Ln
`
`Nmrasrf. 9, 448-459 (1997).
`Xu, (2., Alldus, G., Hider, N. 8: Wilkinson, D. G. Expression of truncated Sek—l receptor tyrosine
`kinase disrupts the segmental restriction ofgene expression in the Xenopus and zebrafish hindbrain.
`Dave-Inpmcii! 12], 4005~40l6 (1995).
`6. Xu, Q. 8: Wilkinson, D. G. Eph-related receptors and their ligands: mediators ofeoiitact dependent
`cell interactions. J. Mol. Med. 75, 576-536 (1997).
`7. Flanagan, I. G. &\"anderhaeghen, P. The ephrins and Eph receptors in neural rlevelopmennirimm. Rev.
`Neumlilal. 21, 309-345 (1998).
`8. O‘I.ear_v, D. D. M. &Will:inson, D. G. Eph receptors and ephrins in neural development. Curr. Opiii.
`Nmtrnlliul. 9, 65v—'/'3 (1999).
`9. Holland, 5. l. el :11. Bidirectional signalling through the Eph-family receptor Nuk and its transiriem-
`brnne ligands. Nrtture 383, 722—725 (1996).
`lo. Bruckner, K., Pasquale, E. E. St Klein, R. Tyrosine phosphorylation oftransmembrane ligands for Eph
`receptors. Science 275, 1640-1643 (1997).
`11. Gale, N. W. er al. Eph receptors and ligands comprise two major specificity subclasses, and are
`reciprocally compartmentaliscd during embryogenesis. Nemun 17, 9-19 (1996).
`12. Eph Nomcnclaturc Committee. Unified nomenclature for Eph family receptors and their ligands, the
`ephrins. Cell 90. 403404 (1997).
`13. Ellis. C. ct iii. A juXt.1membrane autophosphorylation site in the Eph family receptor tyrosine kinase.
`Sek. mediates high ztflinity interaction with p59tyn. Oiirngeite 12. 1727-1735 (1996).
`14. Theil. T. at al. Segmental expression ofthe EpliA4 (Sel<~ I) gene is under direct transcriptional control
`of Krox-Z0. Dvvalllpinlrni 125, 443-452 < I993).
`I5. Woo, K. 8: Fraser, 5. E. Order and coherence in the fate map of the zebralisli nervous system.
`Del/t'lupinenI I21, 259S~2609 (1995).
`I6. Townes, R L. 3; Holfreter, }. Directed movements and seleaive adhesion of embryonic amphibian
`cells. J. Exp. Z001. 128, 53~l?.0 U955).
`i7. Steinberg. M. 5. Does differential adhesion govern self-assembly processes in histogcnesis? Equilie
`brium processes and the emergence ofa hierarchy among populations ofembryonic cells]. Fxp. Zmil
`173, 395-434 (1970).
`I8. Nose, A., Nagafuchi, A. 8t Takeiclii, M. Expressed rccoiiibitiant cadlrerins mediate cell sorting in
`model systems. Cell 54, 993400] (1988).
`I9. Friedlander, D. K. Mega, R. M., Cunningham. ll. A. 8: Edelman, G. M. Cell sorting—out is modulated
`by both the specificity and amount ofdifferent cell adhesion molecules. P7'Ut'. Narbirnd. Sri. USA 86,
`7043-7047 (1959).
`20. Godt, D. 8: Tepass, U. Drnsupliilu oocytc localization is mediated by differential cziclhcrimbascd
`adhesion. Nature 395, 337-391 U998).
`21. Conzalez—Reyes, A. 8; St lohnston, D. The Drosophila A—P axis is polarised by the cadherimmediated
`positioning of the ooc)'te.DeveIo_1>mmzt 125, 363S—3644 (I998).
`22. Meima, L. et ul. Al..—1—inducecl growth cone collapse ofrat conical neurons is correlated with REK7
`expression and rearrangement ofthe actin cytoskeleton. Em: [.
`l\'t2IH’t7S(‘l. 9, 177-188 (1997).
`23. Zisch, A. H. 21 ii/. Tyrosine phosphorylation ofLl family adhesion molecules: implication ofthe Eph
`kinase Ceki. ]. N(:iirnsi'i. Res. 47, 655-665 U997).
`24. Lumsclen, A. 8: Keynes, R. Segmental patterns ofneuronal development in the chickhinclbrain.NrtIuri:
`337, 424-423 (1989).
`25. Heyman, l., Kent. A. Br Lumsden. A. Cellular morphology and extracellular space at rhombomere
`boundaries in the chick embryo hmdbrain. Dev. Dymimirs 198, 241-253 (1993).
`26. Xu, Q., Hider, N., Patient, 11. 8: Wilson, S. W. Spatially regulated expression ofthrec receptor tyrosine
`kinasc genes during gastrulation in the zebrnfislt.Deire1u]nneiiI 120, 287-299 (1994).
`27. lrving, C.. Nieto, M. A.. DasGupta, R., Chnrnay, . & Wilkinson, D. G. Progressive spatial restriction of
`Sek—l and KroxA20 gene expression during hindbrain segmentation. Dev. Biol. 173, 26~38 (I996).
`Acknowledgements. We thank N. Gale and G. Yancopoulos for ephiin clones. M. Henkemeyer for the
`EphB2 clone and 5. Fraser, 1. P. Vincent, R. Krumlauf and P. Trainer for discussions. This work was
`supported by the MRC, an ec Biotechnology grant and an EMBO Fellowship to <3..vi.
`Correspondence and requests for materials should be addressed to D.G.W. (e—rnai|: d-\vilkin@ninir.rnrc.
`ac.uk)
`
`
`
`The tumour suppressor
`protein VHL targets
`hypoxia-inducible factors for
`oxygen-dependent proteolysis
`Patrick H. Maxwe|l*, Michael S. Wiesener*,
`Gin—Wen Chang*, Steven C. Cliffordr, Emma C. Vauxfr,
`Matthew E. Cockmani, Charles C. Wykoffi.
`Christopher W. Pughi, Eamonn R. Maheri
`& Peter J. Ratcliffe‘i
`* Wcllcumc Trust Crmtrcfar Human Genetics, Wind1mllR0ad, OJq‘0rd OX3 7BN, UK
`T Section ofMediml and Molecular Genetics, Department ofPaediatricszmd Child
`Health, University ofBirmingham, Binningham B15 2TT, UK
`it Institute ofMolecular Medicine, John Radcliffe Hospital, Oxford OX3 9DS, UK
`
`(HIF—l) has a key role in cellular
`1
`
`responses to hypoxia, including the regulation of genes involved
`in energy metabolism, angiogenesis and apoptosis”. The on
`subunits of HIF are rapidly degraded by the proteasome under
`normal conditions, but are stabilized by hypoxias. Cobaltous ions
`or iron chelators mimic hypoxia, indicating that the stimuli may
`
`s to ature
`
`
`
`
`interact through effects on a ferroprotein oxygen sensor”. Here
`we demonstrate a critical role for the von Hippel—Lindau (VHL)
`tumour suppressor gene product pVHL in HIF—1 regulation. In
`VHL-defective cells, HIF at-subunits are constitutively stabilized
`and HIF-1 is activated. Rc—e.xpression of pVHL restored oxygen-
`dependent instability. pVHL and HIF oz-subunits co-immunopre—
`cipitate, and pVHL is present in the hypoxic HIF-1 DNA-binding
`complex. In cells exposed to iron chelation or cobaltous ions,
`HIF-1 is dissociated from pVHL. These findings indicate that the
`interaction between HIF-1 and pVHL is iron dependent, and
`that it is necessary for the oxygen—dependent degradation of
`HIF or-subunits. Thus, constitutive HIF-1 activation may underlie
`the angiogenic phenotype of VHL-associated tumours. The
`pVHL/HIF-1 interaction provides a new focus for understanding
`cellular oxygen sensing.
`Enhanced glucose metabolism and angiogenesis are classical
`features of cancer”,
`involving upregulation of genes that are
`normally induced by hypoxia. In addition to stimulation by the
`hypoxic microenvironmentm, genetic alterations contribute to these
`effects“. A striking example is Von Hippel~Lindau (VHL) disease, a
`hereditary human Cancer syndrome predisposing sufferers to highly
`angiogenic turnouts". Constitutive upregulation of hypoxically
`inducible messenger RNAs encoding vascular endothelial growth
`factor (VEGF) and glucose transporter 1 (GLUT-1) in these tumour
`cells is correctable by re—expression of pVHL. A p0st~transcripti0nal
`mechanism has been proposed”'”. We studied the involvement of
`pVHL in oxygen-regulated gene expression using ribonucleasc
`protection analysis of two VHL~dcficient renal carcinoma lines,
`RCC4 and 786-0. Eleven genes encoding products involved in
`glucose transport, glycolysis, high-energy phosphate metabolism
`and angiogenesis were examined; nine are induced by hypoxia in
`other mammalian cells and two (LDH—B and PFK—M) are repressed
`by hypoxia. None of these responses was seen in the VHL-defective
`cell lines. Responses to hypoxia were restored by stable transfection
`of a wild—type VHL gene, with effects ranging from a rather modest
`action of hypoxia (PFK—L and LDH~B) to substantial regulation
`(Fig. 1 shows results for RCC4 cells; similar effects were seen in 786-
`0 cells, data not shown). These results indicate that the previously
`described upregulation of hypoxia—inducible mRNAs in VI-IL~
`defective cells”’” extends to a broad range of oxygcn—regulated
`genes and involves a constitutive ‘hypoxia pattern’ for both posi-
`tively and negatively regulated genes.
`As a number of these genes (VEGF, GLUT—1, AK-3, Al.D—A,
`PGK—l, PFK-L and LDH»A) contain hypoxjenresponse elements
`(HRES) which bind HlF—l and/or show altered expression in cells
`lacking HIF-l
`(refs 2, 14 and references therein), this survey of
`expression in VHL—defective cells prompted us to look for effects of
`pVHL on HlF—1 and HRE function. RCC4 cells were co-transfected
`with reporter plasmids which did or did not contain I-IRES from the
`mouse phosphoglycerate—l<.inase—l or erythropoietin (Epo) enhan-
`cers, and either the Vl-IL—expression plasmid pcDNA3—VHL or an
`empty vector. pVHL suppressed HRE activity in normoxic cells and
`restored induction by hypoxia (Fig. 2a). Similar
`results were
`obtained by sequential stable transfection of RCC4 cells with an
`HRB reporter followed by pcDNA3-VHL (data not shown). HIF-l
`itselfwas examined by electrophoretic mobility shift assay (EMSA),
`which showed a constitutive HlF—l DNA-binding species in VHL-
`deficient RCC4 cells, with restoration of the normal hypoxia-
`inducible pattern in RCC4 cells stably transfected with pcDNA3—
`VHL (RCC4/VHL) (Fig. 2b). In other cells, HlF—1 activation by
`hypoxia involves a large increase in HlF—1ot abundance from low
`basal levels in norntoxiam. Western blotting of whole-cell extracts
`showed that RCC4 cells express constitutively high levels of both
`HlF—1oL and a related molecule, HlF—2ot (also termed EPAS-1, HRF,
`HLF and MOP2) which is normally regulated in a similar way”
`(Fig. 2c). Constitutively high levels of these proteins were found in
`eight other VHL—defective cell
`lines,
`in contrast
`to the renal
`
`NATURE|VOL 399|2o MAY l999lwww.nature.com
`
`% © 1959 Macmllla“ Magazmes Ltd
`
`271
`
`Roxane Labs., Inc.
`Exhibit 1016
`
`Page 001
`
`Roxane Labs., Inc.
`Exhibit 1016
`Page 001
`
`

`
`
`
`
`
`
`
`TC3F«li "
`
`ALD~A ‘
`PGiK~1
`
`Figure 1 Effect of pVHL on oxygerwegulated gene expression rnRNA analysis of
`RCC4 cells and stable transfectant expressing pvl-lL (RCC4/VHL). N, normoxla;
`H, hypoxia (1% 02. 16h). VEGF. vascular endothelial growth factor; GLUT-‘l,
`glucose transporter 1; AK-3, adenylate kinase 3; TGF-Bi, transforming growth
`factor—Bl; Al_D—A. aldolase A; PGK—1, phospnoglyceratekinase 1; PFK, phos-
`
`phofructokinase: LDl-l, lactate dehydrogenase. U6 small nuclear (sn) RNA was
`used as an internal control. Also illustrated are two genes not influenced by VHL
`status or hypoxia; nuclear respiratory factor l [NRF~1 ) and B~aCTll'l. Amount of RNA
`analysed is detai ed in Table S1 ofthe Supplementary Information.
`
`
`
`..
`+
`NHNH NH
`
`5
`
`'§'
`
`~
`
`4'
`
`~
`
`'3'
`
`-
`
`+
`
` NH NHNH NHNH NHNH
`.. Ldmd
`:> :2 § 8 §
`
`HRE
`Promote:
`
`s
`
`_
`
`33140
`
`......¥?’Gl<«1
`
`“
`
`TK
`
`d
`
`J
`3 2'3 @-
`g g ca‘ E 3;
`
`Figure 2 Effect of pVl-lL on l-llF—1 and HRE activity. a, Representative transient
`transfections of RCC4 cells with VHL expression vector (+) or empty vector, and
`Iuciferase reporter genes containing no HRE, or HREs from the PGK-7 or
`erythropoietin (Epo) genes linked to SV4O or TK promoters. N, normoxia; H,
`hypoxia (0.1% Oz, 24h—results were simllarwith 1% 02). b, EMSA using the Epo
`HRE. N, norrnoxia: H, hypoxia (1% 02, 4h). In HeLa and RCC4/VHL, l-llF-1 is a
`doublet (S, slower and F, taster mobility). RCC4 cells contain only faster mobility
`H|Fv1. with equivalent levels in normoxia and hypoxia. Constitutive binding
`
`lrnmunoblots of whole cell extracts for HlF u-
`species are indicated (C). c,
`subunits. Upper panels; RCC4 and RCC4/VHL cells (+VHL). Lower panel: 7860
`cells stably transtected with vector alone, a full length VHL gene (+Vl-lL), or a
`truncated VHL gene (I-115; +Tr). HIF-in was not detected in 785-O cells. d,
`lmrnunoblot of UMRC2. UMRC3 and KTCL14O (renal carcinoma lines with VHL
`mutations“). Cakrl (renal carcinoma line expressing wild—type pVl-lLl and the
`hepatoma line Hep3E.
`
`carcinoma line Caki—1 (which expresses pVHL normally”) and a
`wide range of previously reported cell lines (Fig. 2d and Supple~
`mentary Information S2). Certain VHL—defeCtive cells (for example,
`786-0, KTCL140) expressed HlF—2ol at a high constitutive level but
`did not express detectable HIF-lot (Fig. 2c, d and Supplementary
`Information 52). Examination of stable transfectants of RCC4 and
`786-0 cells demonstrated that expression of the wild—type, but not
`truncated, VHL gene restored regulation of HIF oz-subunits by
`oxygen without affecting the levels of mRNA encoding either
`subunit (data not shown).
`To investigate the role of pVHL in HIF—1 regulation we tested for
`interactions between HIF 0z—subunits and pVHL using a combina-
`tion of hypoxia and/or proteasomal blockade to induce HIF oi-
`subunits. Anti—pVHL immunoprecipitates of extracts from protea—
`
`somally blocked RCC4/VHL cells, but not RCC4 cells, contained
`both HIF-lot and HIF-201 (Fig. 33). Similar results were obtained
`with hypoxia in the absence of proteasomal blockade. In the inverse
`reactions, immunoprecipitating antibodies to HlF~2ol or HIF—1o1
`c0—precipitated pVHL, although a smaller proportion of the total
`was captured (Fig. 3b). Anti~pVI-IL imrnunoprecipitations also
`demonstrated the interaction in HeLa cells, which express pVHL
`normally (Fig. 3c). We next tested whether pVHL is incorporated in
`the HIF—1 DNA—binding complex. Addition of antibodies raised
`against pVHL (but not control antibodies) to nuclear extract from
`RCC4/VHL cells and HeLa cells produced a change in mobility,
`which was not observed with VHL-defective RCC4 cells (Fig. 3d).
`HIF—1 migrated as two species. Only the slower—mobi.lity HIF—l
`species was shifted by anti—pVHL, whereas both species were shifted
`
`272
`
`% @1999 Macmillan Magazines Ltd
`
`NATURElVOL 399l20 MAY I999lwww.nature.com
`
`Roxane Labs., Inc.
`Exhibit 1016
`
`Page 002
`
`Roxane Labs., Inc.
`Exhibit 1016
`Page 002
`
`

`
`
`
`
`
`-§-++IControl
`
`-++-6‘
`
`nofiysale
`
`Figure 3 Association of pVl-lLwith l-llF~1. a, lmmunoblots for HlF 4x'SUbLll'lliS (2ut,
`1:») of IG32 (Vl-lLlp) and control immunoprecipitates (using VG-7l::e) of RCC4/VHL
`(VHL+) and RCC4 (VHL—) cells exposed (4h) to norrnoxia or hypoxia (1% O2; H+)
`with or without proteasomal inhibition (Pl+). Aliquots of selected input lysates
`were also immunoblotted. b.
`lmmunopreelpitatiorl of RCC4/VHL (VHl_+) and
`RCC4 (VHL—) extracts with polyclonal antibodies to HIF msubunits or normal
`rabbit irnmunoglobulin (control ip) followed by lmmunoblotting for pVHL (V). A
`cross—reacting species arose from the HIF-2o antibody (asterisk). c, immuno-
`precipitation of HeLa extracts with IG32 (VHL.,,) or pAb4l9 (control) followed by
`
`lmmunoblottlng for l-llF 0rSUbUlWltS. d, Anti-pVHL supershifts. IG32 (VHL Ab+) or
`VG-7be (Control Ab+) was added to binding reactions of nuclear extracts from
`normoxic or hypoxic (1 % Oz, 4 h; H+) cells. Anti-pVHLsupershlfted (SS)the slower
`HIF-1 species (8) in HeLa and hypoxic RCC4/VHL cells. No supershilt was seen
`with RCC4 cells, which lack pVHL. e. Anti—pVHL, anti~HlF—lu and combination
`supershifts in HeLa cells. Anti-pvl-lL(lG32, +VHLAbl supershifted slower mobility
`HIF-l, Anti-HIF-1n (clone 54) supershifted both components (SS). Addition of both
`antibodies ‘super-super-shifted‘ (SSS) slower mobility HIF-7.
`
`by anti—I-IIF— Iol (Fig. 3e). Similar results were obtained in other cell
`lines (Hep3B, Calci-1, MRC5—V2 and 293; data not shown).
`Furthermore, whereas RCC4/VHL, HeLa and other cells contained
`both I-IIF-I
`species, RCC4 extracts contained only the faster-
`mobility species (Figs 3d, Fig. 2b). Thus, VHL—defective cells lack
`the slower—mobility species which is restored by re-expression of
`pVI-IL, and shifted by anti—pVI-IL. This indicates that the DNA-
`binding HIF—l doublet arises from two species—containing or not
`containing pVHL. Combination supershift analysis confirmed that
`the slower—mobility species contained both HIF-l(X and pVHL
`(Fig. 3e).
`.
`’
`HIF—1 activation by hypoxia is mimicked by cobaltous ions and
`iron chelation”. We therefore tested whether the pVI-IL/HIF—1
`interaction was regulated by these stimuli. Proteasomal blockade
`induces an HlF—1 DNA—binding complex in normoxic cells”;
`comparison of this normoxic complex with EMSA of hypoxic
`cells with or without proteasornal i.nhibitors showed a similar
`shift and anti—pVHL supershift
`(Fig. 4a and data not shown).
`Together with immunoprecipitation data, this indicates that the
`interaction with pVHL occurs in both normoxic and hypoxic cells.
`In contrast, EMSA analysis of RCC4/VHL cells treated with cobalt
`and the iron chelator desferrioxamine (DFO) demonstrated only
`the faster mobility HIF-1. This did not supershift with anti—pVHL,
`indicating that the pVHL/HIF—I complex could not form in cells
`exposed to these stimuli. Similar results were obtained in other cell
`types and are consistent with hitherto unexplained mobility differ
`ences between previous analyses of HIF—I from cobalt~ or DFO—
`versus hypoxia—stimulated cells7, indicating that this is a general
`
`effect. Treatment with DFO 4h before hypoxia prevented the
`formation of the pVI-IL/HIF—1 complex (Fig. 4b). Addition of
`iron chelators could not break the pVHL/HIF-1 complex in vitro,
`whereas addition of in vitro—translated wild—type pVHL (but not a
`truncated pVHL) could restore the slower-rnobility species to
`nuclear extracts of proteasomally blocked, normoxic and hypoxic
`RCC4 cells, but not to cells treated with DFO or cobalt (Fig. 4c, and
`Fig. Sla of Supplementary Information). Immunoprecipitation
`studies also indicated that the interaction between HIF—1 and
`pVHL is iron—dependent. V‘\7hereas both HIF— lot and HIF-2ol were
`contained in anti-pVI-IL immunoprecipitates from hypoxic RCC4/
`VHL cells, neither was contained in precipitates from DFO- or
`cobalt—treated cells
`(Fig. 4d). The iron-dependent
`interaction
`between HIF ol—subunits and pVHL may be direct or indirect.
`However, in vitro—translated wild—type pVHL did not bind to an
`in vitrmtranslated HIF—I DNA-binding complex (Fig. Slb in
`Supplementary Information), in contrast to the interaction with
`RCC4 extracts (Fig. 4c), indicating that an additional factor or
`modification of HIF—1 not represented in rabbit reticulocyte lysates
`is necessary for the association.
`Normally, HIF oL—subunits are targeted for rapid degradation in
`normoxic cells by a proteasomal mechanism operating on an
`internal oxygen—dependenbdegradation (ODD) domains. Our
`data suggest that pVHL might be required for this process—a
`possibility which would be consistent with recent data that pVHL
`forms a multiprotein complex (containing Cul—2 and elongins B
`and C) which has homology with ubiquitin—ligase/proteasome—
`targeting complexes in yeast'““. When cells were switched from
`
`NATURElVOL 399l20 MAY l999lwww.nature.com
`
`%©199a Macmillan Magazines Ltd
`
`213
`
`Roxane Labs., Inc.
`Exhibit 1016
`
`Page 003
`
`Roxane Labs., Inc.
`Exhibit 1016
`Page 003
`
`

`
`letters to nature
`
`hypoxia to norrnoxia with addition of cycloheximide, HIF 0(-
`subunits decayed with a half-life of about 5 min in wild—type VHL
`transfectants, compared with ~60 min in the VHL—defective RCC4
`and 786-0 cells, thus confirming a strong effect ofpVHL on stability
`(Fig. 5a). Moreover, functional studies of (3314 chirnaeras contain-
`ing the HIF—l0i: ODD domain demonstrated a striking dependence
`of the isolated ODD domain on pVHL (Fig. 5b).
`These experiments define a function for pVHL in the regulation
`of HIF-1. Given recent demonstrations of the importance of HlF—1
`in tumour angiogenesism, constitutive HIF—1 activation is clearly
`consistent with the angiogenic phenotype of VHL disease. Whether
`it is a sufficient explanation for oncogenesis is less clear. HIF—l
`mediates gene activation not only by hypoxia, but also by growth
`factors such as insulin and insulin-like growth factor-1 (refi 22).
`HlF—l
`targets such as molecules involved in enhanced glucose
`metabolism and angiogenesisS‘9‘” are classically upregulated (by
`different mechanisms) in many forms of cancer, supporting an
`
`important role in tumour progression, although their role in the
`initiation of oncogenesis is less clear. pVHL is probably a multi-
`functional protein which could have other tumour suppressor
`actio1‘is“’2"‘“. One possibility is that other gene products could be
`targeted in a similar manner to HIP oi-subunits; however, compari-
`son of anti-pVHL immunoprecipitates from metabolically labelled
`RCC4/VHL cells with and without proteasornztl inhibitors has so far
`demonstrated only two species: HIF- lot and 1-IlF—2oL (G.—W.C.,
`unpublished observations).
`As both pVHL and HIF—1 are widely expressed, it is likely that the
`physiological role of pVHL in HIF-1 regulation is general. It is not
`yet clear whether pVI-IL has actions on oxygen-regulated gene
`expression other than through HIF-1. Stabilization of hypoxia-
`inducible mRNAs has been reported in VHL-deficient cells”’”. This
`might represent an independent action of pVHL. However, regula-
`tion of these RNAs is commonly abolished in I-lIF—l—deficient
`cellsus, so the mRNA stability factors could lie downstream of
`
`+iI.Vi-iL
`N ti G Co H N I% 0 Ch M
`
`+m\»‘l»iL
`+2‘/TT
`Ni-lDPi NHDHNHDH
`
`Figure 4 Effect of cobalious ions and iron chelation on the pVHL/HIF-1
`interaction, a, EMSA and supershift analysis of RCC4/VHL cells exposed (4 h)
`to normoxia (N), hypoxia (H; 1% O3), DFO (lO0p.l\M, cobaltous chloride (Co,
`100 pM) or proteasomal inhibition (Pl). In lanes 6-10, lG32 was added (+uVH l_). b,
`Eli/ISA and supershift analysis of RCC4/VHL cells subjected to hypoxia (H; 1% O;
`for B h) or DFO (100 pM) with hypoxia (D—~ H; cells exposed to DFO for 8 h, 4h
`
`normoxia, then 4 h hypoxia). c, EMSA of RCC4 cells showing only faster mobility
`HlF-1 (lanes 1-4). Addition of/n vitro transcribed/translated pVHL alone (lanes 5-
`8, +l\/Tl‘), ortogether with lG32 (lanes 9-12, +l\fl‘l+uVHL); slower mobility l-llF-1
`forms and supershifts in cells exposed to normoxla, hypoxia and PI, but not DFO.
`d, HlFu immunohlots of anti-pVHL imrnunoprecipitaies of RCC4/VHL cells.
`
`
`
`RIF-'20:»
`
`:3 zomeoac
`
`+VHL
`G 5 30 T5 33
`
`time
`(min)
`
`RG03
`
`paaseiswsss
`VF’t6
`
`Figure 5 Effect of pVHL. on HlFu stability and ODD domain function. a, Western
`analysis of HIF l'I:'SUbUnil stability in cells lacking VHL (RCC4, 786-0) and stable
`transfectants expressing pVHL (4-VHL). Cells were incubated in hypoxia (4h),
`then moved to normoxia (time 0) with addition of cycloheximide (100 p.i\/ll and
`harvested up to 80 min later. b, Representative functional assay ofthe HlF-Io: ODD
`domain. Hep3B or RCC4 cells were transfected with Gal4 reporter pUAS-tl<-Luc,
`and either pGalVP16 (upper panel) ericodingthe Gal4 DNA-binding domain fused
`to theVPl6 activation domain, or pGalci344-698VP‘i6 (lower panel) which includes
`
`HIF-la amino acids 344-698 (containing the entire ODD domain“). RCC4 cells
`were co~transfected with poDNA3 (—), pcDNA3—VHL (VHL) or pcDNA3-VHL.103FS
`(TrVHL). Aftertransfection, cells were divided for 24h incubation in normoxia (N)
`or hypoxia (H; 0.1% Oz). Correctedluciferase counts are shown, normalizedto the
`normoxlc value with pGalVPi6 or pGalVPi6+pcDNA3. The HlF-la domain con-
`fers suppression and hypoxlc regulation in Hep3l3 cells but not RCC4 cells, where
`reexpresslon of pvl-lL restores these properties.
`
`274
`
`% © 1999 Mac
`
`mlnan Magazines Ltd
`
`NATURElVOl. 399120 MAY 1999lwww.nature.com
`
`Roxane Labs., Inc.
`Exhibit 1016
`
`Page 004
`
`Roxane Labs., Inc.
`Exhibit 1016
`Page 004
`
`

`
`H1F—1. Positive and negative effects on H1F—1 activation by iron
`chelators, hydrogen peroxide and redox active agents have indicated
`that the underlying oxygen sensing mechanism may involve oxygen-
`dependent generation of partially reduced oxygen radical species by
`redox active iron centre(s)2’°'7"5'Z°. Such system(s) could act distantly
`on a transduction pathway or might directly modify the ODD
`domains of HlFot through a caged radical system, as proposed for
`iron sensing in the regulation of IRP2 (ref. 27). Cobaltous ions
`activate HIF-1 in inverse relation to iron availability, indicating that
`there may be competition for incorporation into a metal centre”.
`Our data support a model in which VH1./HIF complexes form in
`normoxic cells and target
`1‘l1FO( subunits for destruction.
`In
`hypoxia, degradation is suppressed despite complex formation,
`perhaps because a critical
`targeting modification of the H1Fot
`ODD domain cannot occur without oxygen. Cobaltous ions and
`clesferrioxarnine prevent formation of the VHL complex, providing
`a different mechanism for stabilization of H1F—1 and potentially
`explaining why activation by these stimuli is relatively resistant to
`oxygen and certain other radical-generating processes°‘”"29. The iron
`dependence of complex formation could indicate that an iron-
`containing protein is an essential component of the complex,
`perhaps involved in local generation of an oxygen—sensing signal.
`l:
`Methods
`truncated pVH1.
`Cells and transfections. 786-0 cells expressing pVH1.,
`(amino acids 1-115), or empty vector” were a gift from W. G. Kaelin. RCC4
`cells were a gift from C. H. C. M. Buys. Other RCC lines were provided by M.
`Lcrman. 1-1eLa and I-1ep3B cells were from ECACC. RCC4/V1-1Lwas obtained by
`transfection with pcDNA3—VH1. and G418 selection. Cells were plated in
`medium lacking G418 24h before experiments. which were performed on
`75 cmz dishes approaching confluence. Proteasomal
`inhibition was with
`100 uM calpain inhibitor 1 and 10 p.M N»carbobenzoxy1AL—leucinyl—L-norval~
`inal. Transient transfections were by electroporation. Transfected cells were
`split for parallel normoxic and hypoxic incubation (Napco 7001, Precision
`Scientific). Luciferase reporter gene activity was corrected for transfection
`efficiency by assay of fihgalactosidase expression from the co—transfected
`control plasmid pCMV—BGal.
`RNA analysis. Total RN/Xwas extracted and analysed by ribonuclease protection.
`Riboprobe details are given in Table S1 of the Supplementary Information.
`Plasmid constructions. pCDNA3—V1-1L contained nucleotides 214-855 of
`GenBank accession no. 1.15409 in pcDNA3 (lnvitrogen). pcDNA3~VH1..103FS
`was made using site-directed mutagenesis to delete nucleotides 522-523. HRE
`reporter genes were based on pGL3-basic (Promega) or pPUR (Clontech) and
`contained either a minimal SV40 promoter or a minimal (-40 bp) thymidine
`kinase promoter linked to a firefly luciferase gene (details of1—1REs are in
`Supplementary Information 53). pGalVP16 encoded the Gall} DNA-binding
`domain (amino acids 1-147) linked in—fran1e to the activation domain (amino
`acids 410-490) from herpes simplex virus protein 16; pGald344—698VPl6
`encoded the indicated amino acids ofl-IIF-lo: between those domains. Plasmid
`pUAS—tl<~Luc contained two copies of the Gal4 binding site linked to a
`thymidine—kinase-promoted luciferase reporter gene.
`Cell lysis. immunoblotting and immunoprecipitation. Whole cell extracts
`were prepared by homogenization in denaturing conditions and aliquots
`immunoblottecl for 1-11F oi-subunits with 28b (anti-1-11F-lot) and 190b (anti-
`1-1]F~2u) as described“, or using clone 54 (anti»H1F~1ot, Transduction Labora-
`tories). For immunoprecipitation, lysis was performed in 100 mM NaCl, 0.5%
`lgepal CA630, 20 1nM Tris-HCl (pH 7.6), 5mM MgCl2 and 1mM sodium
`orthovanadate with aprotinin (10 )tgml'l),
`‘Complete’ protease inhibitor
`(Boehringer) and 1.0 mM 4—(2-a1ninoethyl)benzene sulphonyl fluoride for
`30min on ice. After clearance by centrifugation, 120 pg aliquots of lysate
`were incubated for 2h at 4°C with 4 ug affinity-purified anti-1-11F-201 poly-
`clonal antibodies (raised against a bacterially expressed fusion protein includ-
`ing amino acids 535-631) or 4 pg ammonium sulphate precipitated anti—1-11F-
`lor polyclonal antibodies (raised against an immunogen including amino acids
`530-652) in parallel with normal rabbit immunoglobulin (control), or alter—
`riatively with 0.7 pg anti»pVHL antibody (1G32, Pharmingen) or control
`(antibody to SV40 '1' antigen, pAb419, a gift from E. Harlow or antibody to
`
`
`
`lers to nature
`
`
`VEGF, VG~7be, a gift from H. Turley). 10 1.1.1 conjugated agarose beads pre«
`blocked with 20 mg ml" BSA was added and lysates incubated for 2b with
`rocking. Pellets were washed five times, eluted with sample buffer, and divided
`into 2—6 aliquots for immunoblotting.
`Electrophoretic mobility shift and supershift assays. We prepared nuclear
`extracts using a modified Dignani protocol and incubated 5 pg (HeLa) or
`7.5 pg (RCC4) with a 3ZP—labelled 24-bp oligonucleotide probe (sense strand;
`5’—GCCCTACGTGCTGCCTCGCATGGO3’) from the mouse Epo 3’ enhan-
`cer as described”. For supershift assays, 0.5 p.g JGS2, VG-7be (isotype and
`subclass matched control for 1G32) or clone 54 (anti—HlF-lot) was added and
`reactions were incubated for 4h at 4°C before electrophoresis.
`In vim)
`transcription translations of pcDNA3—V1—1l. and pcDNA3-VH1..l03FS were
`done using reticulocyte lysate (Promega); lpl of a 1:5 dilution in PBS was
`added to binding reactions 2h before electrophoresis or addition of antibody.
`Received 11 March; accepted 13 April 1999.
`1. Wang, G. l.., Jiang, B.»H., Rue, E. A. Br Semenza, G. L. Hypoxia—inducible factor 1 is a basic~l1elix-loop-
`heli3t—PASheterodimerregulatedbyc¢llularO1tension.l’mc.Na1lArm1.Sn. USA9Z,55l0—S514(199S).
`2. Bunn, H. 13.8: Poyton, R. 0. Oxygen sensing and molecular adaptation to hypoxia. Plrysml. Rev. 76,
`E39-f185(1996).
`3. Carm=lict,1’. at 141. Role ofl-1lF—lalpha in hypoxia-mediated apoptosis, cell proliferation and tumour
`angioge1\esis.Nm‘me 394, 485-90 (1998).
`4. An,W. G.c!uI.Stabi1iutiouofwild~type p53 by l1YpOXlBrlI1ClLtCll)l£‘ factor 1ot.Nz111m.'392,405—403( 1998).
`S. Huang, L. E., Gu,J., Schau, M. 8: Bunn. H. E Regulation ofhypoxiadnducible factor la is mediated by
`an o.‘cyg:n—dependent domain via the ulaiquitimproteasome pathway. Pror. Nr1Il.»tt'uz1. Sci. USA 95,
`7987-7992 (1993).
`6. Goldberg, M. A., Dunning, S. P. & Bunn, H. 1"-. Regulation ofthe erythropoictin gene: evidence thatthe
`oxygen sensor is a heme protein. S(‘lEl7I‘,il 242.
`l4l'.2—~l4l5 (1988).
`7.
`ivnng, G. L. 84 Serr1enza,G.l.. Desfcrrioxamin: induccscrythrnpnictin gen: expression and hypoxia-
`induciblc factor 1 DNA~binding activity: implications for models ofhypoxia signal transduction.
`Blood 82, 361043615 (1993).
`5. Warburg. O. Tl1eMemlml1.<m nfTxmrmu*.< (Arnold Constable. London. 1930).
`9. Hanahan, D. Sr Folkman, I. Patterns and emerging mechanisms of the angiogenic switch during
`tumorigcncsis. Cell 35, 353—3s4 (1995).
`10. Sliweilti, D.,1tin, A., Soffer, D. S< Keshet, E. Vascular cudothclial growth factor induced by hypoxia may
`mediate hypoxirriiiitiatcd angiog:|1esis.NlzIurc 359, s43—s45 (1992).
`l 1. Kaelin, W. G. 8r Maher, E. R. The VHL tumourstlppressor gene paradigm. Trend: Gcrwr. 14, 4234126
`(1998).
`12. Gnarra,1.R.clul.Pcst»trar1scriptional regulation ofvascular endothelial growth factor mRNA by the
`product ofthe VHL tumor suppressor gene. Prnc. Null Amid. Sci. USA 93, 10589-10594 (1996).
`13. Iliopoulos, 0., Levy, A. P.. liang, C., Kaeliu,W. G. ]r& Goldberg, M.A. Negative regulation ofhypoxiav
`inducible genes by the V011 1-lippel—Li11dau protein. Prat. Nullxlrlrd. Sci. USA 93, 1059540599 (1996).
`14. Dang, C.V. 3( Szmenza, G. 1... Oncogenic alterations ofmelabolisiri. TrL'11dsBi0clzu111. $11.24, 6Bv7Z (1999).
`I5. Huang, L. E., Arany,Z., Livingston. D. M. 8: Bunn. H. F. Activation ofhypoxia—inducible transcription
`factor depends primarily on redox-sensitive stabilization ofits -x subunit. J. Biol. Chem. 271, 32253-
`32259 (1996).
`I6. Wiesener, M. 5. el (11. lnduciion ofendothelial PAS domain protein-1 by hypoxia: characterization and
`comparison with hypoxia~i11ducible l:TiCt0K"l(l.Bll7l)t1' 92. 2260v2268 (I998).
`17. lliopoulos, 0.. Kibel, A., Gray, 5. 8: Kaelin, W. G. ]r Tumour supression by the human vou Hippclv
`Lindau gene product. Nmnre Med. 1, 822—S26 (1995).
`18. Salcecla, S. 8: Cam,
`I. Hypoxia-indiicrble factor lot
`(H1F—loz) protein is rapidly degraded by the
`nbiquitimprnteasome system under normoxic conditions. I. Burl. Clmn. 272, 22642-22647 (1997).
`19. Pause, A. at til. the van Hippel-Lindall tumor-suppressor gene product fnrrns :1 stable complex with
`humanCU1.»2,a memberofthe Cdc53tan1ilyofproteins.l’rac. N(lll.‘l[l1Ll. Sci. USA 94,2156—-2161 (1997).
`20. Lonergan, K. M. er nil. Regulation of hypoxia—inducible mRNAs by the Von Hippel—Llndau tumor
`suppressor protein requires binding to complexes containing elongins B/C and Cul2. Mal. Ct-IiB1oZ.
`in, 732—741(199s).
`2]. Maxwell, P. H. 2! nl. Hypoxia inducible factor-I modulates gene expression in solid tumors and
`influences both angiogcnesis and tumor growth. I’r41c. Nrzrl/1A'r1rl. Sci. USA 94, 8104-8109 (1997).
`22. Zelzer, E. ul ul. lnsulin induccstranscripiion oftargct genes through the hypoxia»iru:lucible factorH1F-
`lu/ARNT. EMBO I. 17, 5033—S094 (1998).
`23. Duan,D.R.ctal.l11hil:ition ofti anscription elongation bythe VHL tumor suppressor protein. Science
`269, l402—l406 (1995).
`24. Ohh. M. er al. The van Hippel—Lindau tumor suppressor protein is required for proper asscmblyofan
`extracellular fibroneetin matrix. Mu]. Cell1,9S9—96S (1995).