THE JOURNAL OF BIOLOGICAL CHEMISTRY
`Vol. 258. No. 10, Issue of May 25, pp. 6043-6050,
`Printed in U.S.A.
`
`1983
`
`Expression of the Human Insulin Gene and cDNA in a Heterologous
`Mammalian System*
`
`Orgad LaubS and William J. Rutter
`From the Department of Biochemistry and Biophysics, University of California, Sun Francisco, California 94143
`
`(Received for publication, October 18, 1982)
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`The human insulin gene or the corresponding cDNA
`has been inserted into the early region of a simian virus
`40 vector in which all SV40 splice junctions were de-
`leted while the early promoter and polyadenylation
`regions remained intact. The expression of insulin-cod-
`ing sequences was tested in permissive monkey COS
`cells.
`The insulin cDNA was transcribed from the early
`promoter to produce a
`stable polyadenylated RNA
`which was translated, and immunoreactive human
`proinsulin accumulated in the medium. Thus RNA
`splicing is not obligatory for insulin expression in this
`system.
`insulin transcript was also initiated
`The genomic
`from the SV40 promoter and terminated at the SV40
`polyadenylation site. S1 endonuclease mapping re-
`vealed that the transcript is processed via two alter-
`native splicing pathways within the insulin gene. About
`one-third of the total transcripts are processed nor-
`mally with removal of the two insulin-specific introns.
`This transcript is apparently translated normally since
`immunoreactive proinsulin accumulates in the me-
`dium.
`About two-thirds of the transcripts are processed via
`an alternative splicing pathway involving a new splice
`acceptor site located within the coding region of the
`insulin gene. This results in a codon frameshift such
`that translation would produce a novel chimeric pep-
`tide containing the insulin NH2-terminal B chain, but a
`different COOH terminus containing human and SV40
`sequences. A peptide of the predicted size is detected in
`the COS cell extract.
`
`expression of immunoglobulin genes (Marcu, 1982), calcitonin
`(Rosenfeld et al., 1982; Amara et al., 1982), and to the tissue-
`specific expression of salivary and liver amylase (Young et al.,
`1981).
`The nucleotide sequence of the human insulin gene and its
`flanking regions has been determined (Bell et al., 1979, 1980).
`A comparison of the human insulin gene with
`the insulin
`cDNA and with other insulin genes indicates that this gene
`has two intervening sequences. Although the DNA sequence
`provides crucial structural information, it does not decisively
`locate the boundary region for the RNA splicing junction nor
`the regions regulating gene expression.
`To elucidate these
`features biological systems must be employed.
`We have used SV40 as a vector to express the human insulin
`gene in permissive monkey cells. This system is particularly
`useful for these and other studies because during infection the
`virus reaches high titer within the cells and consequently high
`levels of transcription are achieved. For these experiments our
`construction employed the SV40 early promoter but the SV40
`splice sites were eliminated. A full length cDNA was inserted
`to test for the effect of introns on the expression of insulin-
`coding sequences. Introns are required for effective expression
`of the mouse pmHJ globin gene in another SV40 vector-host
`system (Hamer and Leder,
`1979).’ We show that cultured
`transformed monkey cells infected with
`this SV40-insulin
`recombinant express high
`levels of insulin-coding mRNA
`without splicing and secrete immunoreactive proinsulin into
`the medium. The transcripts from the genomic human insulin
`DNA were processed by two splicing pathways. In the first,
`the precursor RNA is processed normally; in the second, a
`new splice acceptor site is recruited from within the insulin-
`coding sequences.
`MATERIALS AND METHODS
`Most eukaryotic genes are mosaic structures in which the
`enzymes were pur-
`Enzymes and Radioisotopes-Restriction
`coding regions (exons) represented in the mRNA are inter-
`chased from Bethesda Research Laboratories or New England Bio-
`rupted by intervening sequences (introns) which are subse-
`labs. Escherichia coli polymerase I, T4 polynucleotide kinase, and
`
`quently removed from the primary transcript by RNA splicing
`T4 DNA ligase were from New England Biolabs. S I nuclease was
`(Sharp, 1982). In most cellular genes
`thus far studied, the
`obtained from Miles Laboratories. All radioisotopes were from Amer-
`sham.
`primary transcript gives rise to a single mature mRNA species.
`Cell Transfection and Virus Strain-The construction of SV40-
`There are however notable exceptions in which alternative
`insulin recombinants is described in the results sections. Transformed
`splicing is employed: in the early gene of SV40, two donor
`African green monkey (COS-7) cells (Gluzman, 1981) were maintained
`sites are spliced to one common acceptor site (Berk and Sharp,
`in Dulbecco’s modified Eagle’s medium containing penicillin, strep-
`1978). In the adenovirus 2 late genes, one donor site is spliced
`tomycin, and 10% fetal calf serum. Twenty-four hours after seeding
`(1.5 X lo6 cells/lO-cm plate), the cultures were transfected by the
`to several acceptor sites (Chow et al., 1977). Alternative RNA
`CaPO, procedure (Graham and Van Der Eb, 1973; Parker and Stark,
`splicing pathways also contribute to the
`diversity of the
`1979). 5-10 p g of circularized SV40-insulin recombinant DNA were
`used for each plate and virus stocks were prepared from cell lysates
`14-21 days after transfection. The titer of the recombinant viruses
`was estimated by comparison with wild type virus stock of known
`titer, assayed under
`the same conditions. The comparisons were
`performed by comparing cytopathic effects of the two stocks and
`alternatively by comparing amounts of free viral DNA (Hirt, 1967)
`48-h post-infection.
`
`* This research was supported by National Institutes of Health
`Grants GM 28520 and AM 21344 and by Grant 1-745 from the March
`of Dimes. The costs of publication of this article were defrayed in
`part by the payment of page charges. This article must therefore be
`hereby marked “aduertisement” in accordance with 18 U.S.C. Section
`1734 solely to indicate this fact.
`i. Recipient of the Weizmann Fellowship and a fellowship from the
`Cystic Fibrosis Foundation.
`
`A. Buchman and P. Berg, personal communication.
`
`6043
`
`Merck Ex. 1063, pg 1472
`
`

`
`6044
`
`pSV40
`(GM48)
`
`FIG. 1. SV40-Human insulin re-
`combinant designed to express the
`human insulin sequences. The insulin
`sequences are indicated by the dark
`solid line, and the coding sequences are
`indicated by three blocks. The details for
`these constructions are summarized in
`the text.
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`LSVinsCZ
`
`LSVinrZ
`
`LSVinrlP
`
`LSVinrLPZ
`
`LSVins
`
`DNA Preparations"SV40 strain 777 DNA was used for the con-
`struction of the SV40 vectors. The HincII/BamHI human
`insulin
`DNA fragment was purified
`from pIns96 which is a subclone of
`pHi3OO (Bell et al., 1980). All SV40 and human DNA fragments were
`purified by agarose gel electrophoresis. DNA fragments were eluted
`by shaking the gel in 0.2 M NaCl, 1 mM EDTA, 10 mM Tris, pH 7.5.
`Eluted DNA was filtered through GF/C filters and concentrated with
`butanol-1. Fragments were ligated as described by Maniatis et al.
`(1978) and SV40-insulin recombinants were cloned in pBR322 and
`amplified in E. coli (Clewell and Helinski, 1969). SV4O-insulin recom-
`binant DNA was extracted from infected COS cells as described (Hirt,
`1967; Randloff et al., 1967). Preparation of uniformIy labeled viral
`DNA has been previously described (Zasloff et al., 1982). End-labeled
`DNA probes were prepared by using T4 DNA polymerase for 3' end
`labeling (O'Farrell et al., 1980) and T4 polynucleotide kinase for 5'
`end labeling (Maxam and Gilbert, 1980).
`Analysis of RNA-Polyadenylated and nonpolyadenylated cyto-
`plasmic mRNAs from COS cells infected at a multiplicity of 10-100
`plaque-forming units/cell with the LSV*-insulin recombinants were
`isolated as described previously (Laub and Aloni, 1975). Mapping of
`RNAs by the SI method of Berk and Sharp (1977) was done with
`labeled insulin probes prepared from LSV,,. DNA. After hybridization
`at 50-52 "C for 4 h, the DNA:RNA hybrids were digested with lo00
`units of SI nuclease, denatured with formamide, and analyzed by
`electrophoresis on a 5% polyacrylamide, 8 M urea gel (Maxam and
`Gilbert, 1980). For Northern analysis polyadenylated RNA was elec-
`trophoresed on a methyl mercury gel (Alwine et al., 1977) and blotted
`onto nitrocellulose paper. The resulting blot was hybridized to a nick-
`translated insulin probe (Maniatis et aE., 1978), washed with 0.1 X
`SSC at 50 "C, and autoradiographed.
`Protein Analysis-COS cells were infected with the LSVIns2 or
`LSVi,.C2 virus stocks at 10-100 plaque-forming units/cell. Cells were
`maintained for 24 h in cysteine-depleted medium followed by 6-h
`labeling with 10 pCi/ml of ~-rS]cysteine. Cell lysate or culture
`medium was immunoprecipitated with guinea pig anti-bovine insulin
`serum and analyzed on a 12.5% acrylamide/sodium dodecyl sulfate
`
`late simian virus 40-insulin
`The abbreviations used are: LSVi,,
`recombinant; ESVi,, early simian virus 40-insulin recombinant;
`LSV,,C2,
`late simian virus 40-insulin cDNA recombinant; LSVk2,
`late simian virus 40-insulin genomic recombinant; Pipes, 1,4-pipera-
`zinediethanesulfonic acid; pLSV, late simian virus 40 vector.
`
`gel (Laemmli, 1970). Quantitative radioimmunoassays were per-
`formed as described (Rall et al., 1973).
`
`RESULTS
`
`Construction of SV40-Human Insulin DNA Recombi-
`nants-Fig. 1 summarizes the procedure for constructing the
`SV40-insulin recombinants. The LSV vector was generated
`from an SV40 genome inserted in the B a m H I site of pBR322
`(pSV40) and amplified in E. coli GM48 cells. pSV40 was
`linearized by partial digestion with Hind11 restriction endo-
`nuclease (SV40 nucleotide 5107) followed by S1 treatment to
`produce blunt ends. The linear pSV40 DNA was digested with
`BcZl restriction endonuclease (SV40 nucleotide 2706) and the
`7.2-kilobase pair pLSV vector was purified
`by preparative
`agarose gel electrophoresis. The resulting pLSV vector con-
`tains the SV40 origin of replication and the coding information
`for the SV40 late genes, Most of the coding region for the
`SV40 early genes (nucleotides 5107 to 2706) was deleted from
`
`the pLSV vector. The vector retains the early SV40 promoters
`the 5' end as
`and 105 noncoding nucleotides downstream from
`well as 136 nucleotides prior to the polyadenylation site at the
`3' end of the early gene region. In pLSVi,,C2 a 545-bp BamHI/
`EcoRI blunt-ended insulin cDNA fragment was inserted
`in
`this site. The human insulin gene including 69 nucleotides in
`the 5' flanking and 119 nucleotides in the 3' flanking region
`was present in the 1603-bp HincII/BamHI fragment that was
`used in all the insulin genomic recombinants. In LSVi,,2 the
`105 bp downstream
`1603-bp insulin fragment was inserted
`
`from the early SV40 major cap site. In LSVin,LP the late SV40
`leader sequences (SV40 nucleotides 234-437) are placed be-
`tween the SV40 early promoter and the human insulin gene.
`In LSV,,LP2,
`the late SV40 promoter and leader (SV40
`nucleotides 140-437) were inserted between the early SV40
`promoter and insulin gene. The constructions of the late SV40
`ESVi,,,, and the nonexpressing
`replacement recombinant,
`
`Merck Ex. 1063, pg 1473
`
`

`
`Human Insulin Gene and cDNA in Heterologous Mammalian System
`a
`
`- b
`
`LSVinsCP RNA
`
`6045
`
`c
`
`LsVisCP
`M RNA
`
`INSULIN
`
`Nu.
`
`CY.
`
`"
`
`SV40
`
`Nu.
`
`Nu.
`(RNase)
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`FIG. 2. Transcription of the LSVrmC2 recombinant. COS cells were infected with 10-100 plaque-forming
`units/cell of the LSVi,C2 virus stock and incubated for 48 h at 37 "C. Nuclear (Nu.) and cytoplasmic (Cy.) RNA
`was prepared as described previously ( h u b and Aloni, 1975). a, polyadenylated cytoplasmic RNA was denatured
`in 10 m~ methyl mercury, electrophoresed through a 5 KIM methyl mercury, 1.5% agarose gel, and transferred to
`nitrocellulose. The resulting blots were preincubated in 50% formamide, 4 X SSC, 3 X Denhardt's, and hybridized
`at 42 "C to an insulin 32P-labeled DNA probe. The blot was washed in 0.1 X SSC at 50 "C and autoradiographed.
`LaneM contains DNA size markers labeled with [y-32P]ATP and polynucleotide kinase (Maxam and Gilbert, 1980).
`b, 5-fold dilutions of the nuclear and cytoplasmic RNAs and controls of RNase-treated samples were spotted on
`nitrocellulose and hybridized to nick-translated SV40 and insulin r3*P]DNA probes.
`
`insulin
`LSVi, hybrid have been described elsewhere:' All
`DNA fragments had a blunt 5' end and a BamHI 3' end.
`These fragments were ligated between the HindIII/Sl blunt
`end and the Bell end within the pLSV vector.
`Ampicillin-resistant colonies were screened by hybridiza-
`tion to 32P-labeled insulin and SV40 probes, and the positive
`colonies were analyzed by restriction endonuclease mapping.
`The resulting plasmids contain a BamHI insert which includes
`the SV40 origin of replication, a functional set of late SV40
`genes and human insulin sequences inserted in the sense
`direction relative to the early SV40 promoter and polyaden-
`ylation sites. These BamHI fragments containing the LSV-
`insulin hybrids were self-ligated to form circular DNA and
`subsequently infected into permissive monkey COS cells
`(Gluzman, 1981).
`Transcription of Insulin Sequences from the SV40-Insulin
`cDNA Recombinant (LSV&2)-The
`intronless LSVi,,C2 re-
`combinant produces high levels of cytoplasmic polyadenylated
`RNA containing insulin coding sequences. A Northern blot
`analysis of this RNA (Fig. 2a) revealed one insulin-specific
`band which corresponds in size (-900 bases) to an insulin
`&NA which is initiated at the SV40 early promoter and is
`polyadenylated at the early SV40 termination signal. This
`RNA contains the 748 nucleotides of nonspliced insulin coding
`RNA and about 150 poly(A) residues.
`Because of the previous reports suggesting a role of intron
`removal in mRNA stability (Hamer and Leder, 1979) and
`transport from the nucleus to the cytoplasm (Lai and Khoury,
`1979), we have assayed the steady state levels of insulin-coding
`sequences in the nucleus and the cytoplasm. The results (Fig.
`2b) show that the partitioning of nonspliced insulin mRNA
`between the nucleus and the cytoplasm is indistinguishable
`from the partition of normally spliced late SV40 mRNA. Thus,
`in this system, there is no apparent barrier to the transport of
`intronless mRNA from the nucleus to the cytoplasm.
`3Laub, O., Rall, L., Bell, G. I., and Rutter, W. J. (1983) J. Biol.
`C h m . 258,603743042.
`
`Transcription of Insulin-coding Sequences from SV40-In-
`sulin Gene Recombinants-The RNA present in the cyto-
`plasm of COS cells infected with each of the LSV-insulin
`recombinants was analyzed by the method of Berk and Sharp
`(1978). A uniformly labeled insulin-specific probe was pre-
`pared from COS cells infected with the LSVi, virus stock and
`labeled with
`(:"P)orthophosphate for 12-16 h. Viral super-
`(Hirt, 1967; Randloff et al.,
`coiled ["'PIDNA was purified
`1967) and the insulin probe was isolated as a 1.7-kilobase pair
`HincII fragment. This labeled probe contains the 1603 nu-
`cleotides of the human insulin insert and an additional 103
`bases derived from the 3' end of the early SV40 gene. The 'v2P
`probe was denatured and hybridized to poly(A') and poly(A-)
`RNA isolated from infected COS cells under conditions favor-
`ing RNA-DNA duplexes (Casey and Davidson, 1977). The
`resulting hybrids were digested with S1 nuclease and analyzed
`on a 5% acrylamide, 8 M urea sequencing gel (Maxam and
`Gilbert, 1980). As shown in Fig. 3, lane A, poly(A) RNA from
`the ESVi..
`recombinant produced six bands; the band 206-
`and 218-nucleotides long correspond to the two insulin-coding
`exons and co-migrate with the S1-protected fragments ob-
`tained with human insulinoma RNA
`treated in a similar
`manner.3 LSVi., is not transcribed (Fig. 3, lane B). This is due
`to the strong inhibitory effect of an SV40 sequence (map units
`0.76 to 0.86) interposed between the promoter and down-
`stream sequences. If this inhibitory fragment is removed
`(LSVh2) or replaced (LSVhLP and LSVhLP2), the insulin
`sequences are transcribed and expressed at high levels.
`LSVi.,2, LSVi.,LP,
`and LSVi..LP2
`(Fig. 3, lanes C, D, and
`E, respectively) are expressed efficiently, and produce 5- to
`10-fold more RNA than the late SV40 replacement recombi-
`nant. The second exon of the human insulin gene, 206 nucleo-
`tides in length, is present in the poly(A') fraction of all LSV-
`insulin constructions; however, exon 1 (42 bp) and exon 3 (218
`bp) are not detected in any of the LSV recombinants. This
`result indicates that most RNA transcripts initiate and ter-
`minate at SV40 early signals. The band, 99 f 3 nucleotides in
`
`Merck Ex. 1063, pg 1474
`
`

`
`6046
`
`Human Insulin Gene and cDNA in Heterologous Mammalian System
`
`length, was not predicted; the next set of
`nucleotides in
`experiments was aimed at the mapping and characterization
`of this transcript.
`Mapping the Novel Transcript-Hue111 restriction endo-
`nuclease is one of the few restriction enzymes which cuts
`single-stranded DNA at its specific recognition site (CCGG).
`The DNA 315 nucleotides in length derived from the S1
`endonuclease protection experiment was eluted from the se-
`an excess of HaeIII. The
`quencing gel and digested with
`cleavage products were analyzed on a 5% acrylamide, 8 M urea
`sequencing gel. As shown in Fig. 4, two new bands, 192 f 3
`and 123 f 3 bases long, were detected. Only two locations
`within the insulin gene insert could produce a 315-nucleotide
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`603
`
`463
`
`194
`188
`
`152
`
`118
`
`102
`
`72
`68
`
`315
`
`192
`
`123
`
`c(
`
`I
`
`434 t p
`
`Ironr<rlpll
`1101.
`SV40 Polyodenylotion
`1€011* lronl'rlpll
`F'IG. 3. S1 analysis of RNA from SV40-insulin-infected cells.
`Purified non-poly(A) (-)- and poly(A)-containing (+) cytoplasmic
`RNAs from infected COS cells were used. RNAs were hybridized to
`an insulin/HincII DNA fragment purified from uniformly labeled
`LSV,, ["'PIDNA. Hybridization mixture in
`80% formamide, 0.4 M
`NaCI, 0.01 M Pipes, pH 6.4 was denatured 2 min at 80 "C, annealed 3
`h at 52 "C, digested 1 h with IO00 units of S1 nuclease, and subjected
`to a 5% acrylamide, 8 M wea sequencing gel. Tracks MI and MZZ
`contain size markers; Lane A, ESVi, RNA; B, LSVi, RNA; C, L S V , 4
`RNA D, LSVi,LP RNA E, LSVi..LP2 RNA; 0, control of probe
`without RNA. The diagram represents the predicted S1-protected
`fragments. The band 315 nucleotides in length was unpredicted.
`
`length, corresponds to RNA that is initiated at the SV40 cap
`site and spliced at the donor site of insulin exon 1. The band,
`443 f 8 nucleotides long, corresponds to the RNA extending
`from the splice acceptor site of insulin exon 3 to the 3' end of
`the insulin probe and therefore results from transcripts poly-
`adenylated at the early SV40 site. The largest protected band,
`483 f 8 nucleotides in length, was also observed with
`the
`ESVi,, recombinant (Fig. 3, lane A ) . This fragment is derived
`from a partially spliced RNA in which only the second intron
`is removed, thus this particular RNA class contains exon 1,
`insulin intron. The RNA, 315 f 6
`exon 2, and the first
`
`I I I I I I C I I
`
`0
`1
`
`4
`4
`c """"" 4
`
`4 4 I
`
`500
`
`1000
`
`14
`
`w
`I- - - - - - - - - - -,
`
`"-4
`
`1500
`
`I
`
`1700
`
`Base Pairs
`FIG. 4. HaeIII mapping of the 315 transcript. The 315-base
`[32P]DNA derived from the SI nuclease protection experiment (Fig.
`3) was eluted from the sequencing gel by passive shaking of the gel as
`described under "Materials and Methods." The eluted ["'PIDNA was
`digested with 3 units of HaeIII, and the cleavage products were
`analyzed on a 5% acrylamide, 8 M urea sequencing gel. Lane MI and
`MZZ are end-labeled ["*P]DNA size markers. The diagram represents
`the HaeIII restriction map of the insulin DNA. The dotted lines
`represent the predicted location of the 315-nucleotide transcript.
`
`483
`
`340
`
`218
`206
`
`99
`
`3%
`
`206
`
`99
`
`Insulin Probe
`Insulin rnRNA
`
`SV40 Promoter
`
`"
`4Y bp
`YO6 bp
`"
`9V bp
`
`340 bp
`
`-
`SVIO Polyodenylotion +, .
`-
`
`Merck Ex. 1063, pg 1475
`
`

`
`Human Insulin Gene
`
`and cDNA in
`
`Heterologous Mammalian System
`
`6047
`
`fragment which, when cleaved with HaeIII, would yield 123-
`and 192-bp fragments (Fig. 4). Because the HaeIII products
`appear as doublets, we reasoned that the fragment must be
`located at the 3' end of the insulin insert. In this region there
`are two HaeIII sites separated by 6 bases and located on
`opposite DNA strands, thus the single-stranded DNA can
`form a loop that contains a double-stranded HaeIII site, which
`is presumed to be the substrate for this enzyme (Bron and
`Murray, 1975).
`Mapping the 3' E n d of the New Exon-A probe for map-
`ping the new exon was constructed from LSVi,, DNA digested
`with PuuII labeled with "'P using T4 DNA polymerase
`(O'Farrell et al., 1980) and subsequently cleaved with HincII.
`
`The 445-bp PuuII/HincII-labeled fragment was purified by
`gel electrophoresis. This DNA probe contains 98 bp derived
`from the third insulin exon, 117 noncoding nucleotides from
`the 3' end of the insulin insert, and 227 bp derived from the 3'
`end of the SV40 early genes. This [''"PIDNA probe was hy-
`bridized to cytoplasmic polyadenylated RNA extracted from
`COS cells infected with the ESVi,, or the LSVi.,2 virus stocks.
`As shown in Fig. 5, lane A, the ESVi.,
`transcripts protected
`the 98 f 2-base fragment corresponds to
`two DNA bands;
`insulin transcripts polyadenylated at the insulin poly(A) site
`and the 215 f 4-base fragment extends beyond the end of the
`insulin insert and reflects polyadenylation at the late SV40
`poly(A) site. Hybridizing the probe with LSV,,,2 RNA (Fig. 5,
`
`MI
`
`A
`
`B
`
`C
`
`MI
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`353
`078
`872
`
`603
`
`3lO
`
`281
`271
`
`234
`
`194
`
`118
`
`72
`
`Born HI
`
`21!
`
`Srna I
`4 1 I
`563 bpt
`
`I
`
`5 -
`0 .
`
`c
`* -
`
`5 -
`
`c
`
`9
`8.
`
`c
`
`Pvu n
`I
`
`"""-4
`+I
`
`18
`
`72
`
`I Barn HI
`- -- 4
`
`4 4 5 b p *-
`98 b p *-
`2 1 5 b p *-
`380 bp *
`FIG. 5. Mapping the 3' end of the new exon. LSVi, DNA was
`cut with PuuII restriction endonuclease and labeled with T4 DNA
`polymerase (O'Farrell et aZ., 1980) using [y-32P]dCTP. The labeled
`DNA fragments were cut with HincII, and a 445-bp PuuII/HincII-
`labeled fragment was purified by gel electrophoresis. This DNA probe
`was annealed with L S V d RNA and analyzed by S1 nuclease as
`described for Fig. 3. Lane MI, end-labeled ["PIDNA size markers; A,
`a late SV40-replacement recombinant
`SI mapping of RNA from
`(ESVi,)", B, RNA from COS cells infected with the LSVi,2
`recom-
`binant; C, untreated labeled probe. The diagram represents the
`predicted SI-protected fragment, terminating at the insulin poly(A)
`site (98 bp) or early SV40 poly(A) site (380 bp).
`
`*
`*
`
`340 bpb
`215 bp-*
`FIG. 6. Mapping the 5' end of the new exon. The 1603-bp
`HincII/BamHI insulin-coding DNA fragment was end-labeled with
`[y-"P]ATP and polynucleotide kinase. The labeled fragment was
`digested with restriction endonuclease SmaI and the resulting 563-bp
`labeled fragment was purified by gel electrophoresis. This DNA probe
`was annealed with LSVi-2 RNA and analyzed by
`SI nuclease as
`described for Fig. 3. Lane MI, DNA size markers; A, untreated probe;
`B, no RNA; C, S1 mapping of RNA extracted from COS cells infected
`with LSV,&. The diagram represents the S1-protected fragments.
`
`Merck Ex. 1063, pg 1476
`
`

`
`E- --
`
`M
`
`m
`
`Human Insulin Gene and cDNA in Heterologous Mammalian System
`6048
`A
`R -E-
`.-g- P... s..- PA
`lane B) results in protecting only one DNA fragment 380 f 6
`nucleotides in length which corresponds to polyadenylation at
`the early SV40 site. The unique 380-base band detected in
`this experiment suggests that the new exon has an overlapping
`3' end with the correct insulin transcript. Thus, the normal
`and the anomalous RNAs terminate at the early SV40 site,
`but differ in their 5' acceptor site.
`Mapping the 5' End of the New Exon-A probe for map-
`ping the 5' end of the new exon was prepared from the 1603-
`bp HincII/BamHI insert by labeling with [yJ2P]ATP and
`polynucleotide kinase. The labeled fragment was digested
`with the restriction endonuclease SmaI and the resulting 563-
`bp labeled fragment was purified by gel electrophoresis. This
`DNA probe extends from the 3' end of the insulin DNA insert
`into the second intron within the insulin gene; thus, it includes
`exon 3. The ['''PIDNA probe was denatured and annealed to
`poly(A) RNA extracted from COS cells infected for 48 h with
`LSVins2. As shown in Fig. 6, lane C, two S1-resistant bands
`were detected in the analytical sequencing gel. The 340-base
`band corresponds to the expected insulin transcript spliced at
`the acceptor site of insulin exon 3. The 222 k 4-base band
`corresponds to the new insulin splice acceptor site which is
`located within the coding region of exon 3.
`The protected fragments shown in Fig. 6 were sized by gel
`electrophoresis alongside a sequencing ladder of chemical
`degradation products (Maxam and Gilbert, 1980) generated
`from the same BamHI/SmaI probe. As summarized in Fig. 7,
`the position of the two protected fragments within the se-
`
`L.
`
`a
`. . .CTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGG
`CACAAGGCCTTGGACGAGACGCGCCGTGCAGGACC
`r
`CAGTGGGGCAGGTGGACCTGGGCGGGGGCCCTGGTGCA
`GTCACCCCGTCCACCTCGACCCGCCCCCGGGACCACGT
`
`CGCAGCCTGCAGCCCTTGCCCCTGGAGGGGTCCCTGCA
`CCCTCGCACGTCGGGAACCGGGACCTCCCCAGGGACGT
`
`I
`
`..
`
`b
`
`m
`
`!$
`G C t%'
`
`G
`I T
`
`h
`
`i
`CCTCCtTCTAtCAGC:GGAGAACTACTGCAACTA~CG
`t C A G G G A G ~ A C C T C T T ~ 1 G A C G T T G A T C : G C
`
`CAGCtTGCAGGCAGCCCCACACCCGCCGCCTCCTGCAC
`GTCGCACGTCCGTCGGGGTGTGGGCGGCGGAGGACGTG
`
`CGAG;GACATGCAAT~AAGCCCTTGAACCAGCCCTGCT
`GCTt:C:CTACCTlk:TTCGGGAACTTGGTCGGGAC~
`
`GTCCCGTCTGTGTGTCTTGCGGGCCCTGGGCCAAGCCC
`CACCGCACLCACACACAACCCCCGGGACCCGGTTCGGG
`
`C C A C G C T C T C T G G G T G t C C A C A G G T G C C G t . . .
`GCTCCGAGAGACCCACGGGTGTCCACGGTTGCGGCC.. .
`C
`
`c-(
`
`5'
`
`RG. 7. Summary of the new splice acceptor site in the hu-
`man insulin gene. a, summary of the mapping of the two alternative
`splice sites on the sequence of the human insulin gene (Bell et al.,
`1980). b, the S1 analysis described for Fig. 6 was sized by gel electro-
`phoresis alongside a sequencing ladder of chemical degradation prod-
`ucts (Maxam and Gilbert, 1980) generated from
`the end-labeled
`SmaI/BamHI probe. c, a schematic representation of the two alter-
`native splice acceptor sites for the third exon coded by the human
`insulin gene.
`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`mhaln
`FIG. 8. Synthesis of human-related peptides in infected COS
`cells. Monolayers of lo6 COS cells were infected with the L S V d or
`LSVhC2 virus stocks. Control COS cells were infected with an LSV
`vector carrying the hepatitis B virus surface antigen gene. Cells were
`grown 12 h in a cysteine-depleted medium followed by 6-h labeling
`with [?3]cysteine (10 pCi/ml). Secreted proteins and the cellular
`lysate (0.5% Nonidet P-.iO/deoxycholate) were analyzed by immuno-
`precipitation with guinea pig anti-bovine insulin serum (Rall et al.,
`1973) followed by 12.5% acrylamide, sodium dodecyl sulfate gel elec-
`trophoresis (Laemmli, 1970). Lane M, size markers: 69, 46, 30, 18.4,
`12.3 Da; A and a, cellular and media from control COS cells infected
`with LSV-Herpes simplex virus 1. B and b, cellular media from COS
`cell infected with LSV-2 virus stock. C and c, cellular and media
`from COS cells infected with the LSVi,C2 virus stock.
`
`quence is accurately mapped within the insulin gene.
`COS
`Synthesis of Human Insulin-related Peptides in
`Cells-To
`test for synthesis of insulin-related peptides, COS
`cells were infected with LSVin,C2 (insulin cDNA recombinant)
`and LSVi2 (insulin genomic recombinant) virus stocks. Cells
`were grown in cysteine-depleted medium and labeled for 12 h
`with ["Slcysteine. Insulin-related material was immunopre-
`cipitated from both culture media and cellular extracts ( R a l l
`et al., 1973) and analyzed on a 12.5% polyacrylamide-sodium
`dodecyl sulfate gel (Laemmli, 1970). As shown in Fig. 8, both
`LSVi,C2- and LSVi,Z-infected COS cells synthesize and se-
`crete human proinsulin. Thus, insulin cDNA is expressed as
`efficiently as genomic DNA in this SV40 vector.
`The two splicing pathways within the human insulin gene
`should on translation produce two distinct peptides which
`share a common insulin NHa-terminal region but are divergent
`in the COOH-terminal region. The aberrant splicing within
`the insulin gene expressed in the LSV vector system generates
`a chimeric translatable insulin-SV40 exon. A =15,000-Dal
`chimeric peptide was detected in the cellular fraction of COS
`cells infected with the genomic recombinant, LSVi,2
`(see
`protein x in Fig. 8). This peptide was not detected in COS
`cells infected with the LSVin,C2 virus stock or with control
`COS cells infected with an LSV recombinant carrying the
`hepatitis surface antigen gene.
`
`DISCUSSION
`early gene
`In this paper we describe the use of SV40
`replacement vectors (LSV) for studying transcription and
`processing of a cloned human insulin gene expressed in SV40-
`transformed monkey kidney cells
`(COS). The LSV-derived
`expression system has several useful features. First, the host
`monkey COS cell line produces SV40 large T antigen and
`therefore is permissive to early SV40 replacement recombi-
`nants, thus the LSV-insulin recombinants can be propagated
`in this host without a helper virus. Second, in this SV40
`vector-host system, the early SV40 promoter produces high
`levels of RNA. Third, all SV40 splice sites were deleted from
`the LSV expression vector, thus it is possible to study the
`RNA splicing signals within a gene cloned in
`this vector.
`
`Merck Ex. 1063, pg 1477
`
`

`
`Downloaded from
`
`http://www.jbc.org/
`
` by guest on June 20, 2016
`
`Human Insulin Gene and cDNA in Heterologous Mammalian System
`6049
`mechanism for enhancing expression of the insulin gene. The
`Finally, the SV40-COS system faithfully reproduces in vivo
`heterologous monkey COS cell
`system seems to be fully
`transcription processing (Mellon et al., 1981).
`competent to process insulin mRNA and secrete human proin-
`When the human insulin cDNA was placed under the
`sulin. It can be assumed therefore that the processing systems
`control of the SV40 early promoter, proinsulin accumulated
`for mRNA and the secretory mechanisms are not gene- or
`in the medium at approximately the same rate as that result-
`cell-specific.
`ing from a similar construction employing the intact gene
`Intriguingly, the strength of the termination sites in these
`containing its two introns (LSV,,2). Gruss et al. (1981) have
`systems appear to correspond to the strength of the promoter
`obtained similar results with a late SV40 replacement recom-
`(early SV40 > late SV40 > insulin). It remains to be demon-
`binant carrying an intronless rat insulin DNA fragment. Anal-
`strated whether the strength of the initiation and termination
`ysis of the mRNA in LSVin,C2-infected COS cells demon-
`signals are intrinsically coupled via some interaction or are
`strated normal levels of stable polyadenylated RNA of the
`affected by some other structural feature (e.g. the stronger
`expected size. Further, a dot blot analysis of insulin-coding
`promoters are always upstream and the stronger terminators
`mRNA indicated no significant difference in