expression status as well as the
`ability of cold peptide to compete off immunostaining on
`paraffin-embedded sections.17,20,25
`Twenty-four cases where paraffin blocks were avail-
`able were subjected to immunohistochemistry (Table 2).
`Four-mm sections were cut and mounted on Superfrost
`Plus slides (Fischer Scientific, Pittsburgh, PA). Immuno-
`staining was performed as described.20 A semiquantita-
`tive score was given to the nuclear and cytoplasmic
`staining of tumor and normal tissue: 2, 1, and 11.
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 002
`
`

`
`1099
`PTEN Expression in Endocrine Pancreatic Tumors
`AJP October 2000, Vol. 157, No. 4
`
`Table 1. Primers and PCR Conditions
`
`Primer
`
`PTEN 1
`
`PTEN 2
`PTEN 3
`
`PTEN 4
`
`PTEN 5a
`
`PTEN 5b
`
`PTEN 6
`
`PTEN 7
`
`PTEN 8b
`
`PTEN 8b
`
`PTEN 9
`
`Position
`AH007803
`
`2229–2379
`
`10242–10412
`18382–18528
`
`24099–24248
`
`26126–26283
`
`26232–26417
`
`32123–32324
`
`37865–38093
`
`40894–41137
`
`41084–41200
`
`45308–45549
`
`Sequence
`
`Length
`(bp)
`
`TCTGCCATCTCTCTCTCCT
`AGAGGAGCAGCCGCAGAAATG
`TTTCAGATATTTCTTTCCTTA
`TAATTTCAAATGTTAGCTCAT
`AAGATATTTGCAAGCATACAA
`GTTTGTTAGTATTAGTACTTT
`ACAACATAGTACAGTACATTC
`TATTCTGAGGTTATCTTTTA
`CTTTCCAGCTTTACAGTGAA
`GCTAAGTGAAGATGACAATCA
`AGGAAAAACATCAAAAAATAA
`TTGGCTTCTCTTTTTTTTCTG
`ACATGGAAGGATGAGAATTTC
`CCTGTGAAATAATACTGGTATG
`CTCCCAATGAAAGTAAAGTACA
`TTAAATATGTCATTTCATTTCTTTTTC
`CTTTGTCTTTATTTGCTTTGT
`GTGCAGATAATGACAAGGAATA
`ACACATCACATACATACAAGTC
`TTCATTTTAAATTTTCTTTCT
`TGGTGTTTTATCCCTCTTGAT
`
`151
`
`171
`147
`
`150
`
`158
`
`186
`
`202
`
`229
`
`244
`
`117
`
`242
`
`Condition
`
`2.0 mmol/L MgCl2, 10% DMSO
`
`2.5 mmol/L MgCl2
`2.5 mmol/L MgCl2
`
`2.5 mmol/L MgCl2
`
`2.5 mmol/L MgCl2, 10% DMSO
`
`2.5 mmol/L MgCl2, 10% DMSO
`
`2.5 mmol/L MgCl2
`
`—
`
`—
`
`—
`
`2 mmol/L MgCl2
`
`DMSO, dimethylsulfoxide.
`
`Table 2. Clinical Data and Results
`
`Clinical data
`No.
`Sex
`Age
`
`Tumor type
`
`CGH†
`
`ICH‡
`
`D10S579
`
`LOH - Analysis§
`AFM86
`D10S2491
`
`D10S1735
`
`Mutation analysis
`
`1
`2
`3
`4
`5
`6
`7
`8
`9
`10
`11
`12
`13
`14
`15
`16
`17
`18
`19
`20
`21
`22
`23
`24
`25
`26
`27
`28
`29
`30
`31
`32
`33
`
`M
`M
`M
`F
`F
`?
`M
`F
`F
`F
`F
`M
`F
`M
`M
`M
`M
`M
`F
`F
`F
`M
`F
`M
`F
`M
`F
`F
`F
`M
`M
`M
`M
`
`93
`36
`58
`81
`26
`?
`62
`22
`59
`35
`42
`53
`52
`61
`62
`52
`58
`56
`64
`56
`48
`44
`33
`51
`34
`53
`46
`59
`36
`57
`63
`20
`41
`
`ins
`ins
`ins
`ins
`ins
`Ins
`ins
`ins
`ins
`ins
`ins
`ins
`non f
`ins, mal
`ins, mal
`ins, mal
`ins, mal
`ins, mal
`ins, mal
`gluc, mal
`gluc, mal
`non f, mal
`non f, mal
`non f, mal
`non f, mal
`non f, mal
`vip, mal
`vip, mal
`vip, mal
`vip, mal
`gast, mal
`ins, MEN1
`gast, MEN1
`
`*
`ni
`
`ni
`ni
`*
`
`ni
`ni
`
`*
`ni
`*
`ni
`*
`ni
`ni
`f
`*
`ni
`ni
`
`*
`f
`
`*
`M
`
`C
`
`C
`N/C
`C
`C
`
`C/M
`N/C
`C
`C/M
`C
`N/C
`C
`C
`C
`neg
`N/C
`C/M
`C
`C
`C
`C
`C/M
`C
`
`C
`
`10q-
`
`10q rg-
`
`10q-
`10q-
`10q rg-
`10q rg-
`10q-
`10q-
`10q-
`10q-
`
`ni
`ni
`
`ni
`ni
`ni
`
`ni
`ni
`
`ni
`M
`ni
`M
`ni
`ni
`f
`ni
`ni
`*
`ni
`
`ni
`f
`
`ni
`M
`
`M
`M
`
`M
`M
`*
`
`M
`M
`
`ni
`M
`ni
`f
`f
`ni
`f
`f
`f
`ni
`ni
`
`*
`f
`
`ni
`M
`
`ni
`ni
`
`ni
`M
`ni
`
`ni
`ni
`
`f
`M
`ni
`ni
`ni
`*
`ni
`ni
`f
`f
`ni
`
`ni
`f
`
`ni
`ni
`
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`Exon 6 L182F
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`neg
`
`ins, insulinoma; gluc, glucogonoma; vip, VIPoma; gast, gastrinoma; non F, non-functioning; mal, malignant
`† 10q rg-, partial 10q deletion by CGH (5)
`‡ C, cytoplasmic expression; N, nuclear expression; M, cytoplasmic membrane staining; neg, no expression; blanks, no paraffin blocks available
`§ f LOH; h ROH; ni, not informative; *, no PCR amplification; blanks, no germline tissue available.
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 003
`
`

`
`Perren et al
`1100
`AJP October 2000, Vol. 157, No. 4
`
`Figure 1. LOH analysis of EPT-nontumor DNA from cases 28 and 31 using microsatellite markers within and flanking PTEN. f, LOH; M, ROH; ni, not informative.
`
`Results
`
`LOH Analysis
`
`For 22 tumor samples, paired normal tissue was available
`and therefore, could be used for LOH analysis (Table 2).
`Sixteen of these EPTs were informative for at least one of
`four markers within and flanking PTEN. Among these 16,
`eight tumors exhibited loss of one allele at the 10q23
`region, and eight retained heterozygosity for all of the
`informative markers (Table 2 and Figure 1). Case 17
`showed retention of heterozygosity at AFMa086wg9 and
`LOH of the adjacent marker D10S2491 indicating partial
`loss of one PTEN allele. LOH at 10q23 seemed to be
`associated with malignant phenotype: whereas eight of
`10 (80%) informative malignant and none of six informa-
`tive benign EPTs showed evidence of loss of one allele,
`two of 10 (20%) malignant and six of six (100%) informa-
`
`tive-benign EPTs retained both 10q23 alleles (P , 0.05,
`Fischer’s exact test).
`Of the eight informative tumors with LOH, five have
`been shown by comparative genomic hybridization to
`have large 10q losses.
`
`Mutation Analysis
`
`Single-strand conformation polymorphism analysis re-
`vealed an additional band in exon 6 in one tumor (case
`23, Figure 2). Sequencing of exon 6 confirmed that the
`aberrant single-strand conformation polymorphism band
`reflected a sequence variant (546A.T) which was absent
`in the corresponding germline DNA. This 546 A.T tran-
`sition represents a somatic missense mutation resulting
`in an amino acid change at codon 182, L182F. This tumor
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 004
`
`

`
`1101
`PTEN Expression in Endocrine Pancreatic Tumors
`AJP October 2000, Vol. 157, No. 4
`
`immunostaining (Figure 2). This malignant, nonfunction-
`ing EPT had a somatic PTEN mutation (as described
`above) and loss of the remaining allele (Table 2, case
`23). In the remaining 23 EPTs, all showed strong PTEN
`expression, graded 1 to 11. Nineteen of these 23 (83%)
`tumors exhibited a predominantly cytoplasmic PTEN
`staining (Figure 3b and Table 2); the staining pattern of
`four of these 19 tumors was suggestive of PTEN localiza-
`tion at the cell membrane (Figure 3c). In addition, four of
`these 19 tumors were found to have cytoplasmic staining
`as well as strong nuclear PTEN staining (case 10, 15, 19,
`and 24; Figure 3d). We found no association between
`staining pattern and clinical behavior in this relatively
`small series.
`
`Discussion
`
`We have detected a novel somatic mutation in exon 6 of
`PTEN. The nucleotide change 546A.T results in an
`amino acid change at codon 182, L182F. As expected for
`a tumor suppressor gene, this mutation was accompa-
`nied by LOH of the wild-type allele. The structural two-hits
`in a malignant nonfunctioning EPT (case 23) resulted in
`loss of immunoreactivity to the monoclonal anti-PTEN
`antibody recognizing a C-terminal epitope. One would
`have expected that loss of one allele with a missense mu-
`tation in the remaining allele would result in a full-length
`protein, with subsequent decreased PTEN immunoreactiv-
`ity. Our observations of complete loss of immunoreactivity
`may be explained by decreased transcription or translation,
`increased degradation of the mutant protein, or confor-
`mational change in the C-terminal 100 amino acids in-
`duced by the missense mutation. Most likely, the mis-
`sense mutation results in decreased transcript stability. In
`sum, somatic intragenic PTEN mutations do occur in a
`small percentage, one of 33 (3%), of EPTs. The patient
`with this widely invasive nonfunctioning EPT underwent a
`Whipple procedure and remains disease-free 11 years
`after the surgery.
`Although somatic intragenic PTEN mutation is infre-
`quent in EPT, we have shown that half of all informative
`EPTs harbor deletions of the 10q23 region, specifically
`involving PTEN. On the one hand, LOH analysis con-
`firmed the large losses of 10q detected by comparative
`genomic hybridization analysis; on the other, we de-
`tected three additional malignant EPTs (cases 14, 18,
`and 28) with loss of the 10q23 region solely detected by
`PCR-based analysis of microsatellite markers. Interest-
`ingly, all of the samples that had LOH were malignant
`EPTs. This finding suggests that allelic loss of this region
`could be associated with malignant behavior. Apart from
`the single malignant EPT with two structural hits and no
`PTEN expression, all of the EPTs with LOH remained
`PTEN-immunopositive. These observations are in con-
`trast to those made in breast cancer, thyroid neoplasia,
`and endometrial cancer, where loss of one PTEN allele is
`strongly associated with decreased PTEN protein level or
`complete loss of PTEN expression (XP Zhou and C Eng,
`unpublished observations).17,20,25 In these tumors, there-
`fore, either one or both inactivational events can be epi-
`
`Figure 2. Case 23 EPT with somatic PTEN mutation, 546A.T and loss of
`wild-type allele, resulting in negative PTEN immunoreactivity. Top: Negative
`PTEN immunostaining; note internal positive control of strongly staining
`neo-vessels. Single-strand conformation polymorphism and sequencing of
`exon 6 reveals a somatic mutation (546A.T). Note that the chromatogram
`shows the mutation as an apparent heterozygote although by both immu-
`nohistochemical and LOH analysis, this tumor has loss one allele and is
`mutant in the remaining. This pseudo-heterozygote appearance is because of
`some admixture with DNA from contaminating normal cells.
`
`also showed LOH at 10q23, at least involving the 39 part
`of PTEN (Table 1).
`
`Immunohistochemistry
`
`Twenty-four paraffin-embedded tumor samples were
`available for immunohistochemical analysis. Fifteen of
`these had adjacent normal pancreatic tissue containing
`the islets of Langerhans, the normal counterpart of EPTs.
`All of the islets showed strong immunoreactivity (11) to
`the antibody 6H2.1. With the exception of one case which
`was fixed in Bouin’s solution (case 33), all normal islets
`exhibited homogenous predominant nuclear PTEN ex-
`pression (Figure 3a). As internal positive controls, we
`used predominantly nuclear staining of endothelial cells
`(especially within neo-vessels) and cytoplasmic staining
`of Schwann cells in peripheral nerves (graded 11 stain-
`ing). Exocrine pancreatic acini were PTEN immunostain-
`negative throughout and were used as internal negative
`controls.
`Among 24 EPTs that were subjected to immunohisto-
`chemistry, one (4%) was completely negative for PTEN
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 005
`
`

`
`Perren et al
`1102
`AJP October 2000, Vol. 157, No. 4
`
`Figure 3. Immunohistochemistry with anti-PTEN antibody. Original magnification, 3100. a: Normal islet (case 11). b: Cytoplasmic staining of tumor cells (case
`11). c: Cytoplasmic staining of tumor cells with membrane pattern (case 25). d: Nuclear and cytoplasmic staining (case 24).
`
`genetic. In EPTs, however, hemizygous loss of 10q and
`PTEN do not seem to be associated with decreased
`expression, an observation that may generate several
`hypotheses. It may be argued that PTEN is not the pri-
`mary target of 10q23 deletion and that other tumor sup-
`pressor genes in the region are the major targets. Fine
`deletion mapping of the 10q22–24 region in thyroid adeno-
`mas and carcinomas, for example, pointed to two distinct
`critical intervals of LOH in this region.26 An alternative pos-
`tulate might be supported by our immunohistochemical
`data. Although PTEN protein is localized mainly in the
`nucleus in nonneoplastic islets, it is localized predomi-
`nantly in the cytoplasm and cell membrane in 19 of 24
`(80%) EPTs. Differential subcellular localization of PTEN
`has been observed previously in a large series ranging
`from normal thyroid to anaplastic thyroid carcinoma.25 In
`the thyroid series, exclusion of nuclear staining was as-
`sociated with increasing malignant potential. The per-
`centage of tumors with decreased nuclear PTEN was
`lowest in breast cancer (Perren and Eng, unpublished
`observations), up to 50% in thyroid carcinomas25 and is
`highest in EPTs (19 of 24, 80%). In contrast to the thyroid
`tumors, however, this shifting of PTEN from nucleus to
`cytoplasm is not associated with increasing malignant
`behavior in EPTs but instead, is associated with the neo-
`plastic state in general.
`The observation of nuclear staining remains a puzzle
`but clearly has been observed by others.27,28 PTEN lacks
`a clear nuclear localization signal, and so, if it does traffic
`
`in and out of the nucleus, a shuttle must be involved. Our
`observations in vivo together with circumstantial prelimi-
`nary evidence demonstrating positive PTEN signal by
`Western blot analysis of nuclear fractions28 (L-P Weng
`and C Eng, unpublished observations) argue that this
`phenomenon is not an artifact. Although PTENs major
`substrate PtdIns(3,4,5)P3 as well as its antagonist phos-
`phatidyl
`inositol 3-kinase (PI3-K) normally interact with
`PTEN in the cytoplasm, more specifically, at the cytoplas-
`mic membrane, the phospholipids and PI3-K have been
`found in the nucleus as well although their role in the
`nucleus is still unknown.29 –31 Whether PTENs nuclear
`localization is significant for its interaction with the phos-
`pholipids or whether it best controls proper cell cycling in
`that location are still speculative. Therefore, based on our
`series of observations20,25 (this report; LP Weng and C
`Eng, unpublished observations), and independent data
`from other groups,27,28 we hypothesize that inappropriate
`qualitative or quantitative subcellular compartmentaliza-
`tion of PTEN could be a frequent initiating event in EPTs,
`which results in neoplasia, whereas physical loss of 10q
`leads to progression to malignancy.
`
`References
`
`1. Zhuang Z, Vortmeyer AO, Pack S, Huang S, Pham TA, Wang C, Park
`WS, Agarwal SK, Debelenko LV, Kester M, Guru SC, Manickam P,
`Olufemi SE, Yu F, Heppner C, Crabtree JS, Skarulis MC, Venzon DJ,
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 006
`
`

`
`Emmert-Buck MR, Spiegel AM, Chandrasekharappa SC, Collins FS,
`Burns AL, Marx SJ, Lubensky IA: Somatic mutations of the MEN1
`tumor suppressor gene in sporadic gastrinomas and insulinomas.
`Cancer Res 1997, 57:4682– 4686
`2. Gortz B, Roth J, Krahenmann A, de Krijger RR, Muletta-Feurer S,
`Rutimann K, Saremaslani P, Speel EJ, Heitz PU, Komminoth P: Mu-
`tations and allelic deletions of the MEN1 gene are associated with a
`subset of sporadic endocrine pancreatic and neuroendocrine tumors
`and not restricted to foregut neoplasms. Am J Pathol 1999, 154:429 –
`436
`3. Lohmann DR, Funk A, Niedermeyer HP, Haupel S, Hofler H: Identifi-
`cation of p53 gene mutations in gastrointestinal and pancreatic car-
`cinoids by nonradioisotopic SSCA. Virchows Arch B Cell Pathol 1993,
`64:293–296
`4. Hofler H, Ruhri C, Putz B, Wirnsberger G, Hauser H: Oncogene
`expression in endocrine pancreatic tumors. Virchows Arch B Cell
`Pathol 1988, 55:355–361
`5. Speel EJ, Richter J, Moch H, Egenter C, Saremaslani P, Rutimann K,
`Zhao J, Barghorn A, Roth J, Heitz PU, Komminoth P: Genetic differ-
`ences in endocrine pancreatic tumor subtypes detected by compar-
`ative genomic hybridization. Am J Pathol 1999, 155:1787–1794
`6. Nelen MR, Padberg GW, Peeters EAJ, Lin AY, van den Helm B, Frants
`RR, Coulon V, Goldstein AM, van Reen MMM, Easton DF, Eeles RA,
`Hodgson S, Mulvihill JJ, Murday VA, Tucker MA, Mariman ECM,
`Starink TM, Ponder BAJ, Ropers HH, Kremer H, Longy M, Eng C:
`Localization of the gene for Cowden disease to 10q22–23. Nat Genet
`1996, 13:114 –116
`7. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang S, Puc J, Miliaresis
`C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittman M,
`Tycko B, Hibshoosh H, Wigler MH, Parsons R: PTEN, a putative
`protein tyrosine phosphatase gene mutated in human brain, breast
`and prostate cancer. Science 1997, 275:1943–1947
`8. Steck PA, Pershouse MA, Jasser SA, Yung WKA, Lin H, Ligon AH,
`Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swed-
`lund B, Teng DHF, Tavtigian SV: Identification of a candidate tumour
`suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in
`multiple advanced cancers. Nat Genet 1997, 15:356 –362
`9. Liaw D, Marsh DJ, Li J, Dahia PLM, Wang SI, Zheng Z, Bose S, Call
`KM, Tsou HC, Peacocke M, Eng C, Parsons R: Germline mutations of
`the PTEN gene in Cowden disease, an inherited breast and thyroid
`cancer syndrome. Nat Genet 1997, 16:64 – 67
`10. Marsh DJ, Dahia PLM, Zheng Z, Liaw D, Parsons R, Gorlin RJ, Eng C:
`Germline mutations in PTEN are present in Bannayan-Zonana syn-
`drome. Nat Genet 1997, 16:333–334
`11. Marsh DJ, Coulon V, Lunetta KL, Rocca-Serra P, Dahia PLM, Zheng
`Z, Liaw D, Caron S, Duboue´ B, Lin AY, Richardson A-L, Bonnetblanc
`J-M, Bressieux J-M, Cabarrot-Moreau A, Chompret A, Demange L,
`Eeles RA, Yahanda AM, Fearon ER, Fricker J-P, Gorlin RJ, Hodgson
`SV, Huson S, Lacombe D, LePrat F, Odent S, Toulouse C, Olopade
`OI, Sobol H, Tishler S, Woods CG, Robinson BG, Weber HC, Parsons
`R, Peacocke M, Longy M, Eng C: Mutation spectrum and genotype-
`phenotype analyses in Cowden disease and Bannayan-Zonana syn-
`drome, two hamartoma syndromes with germline PTEN mutation.
`Hum Mol Genet 1998, 7:507–515
`12. Marsh DJ, Kum JB, Lunetta KL, Bennett MJ, Gorlin RJ, Ahmed SF,
`Bodurtha J, Crowe C, Curtis MA, Dazouki M, Dunn T, Feit H, Geraghty
`MT, Graham JM, Hodgson SV, Hunter A, Korf BR, Manchester D,
`Miesfeldt S, Murday VA, Nathanson KA, Parisi M, Pober B, Romano C,
`Tolmie JL, Trembath R, Winter RM, Zackai EH, Zori RT, Weng LP,
`Dahia PLM, Eng C: PTEN mutation spectrum and genotype-pheno-
`type correlations in Bannayan-Riley-Ruvalcaba syndrome suggest a
`single entity with Cowden syndrome. Hum Mol Genet 1999, 8:1461–
`1472
`13. Zhou XP, Marsh DJ, Hampel H, Mulliken JB, Gimm O, Eng C: Germ-
`line and germline mosaic mutations associated with a Proteus-like
`syndrome of hemihypertrophy, lower limb asymmetry, arterio-venous
`malformations and lipomatosis. Hum Mol Genet 2000, 9:765–768
`14. Kong D, Suzuki A, Zou T-T, Sakurada A, Kemp LW, Wakatsuki S,
`Yokohama T, Yamakawa H, Furukawa T, Sato M, Ohuchi N, Sato S,
`
`1103
`PTEN Expression in Endocrine Pancreatic Tumors
`AJP October 2000, Vol. 157, No. 4
`
`Yin J, Want S, Abraham JM, Souza RF, Smolinksi KN, Meltzer SJ, Horii
`A: PTEN1 is frequently mutated in primary endometrial carcinomas.
`Nat Genet 1997, 17:143–144
`15. Levine RL, Cargile CB, Blazes MS, van Rees B, Kurman RJ, Ellenson
`LH: PTEN mutations and microsatellite instability in complex atypical
`hyperplasia, a precursor lesion to uterine endometrioid carcinoma.
`Cancer Res 1998, 58:3254 –3258
`16. Tashiro H, Blazes MS, Wu R, Cho KR, Bose S, Wang SI, Li J, Parsons
`R, Ellenson LH: Mutations in PTEN are frequent in endometrial carci-
`noma but rare in other common gynecological malignancies. Cancer
`Res 1997, 57:3935–3940
`17. Mutter GL, Lin M-C, Fitzgerald JT, Kum JB, Baak JPA, Lees JA, Weng
`L-P, Eng C: Altered PTEN expression as a diagnostic marker for the
`earliest endometrial precancers. J Natl Cancer Inst 2000, 92:924 –931
`18. Du¨rr E-M, Rollbrocker B, Hayashi Y, Peters N, Meyer-Puttlitz B, Louis
`DN, Schramm J, Wiestler OD, Parsons R, Eng C, von Deimling A:
`PTEN mutations in gliomas and glioneuronal tumours. Oncogene
`1998, 16:2259 –2264
`19. Bostro¨m J, Ludwig-Cobbers JMJ, Wolter M, Tabatabai G, Weber RG,
`Lichter P, Collins VP, Reifenberger G: Mutation of the PTEN (MMAC1)
`tumour suppressor gene in a subset of glioblastomas but not in
`meningiomas with loss of chromosome arm 10q. Cancer Res 1998,
`58:29 –33
`20. Perren A, Weng LP, Boag AH, Ziebold U, Thakore K, Dahia PLM,
`Komminoth P, Less JA, Mulligan LM, Mutter GL, Eng C: Immunohis-
`tochemical evidence of loss of PTEN expression in primary ductal
`adenocarcinomas of the breast. Am J Pathol 1999, 155:1253–1260
`21. Solcia E, Klo¨ppel G, Sobin LH, (Eds): Histological Typing of Endo-
`crine Tumours. Heidelberg, Springer, 2000
`22. Perren A, Roth J, Muletta-Feurer S, Saramaslani P, Speel EJ, Heitz
`PU, Komminoth P: Clonal analysis of sporadic pancreatic endocrine
`tumours. J Pathol 1998, 186:363–371
`23. Komminoth P, Kunz E, Hiort O, Scho¨der S, Matias-Guiu X, Chris-
`tiansen G, Roth J, Heitz PU: Detection of RET proto-oncogene point
`mutations in paraffin-embedded pheochromocytoma specimens by
`nonradioactive single-strand conformation polymorphism analysis
`and direct sequencing. Am J Pathol 1994, 145:922–929
`24. Weng L-P, Smith WM, Dahia PLM, Ziebold U, Gil E, Lees JA, Eng C:
`PTEN suppresses breast cancer cell growth by phosphatase func-
`tion-dependent G1 arrest followed by apoptosis. Cancer Res 1999,
`59:5808 –5814
`25. Gimm O, Perren A, Weng LP, Marsh DJ, Yeh JJ, Ziebold U, Gil E,
`Hinze R, Delbridge L, Lees JA, Robinson BG, Komminoth P, Dralle H,
`Eng C: Differential nuclear and cytoplasmic expression of PTEN in
`normal thyroid tissue, and benign and malignant epithelial thyroid
`tumors. Am J Pathol 2000, 156:1693–1700
`26. Yeh JJ, Marsh DJ, Zedenius J, Dwight T, Delbridge L, Robinson BG,
`Eng C: Fine structure deletion analysis of 10q22–24 demonstrates
`novel regions of loss and suggests that sporadic follicular thyroid
`adenomas and follicular thyroid carcinomas develop along distinct
`parallel neoplastic pathways. Gene Chromsom Cancer 1999, 26:322–
`328
`27. Tamura M, Gu J, Matsumoto K, Aota S-I, Parsons R, Yamada KM:
`Inhibition of cell migration, spreading and focal adhesions by tumor
`suppressor PTEN. Science 1998, 280:1614 –1617
`28. Lachyankar MB, Sultana N, Schonhoff CM, Mitra P, Poluha W, Lam-
`bert S, Quesenberry PJ, Litofsky NS, Recht LD, Nabi R, Miller SJ,
`Ohta S, Neel BG, Ross AH: A role for nuclear PTEN in neuronal
`differentiation. J Neurosci 2000, 20:1404 –1413
`29. D’Santos CS, Clarke JH, Divecha N: Phospholipid signalling in the
`nucleus. Biochim Biophys Acta 1998, 1436:201–232
`30. Metjian A, Roll RL, Ma AD, Abrams CS: Agonists cause nuclear
`translocation of phosphotidylinositol 3-kinase gamma. A Gbeta-gam-
`ma-dependent pathway that requires p110-gamma amino terminus.
`J Biol Chem 1999, 274:27943–27947
`31. Marchisio M, Bertagnolo V, Colamussi ML, Capitani S, Neri LM:
`Phosphotidylinositol 3-kinase in HL-60 nuclei is bound to the nuclear
`matrix and increases during granulocyte differentiation. Biochem Bio-
`phys Res Commun 1998, 253:346 –351
`
`Roxane Labs., Inc.
`Exhibit 1020
`Page 007