DNA
`Volume 1, Number 3, 1982
`Mary Ann Lieben, Inc., Publishers
`
`Direct Expression of Hepatitis B Surface Antigen in Monkey
`Cells from an SV40 Vector
`
`. CHUNG-CHENG LIU, DANIEL YANSURA, and ARTHUR D. LEVINSON
`
`ABSTRACT
`We have developed an SV40-based vector that can be used for the efficient direct expression of foreign genes
`in permissive monkey cells. The vector lacks the coding sequences for the major SV40 late protein (VP-1) and
`possesses unique Eco RI and Bam HI restriction sites so that DNA fragments containing the coding sequences
`of foreign genes bounded by these two restriction sites can be conveniently inserted and directly expressed
`under the control of the VP-1 transcriptional unit. We have inserted into this vector the gene encoding the sur-
`face antigen of hepatitis B virus and observed the synthesis of this protein in monkey cells infected with this
`vector at a level comparable with that of VP-1. Furthermore, we have shown that the HBsAg synthesized is
`assembled into and secreted as a complex structure (22-nm particle) indistinguishable from that formed
`naturally during human infection. These observations enable us to conclude that HBsAg is the only compo-
`nent encoded by HBV that is required for the secretion and assembly of the 22-nm particle and that this pro-
`cess can occur without the involvement of a potential signal peptide suggested by the DNA sequence which
`precedes the coding region of mature HBsAg.
`
`INTRODUCTION
`
`Hepatitis B virus (HBV) is transmitted among hu-
`mans as a chronically debilitating infection which can
`result progressively in high incidence of chronic liver dis-
`ease or liver cancer (Tiollais et al., 1981). The viral surface
`antigen (HBsAg) is a glycosylated protein of 25,400 daltons
`which represents the major envelope antigen of the 42-nm
`particles (Dane particle) of hepatitis B virus and is thought
`to be the major target of neutralizing antibody (Tiollais
`et al., 1981 ). HBsAg is found in the plasma of HBV carriers
`and is most often assembled with lipid and other proteins
`into either 22-nm spherical particles (22-nm particles) or
`filaments (Tiollais et al., 1981). Similar HBsAg particles
`can also be purified from the culture medium of a hepa-
`toma cell line (Marion et al., 1979), indicating that the pro-
`cesses of assembly and secretion can occur in the absence of
`productive viral infection. To characterize further the pro-
`cesses involved in the glycosylation, assembly, and secre-
`tion of HBsAg, we sought
`to construct SV40 vectors
`suitable for the direct expression of genes from hepatitis
`virus in monkey cells.
`SV40 virus has commonly been employed as a transduc-
`ing vector for the expression of foreign genes in permissive
`monkey cells (Gething and Sambrook, 1981; Gruss and
`Khoury, 1981; Hamer et al., 1979; Mulligan et al., 1979).
`The virus is well suited for this purpose, having a small
`genome of double-stranded DNA whose sequence has been
`determined and an extensively characterized life cycle. In
`
`addition, the virus replicates efficiently in permissive cells,
`expressing high levels of viral proteins during the process
`(Acheson, 1980; Griffin, 1980). However,
`in most of the
`studies reported heretofore, the restriction enzyme recogni-
`tion sites that were used to construct the recombinant virus
`removed some of the presumed transcriptional as well as
`translational controls of SV40 (Hamer et al., 1979; Gething
`and Sambrook, 1981; Gruss and Khoury, 1981), perhaps
`accounting for the poor expression of the foreign gene. In
`this report, we describe the construction of an SV40 vector
`that contains unique restriction sites, between which a
`foreign gene can be inserted and expressed in place of the
`structural gene for the major capsid protein of SV40
`(VP-1), preserving all known control elements of SV40.
`When the recombinant SV40-HBV DNA is introduced
`into permissive monkey cells by DNA transfection in the
`presence of helper virus, HBsAg is synthesized at a level
`comparable with that of
`the major SV40 late protein
`(VP-1). Furthermore, HBsAg so produced is assembled in-
`to a complex particle structure indistinguishable from that
`observed in human serum following secretion from the liver
`the insertion of the
`during the infectious cycle. As such,
`HBsAg gene into this vector affords the opportunity to
`study not only factors controlling the expression of a
`foreign gene in mammalian cells, but also provides as well a
`convenient experimental system permitting the study of the
`processes involved in the posttranslational modification,
`
`Department of Molecular Biology, Genentech, Inc., South San Francisco, CA 94080.
`
`213
`
`Merck Ex. 1064, pg 1480
`
`

`
`214
`
`LIU ET AL
`
`assembly, and secretion of complex macromolecular ag-
`gregates in such cells.
`
`MATERIALS AND METHODS
`All restriction enzymes, Escherichia coli DNA polymer-
`(Klenow polymerase I)
`ase large fragment
`(Jacobsen
`et al., 1974), T4 polynucleotide kinase, T4 DNA ligase,
`and X exonuclease were products of either BRL or New
`England Bicjabs and were used according to the prescribed
`reaction conditions. Synthetic oligonucleotides were syn-
`thesized according to the method described previously
`(Crea et al., 1978).
`pHBV-T-1 A is a plasmid in which HBV DNA was cloned
`into the Eco RI site of pBR322 according to published pro-
`cedures (Charnay et al., 1979; Valenzuela et al., 1980).
`Plasmids pHS42 (D. Yansura and D. Kleid, unpublished re-
`sult) is a derivative of pHBV-T-lA and pGH6 (Goeddel et
`al., 1979a). This plasmid contains the structural gene for
`HBsAg from the ATG codon (constructed in a manner
`similar to that described in Fig. 2) through the HBsAg ter-
`mination codon continuing to the Hpa I site in HBV DNA.
`This sequence is inserted into the filled-in Eco RI site of
`pGH6 in two separate steps. Plasmid pNCV is a derivative
`of pBR322 and its structure has been described (Goeddel et
`al., 1980a).
`The hepatoma cell line used as a source of HBsAg is the
`line (designated pLCWIII in the text) de-
`Alexander cell
`scribed previously (Macnab et al., 1976; Marion et al.,
`1979) which was passaged in Dulbecco's modified Eagle
`medium supplemented with 10% fetal calf serum. HBsAg
`was assayed by the Austria II radioimmunoassay kit (Ab-
`bott Laboratories) and quantitated by serial dilution of the
`unknown sample and comparison to the positive control
`(20 ng/ml) supplied in the assay kit.
`The procedures for isolating plasmid DNA, performing
`transforming bacteria, and other related
`electrophoresis,
`methods were as described (Goeddel et al., 1979b; Davis
`et al., 1980). Growth of the CV-1 cell line and the propaga-
`tion of virus stock (tsA28 or recombinants) were performed
`according to published procedures (Mertz and Berg, 1974).
`
`RESULTS
`
`Construction of SV-40 DNA lacking
`the gene encoding VP-1
`Examination of the nucleotide sequence of SV40 encom-
`passing the coding region of VP-1 protein indicated two
`well-placed restriction endonuclease cleavage sites (Fig. !)
`which could be used to generate a vector lacking the VP-1
`coding sequences (Mulligan et al., 1979). The first is a Hind
`III cleavage site at nucleotide position 1493, 6 nucleotides 5'
`to the initiation codon for the VP-1 protein. The second, a
`Bam HI cleavage site at nucleotide 2533, is 50 nucleotides 5'
`to the termination codon of the VP-1 gene. To obtain SV40
`DNA with a deletion between these two sites, we carried
`out experiments outlined in Fig. 1. Briefly, wild-type SV40
`DNA was first cleaved with Bam HI
`to obtain full-
`length, linear DNA molecules and then cleaved with Hind III
`
`under conditions such that eacn DNA molecule was cleaved
`approximately once (there are six Hind III cleavage sites in
`the SV40 DNA). Subsequently, a synthetic decanucleotide,
`dAGCTGAATTC, was ligated to the digested DNA through
`cohesive ends generated by the Hind HI cleavage (-TCGA).
`The mixture was then digested with Eco RI (to generate a
`cohesive end from the Eco RI site present within the added
`decanucleotide) and cloned into pBR322 between the
`Bam HI and Eco RI sites. Plasmids containing SV40 se-
`quences were screened and the one with the stipulated dele-
`tion was isolated and designated as pSVR. Large quantities
`of this SV40 DNA vector were prepared by the propagation
`of pSVR plasmid in E. coli followed by cleavage of the
`plasmid DNA with Eco RI and Bam HI.
`The purpose for the added synthetic decanucleotide is the
`introduction of an unique Eco RI site which is absent in
`this part of SV40 DNA. In addition, the added decanucleo-
`tide restores the original physical distance between the
`Hind III cleavage site and initiation codon for VP-1 protein
`when a DNA fragment containing the coding sequences of
`a foreign gene is constructed as described below and ligated
`to this vector through the Eco RI cleavage site (see below
`and Fig. 3B for more details). This may be an important
`consideration, as the spacing between the ribosome binding
`site and the initiation codon of a gene has been shown to af-
`fect the translational efficiency in prokaryotes profoundly
`(Goeddel et al., 1980b; Guarente et al., 1980).
`
`Construction of recombinant SV40 DNA
`capable of synthesizing HBsAg
`For the direct expression of HBsAg in pSVR, the follow-
`ing modifications of the HBsAg gene are required (i) an
`Eco RI site located immediately 5' to an initiation codon,
`(ii) a Bam HI site located distal to the coding sequences,
`and (iii) a size comparable with the VP-1 gene of SV40 (900
`bp)
`to ensure efficient packaging of
`the recombinant
`SV40-HBV molecule into virus particles. To meet these re-
`quirements, we carried out a series of experiments detailed
`in Fig. 2. An important step in this construction is the crea-
`tion of an Eco RI restriction site immediately 5' to a Met
`codon (ATG) of HBsAg. This was achieved by using a syn-
`(dATGGAGAACATQ as a site-specific
`thetic 12-mer
`this sequence represents codons of the first four
`primer;
`the mature HBsAg (Met-Glu-Asn-Ile)
`amino acids of
`(Valenzuela et al., 1980). The primer was elongated by E.
`coli DNA polymerase large fragment (Klenow fragment),
`resulting in a blund-ended DNA molecule at precisely the
`Met codon of HBsAg (Goeddel et al., 1980b). Following
`ligation into a suitable vector, an Eco RI site is generated
`immediately proximal to an initiation codon.
`To prepare homogeneous recombinant SV40-HBV DNA
`for transfecting monkey cells,
`the Bam HI-£co RI
`frag-
`ment containing SV40 DNA from pSVR was first ligated to
`the Eco Rl-Bam HI
`fragment encoding HBsAg from
`pHS94 (Fig. 2) and the ligated fragment was subsequently
`cloned in the Bam HI site of a pBR322 derivative (derived
`from pHBV-T-lA, Fig. 2) as shown in Fig. 3A. The cloned
`DNA, pSVHBSA, could then be cleaved with Bam HI to
`generate a DNA fragment of 5382 nucleotides which
`represented the SV40 genome with the coding region of
`
`Merck Ex. 1064, pg 1481
`
`

`
`DIRECT EXPRESSION OF HBsAg IN MONKEY CELLS
`
`215
`
`Bam HI cleaved linear full length SV40 DNA
`X_2_J
`
`3
`
`E
`
`L
`
`Partial Hind HI
`
`Eco RI linkers:
`AGCTGAATTC
`CTTAAGTCGA
`f T4 DNA ligase
`
`Eco RI
`
`Mixture of BamHI-EcofXI
`terminated fragments
`
`Bam HI, EcorM
`Isolate 3987 bp
`fragment
`
`a Bam HI
`a Fco RI
`6 Hiná M
`
`T4 DNA ligase
`
`Transform £ coli 294
`
`Screen amp' colonies
`
`FIG. 1. Construction of an SV-40 DNA without the coding region of VP-1 protein. Eight ^g of Bam HI-cleaved, linear,
`full-length SV40 DNA (obtained by either cleaving wild-type SV40 DNA or SV40 DNA cloned at the Bam HI site of
`pBR322) were digested with two units of Hind III (BRL) in a 50-fA reaction mixture. After incubation at 37°C for 30 min,
`the reaction was stopped by the addition of excess EDTA and the reaction mixture was deproteinized by phenol extraction
`followed by ethanol precipitation. The partially digested DNA was then resuspended in 10 ¡A of TE buffer (10 mMTris-Cl
`1 mM EDTA). Synthetic decanucleotide dAGCTGAATTC (0.1 nmole) was phosphorylated with ATP by
`pH 7.5,
`polynucleotide kinase in 10 ¡A reaction mixture containing 10 units of kinase. Incubation was at 37°C for 1 hr. Then an ali-
`quot (3 ¡A) of the kinase reaction mixture was added to a ligation mixture (20 ¡A) containing 66 mM Trs-HCl pH 7.5, 6.6
`mMMgCU, 10 mMDTT, 0.05 mg/ml BSA, 0.5 mMATP, 4 ¡ig of the partially Hind Ill-digested SV40 DNA (above), and
`10 units of T4 DNA ligase. The ligation reaction was incubated at 20° C for approximately 16 hr. The ligated DNA was
`treated with restriction endonuclease Eco RI. The fragments, now containing Eco RI ends were ligated to the
`Bam HI-£co RI fragment of pBR322 (0.5 ¡ig) in a 15-pA ligation mixture and used to transform E. coli 294. Plasmid DNA
`from various transformants was screened by various restriction enzyme digestions for the presence of the SV40 DNA frag-
`ment of interest. The plasmid was designated pSVR. The relative positions of 5' termini of both early and late transcripts
`are indicated by E and L.
`I
`
`VP-1 protein replaced by that of HBsAg and with the ap-
`proximate position of the ATG of VP-1 protein restored
`(Fig. 3B). After in vivo ligation through the Bam HI sites
`the poly(A) site and the transcriptional
`(see below),
`termination site of the late transcripts will be contiguous to
`the coding sequence of HBsAg, and the VP-1 transcrip-
`tional unit is restored.
`
`Propagation of recombinant SV40 virus and
`expression of HBsAg in monkey cells
`To test the efficiency of HBsAg synthesis in such a vector
`system, we introduced Bam HI-cleaved pSVHBSA DNA
`into a monolayer of CV-1 cells by DEAE dextran (McCut-
`chan and Pagano, 1968) and coinfected cells with helper
`
`Merck Ex. 1064, pg 1482
`
`

`
`216
`
`LIU ET AL
`
`Hpa It
`Isolate 1700 bp
`fragment
`
`-ZU HBsAq
`
`Xbal, Barn HI
`Isolote I089bp
`fragment
`
`X exonuclease
`
`Primer dATGGAGAACATC
` Klenow Pol. I + 4dNTP's
`
`Xba I
`Isolate 91 bp fragment
`
`Fragment A
`91 bp
`
`a Bom HI
`A Eco RI
`t Hpa I
` Xba I
`
`Klenow Pol. I
`+ 4dNTP's
`
`Born HI
`
`Isolate large
`frogmen!
`
`I T4 DNA ligase
`i Transform Ecoli 294
`I Screen let' colonies
`
`FIG. 2. Construction of a "HBsAg expression cassette." Plasmid pHS94 was constructed through the ligation of three
`DNA fragments: (i) fragment A, which contains the DNA sequences from the Met codon of matured HBsAg (Valenzuela
`et al., 1980) to the unique Xba I site; (ii) the Xba l-Bam HI fragment from pHS42 which contains the remaining coding
`sequence of HBsAg from the unique Xba I plus some 3' untranslated sequences up to the Hpa I site followed by the 375 bp
`Eco Rl-Bam HI fragment of pBR322 (linked through the Hpa I and blunted Eco RI sites); and riii) the treated vector
`DNA from pNCV. To obtain fragment A, 50 pg of pHBV-T-IA DNA was first digested with Hpa II (80 units) in a 200-fil
`reaction mixture and fractionated by polyacrylamide gel electrophoresis to obtain a 1.7-kb DNA, in which the presumed
`initiation codon for the coding sequences of HBsAg was located closer to the 5' end of the sense strand (about 400 bp). The
`purified Hpa II fragment was then treated with X exonuclease (2 units) in 100-^1 reaction mixture (New England BioLab)
`for 30 min at 37°C. The X exonuclease will degrade DNA from the 5' end of the sense strand from HBsAg-coding se-
`quences and expose the antisense strand for pairing with added primer. The X exonuclease-treated DNA was then depro-
`teinized and resuspended in 50 /il of E. coli DNA polymerase reaction mixture containing 40 mM potassium phosphate
`buffer pH 7.4, 1 mMDTT, 6mMMgCl2, 0.5 mMeach of dNTPs, and 0.2 nmole of dATGGAGAACATC (32P-labeled at
`5' end by T4 polynucleotide kinase). The mixture was first heated at 90°C for 1 min, annealed at 0°C for 30 min, and then
`incubated at 37°C for 3 hr in the presence of 2 units of E. coli DNA polymerase Klenow fragment. The DNA polymerase
`will synthesize DNA primed by the added primer and degrade any unpaired template to create a blunt-ended DNA mole-
`cule. The resultant DNA was then deproteinized, digested with Xba I (45 units) in a 100-/il reaction mixture, and frac-
`tionated by electrophoresis in 5% polyacrylamide gel. The 91-bp DNA (fragment A) was isolated after autoradiographic
`detection. To prepare the third fragment, the vector DNA, pNCV DNA was first cut with 24 units of Pst I enzyme in a
`100-/xl reaction mixture and then treated with 2 units E. coli DNA polymerase large fragment in a 50-/il reaction mixture
`(see above for details) at 8°C for 1 hr. The DNA polymerase treatment removed the 4 unpaired nucleotides created by
`Pst I digestion and left a blunt end after an intact Eco RI restriction site. The DNA was subsequently digested with
`Bam HI to obtain the large fragment which contains part of TetR gene and the pBR322 replication origin. Final ligation
`mixture (30 ¡A) containing 300 ng of treated pNCV DNA, 200 ng of Xba I-Bam HI fragment derived from pHS42, and ap-
`proximately 10 ng of the fragment A was incubated at room temperature for 16 hr and used to transform E. coli 294.
`Plasmid DNA from the TetR transformants was screened with restriction enzyme digestion, and the DNA sequence of one
`of these, pHS94, was confirmed by directly sequencing the relevant region (Maxam and Gilbert, 1977).
`
`Merck Ex. 1064, pg 1483
`
`

`
`DIRECT EXPRESSION OF HBsAg IN MONKEY CELLS
`
`217
`
`Bam HI, EcoRI
`Isolate 4203 bp
`fragment
`
`'
`
`'
`
`Bam HI
`Isolate 4017 bp
`fragment
`
`\
`
`i
`
`Bam HI, EcoRI
`Isolate 1179 bp
`fragment
`
`'
`
`'
`
`HBsAg
`
`T4 DNA ligase
`
`Transform E colt 294
`
`Screen tetr colonies
`
`polyA (L)
`
`\ 1
`
`a Bam HI
`a Eco RI
`
`B.
`
`sv40(-vp-r)
` TCTAAAAGCTTATGAAGATG
`SV40(-HBsAg)
`•TCTAAAAGCTGAATTCATG
`FIG. 3. Construction of recombinant SV40 DNA capable of synthesizing HBsAg. A. The construction of pSVHBSA
`DNA. Contained in this construction are three DNA fragments: (i) SV40 DNA from the Bam HI + Eco RI-digested
`pSVR DNA; (ii) pBR322 DNA from Bam HI-digested pHBV-T-IA DNA (see Fig. 2 for detailed structure); and (iii)
`HBsAg coding sequence containing DNA from Bam HI + Eco RI-digested pHS94. The three fragments were ligated by
`T4 DNA ligase through their respective Bam HI and Eco RI sites in a 15-/d ligation mixture. One class of transformants
`should contain a plasmid which has reconstituted an intact TetR gene of pBR322 and, therefore, can be selected by TetR
`and separated from the large number of Tets transformants resulting from self-ligation of vector DNA. Plasmid from such
`a transformant, pSVHBSA, was obtained and its DNA construction was verified by restriction enzyme digestion. The early
`and late transcriptional starts of SV40 are indicated by E and L respectively. The poly(A) addition site of SV40 late mRNA
`is also indicated. B. DNA sequence surrounding the ATG initiation codon of VP-1 protein (boxed ATG in .top line)
`(Acheson, 1980) is compared with that of HBsAg created in pSVHBSA DNA (boxed ATG in bottom line). The Hind III
`site which was changed to an Eco RI site is underlined. The ATG 6 nucleotide 5' to the boxed ATG is also a possible initia-
`tion codon of VP-1 protein.
`
`virus (tsA28) at 41 °C. The tsA28 virus encodes a tempera-
`ture-sensitive SV40 T antigen (Tegtmeyer and Ozer, 1971)
`and is therefore replication defective at 41 °C. Bam HI-
`cleaved pSVHBSA DNA alone is also incapable of produc-
`ing infectious virus because it lacks the structural gene for
`
`VP-1 protein. As expected, a cytopathic effect was ob-
`served in CV-1 cells which received both tsA28 and the
`pSVHBSA DNA, with complete lysis observed after 2
`weeks of incubation. Neither effect was observed in the
`CV-1 cells receiving only Bam HI-cleaved pSVHBSA DNA
`
`Merck Ex. 1064, pg 1484
`
`

`
`218
`
`LIU ET AL
`
`In the productively infected cultures,
`tsA28 virus.
`or
`HBsAg production can be detected in the culture medium
`as early as 4 days after the introduction of DNA. Quantita-
`tive assays showed that a monolayer of 1 x 106 CV-1 cells
`produced up to 3.8 fig of HBsAg prior to complete cell
`lysis, an equivalent of 9 x 107 molecules/cell. This number
`is comparable with the estimated number of VP-1 protein
`molecules produced during a single infectious cycle of SV40
`(Acheson, 1980).
`the recombinant SV40-HBV
`To determine whether
`genome was packaged and propagated in CV-1 cells, we
`coinfected CV-1 cells with tsA28 virus and an aliquot of the
`lysate derived from the original transfected cells which con-
`tain both recombinant virus and tsA28. Three days after
`the mixed infection, low-molecular-weight DNA was iso-
`lated from the infected cells by the method of Hirt (1967).
`The isolated DNA was either untreated or cleaved with
`Bam HI and then fractionated by agarose gel electro-
`phoresis. The fractionated DNA was then denatured and
`transferred to nitrocellulose paper by the method of
`Southern (Southern, 1975) and probed with "P-labeled
`the recombinant
`pHS94 DNA. As can be seen in Fig. 4,
`DNA molecules containing hepatitis sequences exist mostly
`as closed-circular DNA with a size indistinguishable from
`SV40 DNA (lane A). A majority of the recombinant DNA
`is linearized by treatment with Bam HI, a reflection of pre-
`sumably faithful in vivo ligation of the cohesive ends of the
`linear DNA introduced (lane B) (Lai and Nathans, 1974).
`As expected, the Bam Hl-Eco RI fragment containing the
`coding region of hepatitis B surface antigen (see Fig. 3) can
`also be isolated in an unaltered form (data not shown).
`
`Hepatitis surface antigen encoded by pSVHBSA
`is synthesized and secreted in a particle form
`As mentioned above, hepatitis surface antigen is synthe-
`sized and secreted from the infected liver cell in the form of
`22-nm particles (Marion et al., 1979; Tiollais et al., 1981).
`Sequence analysis of several clones of HBV DNA raised the
`possibility that the mature surface antigen may be cleaved
`from a precursor protein (Valenzuela et al., 1980). Since the
`only HBV sequences present in pSVHBSA DNA were those
`encoding the mature HBsAg gene plus some 3' untranslated
`sequences, we examined whether the proposed precursor-
`peptide plays any functional role in the assembly of the
`22-nm particle and in its eventual secretion from the cell.
`To this end, we characterized the HBsAg synthesized under
`SV40 control by sedimentation velocity and sedimentation
`equilibrium. As shown in Fig. 5, HBsAg synthesized by
`pSVHBSA DNA in monkey cells has a sedimentation rate
`indistinguishable from HBsAg isolated from the medium of
`line previously shown to secrete
`a human hepatoma cell
`HBsAg particles (panel A) (Marion et al., 1979). The
`HBsAg derived from the mixed infection of pSVHBSA and
`tsA28 has a buoyant density of 1.22 g/cm3 (panel B), again
`similar to the authentic surface antigen 22-nm particle
`(Marion et al., 1979). Furthermore, electron microscopic
`examination of a highly purified surface antigen prepara-
`tion derived from pSVHBSA has also revealed a predomi-
`nant particulate structure with a diameter of 220 A (22 nm)
`and morphologically identical to authentic 22-nm particles
`
`FIG. 4. Bam Hi-cleaved recombinant pSVHBSA DNA is
`packaged and replicated in CV-1 cells as SV40 DNA. A
`150-mm plate of CV-1 cells was grown to 90% confluency
`and then infected with a lysate prepared from the original
`transfection experiment which contained both recombinant
`and tsA28 viruses. This was further supplemented with ex-
`cess ts28 virus and incubated in a 41 °C incubator. After 70
`hr, the medium was removed. Intracellular low-molecular-
`weight DNA was isolated according to the methods of Hirt
`(Hirt, 1967) and resuspended in 1 ml of TE buffer. Five ¡A
`of the DNA was treated with Bam HI and then fractionated
`by electrophoresis through 0.8% agarose in TBE Buffer
`(Davis et al., 1980) and compared .with SV40 DNA. The
`DNA was transferred from the gel to a sheet of nitrocell-
`ulose paper and hybridized to a 32P-labeled pHS94 DNA
`(Southern, 1975). The picture represents the autoradio-
`graphie image after hybridization. Lane A is untreated Hirt
`supernatant and lane B is Bam Hi-digested Hirt superna-
`tant DNA. I, II, and HI denote the positions of form I,
`form II, and form III of SV40 DNA. The positions of these
`were determined by ethidium bromide staining before DNA
`was transferred.
`
`i
`(R.M. Stroud, personal communication). Therefore, we
`conclude that mature hepatitis surface antigen protein
`monomer is the only essential structural component encoded
`by hepatitis virus that is required for the assembly of 22-nm
`particle. In our study of the time course of HBsAg expres-
`sion in productively infected CV-1 cells, we can detect
`HBsAg in the culture medium as early as 20 hr after infec-
`tion. Moreover, a majority of the surface antigen was
`detected in the culture medium before any cell lysis was ob-
`
`Merck Ex. 1064, pg 1485
`
`

`
`DIRECT EXPRESSION OF HBsAg IN MONKEY CELLS
`
`served, suggesting that surface antigen is assembled in the
`cell membrane and secreted as a particle in the monkey cells
`without the involvement of a precursor peptide.
`
`DISCUSSION
`the life cycle
`Compared with other pathogenic viruses,
`and genetics of HBV are poorly understood. Only one viral
`(HBsAg) has been rigorously identified
`gene product
`(Tiollais et äl., 1981), although the mechanism of synthesis,
`glycosylation, assembly, and secretion of the antigen has
`eluded detailed characterization. This ignorance is largely a
`consequence of the failure of HBV to replicate in any tissue
`culture system (Tiollais et al., 1981).
`to overcome this restriction of host
`In an attempt
`specificity to permit an analysis of these processes, we have
`constructed an SV40 vector suitable for the direct expres-
`sion of the HBsAg gene in permissive monkey cells. The
`strategy consisted of removing only the DNA sequences en-
`coding VP-1 protein and creating unique restriction sites,
`so that a foreign gene could be conveniently inserted in its
`place. At the same time, all known control elements of the
`virus were preserved to aid the efficient expression of the
`inserted foreign gene. Since VP-1 protein is the major cap-
`
`219
`
`sid protein of SV40 and is synthesized in large amounts dur-
`ing the lytic process,
`it was anticipated that the inserted
`HBsAg gene would be expressed at high levels. As we have
`demonstrated above, HBsAg is synthesized at a level com-
`parable with VP-1.
`DNA sequence analysis of HBV reveals that an open
`reading frame with an initiation codon precedes the se-
`quences that encode the mature form of the surface an-
`tigen, prompting the suggestion that synthesis and secretion
`of HBsAg may involve a leader signal peptide (Valenzuela
`et al., 1980). We have specifically addressed this issue by in-
`corporating only those sequences representing the mature
`form of HBsAg into the SV40 vector. We have demon-
`strated that the surface antigen so produced is assembled
`into particles indistinguishable from authentic HBsAg in
`terms of antigenicity, size (determined by velocity sedi-
`mentation), and density. Since HBsAg particles accumulate
`in the medium of cells infected with recombinant SV40/
`HBV virus with 20 h of infection, well before cell
`lysis
`in addition to assembly into an
`it appears that
`begins,
`authentic particle structure, secretion of the antigen can
`also proceed without the involvement of the putative signal
`peptide.
`Although we have not demonstrated directly that the
`
`I500h
`
`1000 h
`
`500 h
`
`3000
`
`2000
`
`1000
`
`20
`10
`Fraction Number
`Fraction Number
`FIG. 5. HBsAg synthesized in monkey cells are assembled as 22-nm particle. A. Comparison of the sedimentation veloc-
`ity of HBsAg synthesized from CV-1 cells or from a hepatoma cell line. HBsAg derived from CV-1 cells (labeled CV-1) was
`harvested from the medium of the experiment described in Fig. 4, and HBsAg derived from hepatoma cells (labeled pLCW
`III) was harvested from the 4-day-old culture medium of the Alexander cell line (Macnab et al., 1976; Marion et al., 1979).
`HBsAg from both culture media was first precipitated by ammonium sulfate at 45% saturation and resuspended to a final
`concentration of 0.5 /ig/ml in a buffer containing 20 mMTris-Cl pH 7.4, 0.5 mMEDTA, and 0.5 mMNaCl. Two hundred
`¡A of each sample were loaded onto parallel 5-ml sucrose gradients containing 5-20% sucrose in the same buffer. Cen-
`trifugation was carried out at 45,000 rpm in a Beckman SW 50.1 rotor for 80 min at 4°C. Fractions were collected from the
`bottom of the tubes and assayed. Recovery was better than 80%. B and T denote the bottom and top of the gradient.
`B. Buoyant density determination of HBsAg synthesized by CV-1 cells. About 2 ¡ig of HBsAg from pooled, infected
`culture medium were first precipitated by ammonium sulfate at 45% saturation, fractionated over gel-permeation column
`(A 5.0 M, Bio-Rad), and then sedimented through a 5-20% sucrose gradient as described in A. Pooled HBsAg was dialyzed
`against gradient buffer, and solid CsCl was then added to give a 7-ml solution with a final density of 1.2 g/ml. This was
`subsequently centrifuged at 50,000 rpm in a Sorvall T 865.1 rotor for 68 hr at 4°C. Recovery of HBsAg in CsCl gradient
`was about 70%. Peak fractions were pooled, dialyzed, concentrated, and prepared for electron microscopic examination.
`
`Merck Ex. 1064, pg 1486
`
`

`
`220
`
`control elements of the transcription as well as the transla-
`tion processes are those employed by SV40 in expression of
`VP-1 protein, we believe that the HBsAg produced in our
`vector system is a result of direct expression under these
`control processes for the following reasons: first, the pro-
`moter, splice sites, poly(A) site, and transcriptional
`ter-
`mination signals used for the production of the mRNA for
`VP-1 protein are all retained in our recombinant SV40
`the inserted DNA fragment contains no
`genome; second,
`the ATG codon for the
`known control elements except
`translational initiation and the codon for translational ter-
`mination encoded by HBsAg gene; and third, the HBsAg
`synthesized has the identical physical structure and an-
`tigenic determinants expected, indicating that protein syn-
`thesis was initiated and terminated appropriately.
`While SV40 has commonly been used as a vector for the
`expression of foreign genes, the levels of expression of the
`inserted genes, have been unpredictable (Hamer et al.,
`1979; Gething and Sambrook, 1981; Gruss and Khoury,
`1981). Because the vector described here lacks only the
`coding region of VP-1, all known viral sequences involved
`in the control of gene expression are present. We believe
`that this general strategy, in which only the coding region
`of a viral gene is replaced by that of a foreign gene, should
`promote the efficient expression of heterologous genes
`when using viral vectors, and likely accounts for the 10-fold
`higher level of HBsAg expression than previously observed
`using an SV40 vector (Moriarty et al., 1981). To test the ap-
`plicability of expressing other foreign genes in our SV40
`vector, we have also inserted a DNA fragment containing
`the coding sequences of dihydrofolate reducíase (DHFR)
`derived from a plasmid containing the cDNA of DHFR
`(Chang et al. 1978) and have observed similar levels of
`DHFR expression (C. Simonsen and C.-C. Liu, unpublished
`results). Because the SV40 virion has an icosahedral sym-
`metry construction which; in turn, imposes restrictions on
`the size of the DNA that can be encapsidated by its capsid
`proteins (Griffin, 1980), the size of the DNA fragments that
`can be inserted into our SV40 vector is approximately
`limited to the size of the coding region of VP-1 protein
`(about 900 bp). Perhaps this size limit can be increased by
`deleting DNA sequences corresponding to the intervening
`sequences of SV40 late mRNA, provided that the integrity
`of the splicing sites are maintained (Ziff, 1980).
`The control of initiation of translation in eukaryotic cells
`is poorly understood. The plasmid pSVHBSA has retained
`DNA sequences that may contain possible control elements
`for the translation of VP-1 protein, therefore the expres-
`sion of HBsAg in the productively infected CV-1 cell can be
`used as a probe to monitor the in vivo translational effi-
`ciency of different mRNAs transcribed from derivatives of
`pSVHBSA DNA. These derivatives can be obtained by de-
`leting or inserting different DNA sequences at the Eco RI
`site located immediately proximal to the ATG codon of the
`inserted HBsAg gene. In one such example, a 29-bp DNA
`fragment has been inserted into this Eco RI site, resulting
`in a much reduced level (less than 1 %) of HBsAg synthesis
`(C.-C. Liu, unpublished results).
`Recently, Moriarty et al.
`reported the production of
`HBsAg particles in monkey cells using an SV40/HBV re-
`combinant virus (Moriarty et al., 1981). However, due to
`
`LIU ET AL
`
`the nature of their construction, no firm conclusions could
`be drawn regarding the involvement of either potential
`signal peptides preceding the coding region of the mature
`HBsAg, or other virally encoded peptides, on surface an-
`tigen morphogenesis. Although we cannot exclude the pos-
`sibility that the precursor is required for the assembly and
`secretion of 22 nm particle from the infected liver cell, we
`