Proc. NatL Acad. Sci. USA
`Vol. 79, pp. 7852-7856, December 1982
`Immunology
`
`Cloning and nucleotide sequence of mouse immunoglobulin
`E chain cDNA
`(immediate hypersensitivity/IgE/cell-free translation/cDNA cloning/protein primary structure)
`FU-TONG LIu*, KEITH ALBRANDT*, J. GREGOR SUTCLIFFEt, AND DAVID H. KATZ*
`*The Department of Immunology, Medical Biology Institute, 11077 North Torrey Pines Road, La Jolla, California 92037; and tThe Department of
`Immunopathology, Scripps Clinic and Research Foundation, La Jolla, California 92037
`Communicated by Hans J. Muller-Eberhard, September 1, 1982
`
`cDNA corresponding to mouse IgE heavy (E)
`ABSTRACT
`chain mRNA was cloned from mouse IgE-secreting hybridoma
`cells. A clone-containing the e cDNA insert was identified by hy-
`bridization to E mRNA and subsequent translation in vitro to un-
`processed E chain reactive with anti-mouse IgE antibodies. This
`clone was used to select 20 other E cDNA clones by colony hy-
`bridization. The clone containing the longest insert was selected
`and the E cDNA insert was subjected to sequence analysis. The
`determined sequence is 1,279 nucleotides long and contains the
`coding regions for part of the constant region (C.) 1 and all of the
`CE2, CE3, and C64 domains and also the entire 3' untranslated
`region of E mRNA. When the amino acid sequence determined
`from the nucleotide sequence is compared to that of human E
`chain; significant homologies between corresponding domains of
`the two E chains are found, including conservations in cysteine and
`tryptophan residues and carbohydrate attachment sites.
`
`IgE has been established as the major class -of antibody that
`mediates type I immediate hypersensitivity, in that allergic re-
`sponses are associated with elevated levels of IgE antibodies
`specific for certain allergens (1). These IgE molecules bind to
`surface Fc receptors on mast cells and basophils and mediate
`the release of vasoactive amines and other pharmacologically
`active substances responsible for the clinical manifestation of
`hypersensitivity (2).
`IgE also may play an important defense role against certain
`pathogens-e.g., parasites. Thus, both the total and specific
`IgE levels are dramatically elevated in certain parasitic infec-
`tions and a striking correlation between the specific IgE anti-
`body response and the development of immunity to reinfection
`has been demonstrated in the animal model (3).
`Due to the intimate relatedness of IgE to the human allergic
`diseases and its possible role in the host defense, understanding
`the regulation of IgE production is a matter ofgreat importance.
`Much effort has been directed toward this area of research and
`it has been found that IgE production is delicately controlled
`in vivo. The most enlightening observations have been that the
`level of IgE production is selectively controlled among other
`Ig classes. Thus, biologically active factors specifically regulat-
`ing the IgE responses have been identified (reviewed in ref.
`4). How the regulation is operating at. the molecular level is
`awaiting exploration.
`In recent years, significant advances have been made in un-
`derstanding the genomic organization of Ig genes and their
`expression during lymphocyte differentiation. Most recently,
`the IgE heavy (E) chain gene has been isolated and its position
`in the genome relative to other Ig genes has been established
`(5, 6). The differentiation of B cells into IgE-producing cells can
`
`be related to the rearrangementof the heavy chain variable (V)
`region gene initially proximal to the IgM heavy (,4) chain gene
`to a position next to the E chain gene. One of the keys to un-
`derstanding the regulation of IgE synthesis may then lie in the
`regulation at the DNA level in this class.switching event.
`Another important area of research for understanding the
`allergic responses is the establishment ofthe structure-function
`relationship of IgE` molecules. Although the complete amino
`acid sequence of a human myeloma E chain has been known for
`some time (7), the precise determinant involved in the binding
`of IgE to Fc receptors still-has not been established. Once this
`determinant is defined, one can perhaps design effective ther-
`apeutic agents for allergy, acting at the level of inhibiting the
`binding ofIgE. It appears that isolation ofcDNA corresponding
`to mRNA of the E chain would provide us with not only the
`protein, sequence of E chain but also a tool to explore the pos-
`sibility of expressing in prokaryotic cells or chemically synthe-
`sizing biologically active fragments of-E chain ofpredetermined
`sequences.
`Therefore, for the purpose of studying expression and struc-
`ture of IgE, we have initiated the cloning of mouse E chain
`cDNA. In this communication, we report the results of this
`cloning study, including the complete nucleotide sequence of
`an isolated cDNA that encodes most of the constant region (CQ)
`of the E chain.
`MATERIALS AND METHODS
`Cell Line. Murine anti-dinitrophenyl IgE hybridoma (H1-
`DNP-E-26.82) was constructed previously (8) and maintained
`in Dulbecco's modified Eagle's medium supplemented with
`10% fetal calf serum.
`Preparation of RNA. RNA was isolated by a procedure
`adapted from that of Marcu et aL (9). Polyadenylylated RNA was
`isolated by oligo(dT)-cellulose chromatography and then was
`fractionated on a linear 15-30% sucrose gradient. Fractions
`were tested individually in the in vitro translation system de-
`scribed below and those fractions enriched in E mRNA were
`pooled.
`In Vitro Translation and Immunoprecipitation. The mRNA
`was translated in the rabbit reticulocyte lysate system (New
`England Nuclear). For immunoprecipitation, the translation
`products were mixed with rabbit anti-mouse IgE (RAME) an-
`tibodies conjugated to Sepharose 4B (8) suspended in 0.5% bo-
`vine serum albumin in phosphate-buffered saline at pH 7.2 for
`1 hr at 40C. The beads were washed three times with the above
`saline and two times with 0. 0625 M Tris-HCl at pH 6.8, and the
`bound polypeptides were released by boiling in 0.0625 M
`Tris-HC1, pH 6.8/10% glycerol/2% NaDodSO4/5% 2-mercap-
`
`The publication costs ofthis article were defrayed in part by page charge
`payment. This article must therefore be hereby marked "advertise-
`ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
`
`Abbreviations: e chain, heavy chain of IgE; Ce, constant region of E
`chain; RAME, rabbit anti-mouse IgE; A chain, heavy chain of IgM;
`CHO, carbohydrate.
`
`7852
`
`Merck Ex. 1057, pg 1416
`
`

`
`Immunology: Liu et d
`toethanol for 1.5 min. Translation products and immunopre-
`cipitates were analyzed by NaDodSO4/polyacrylamide gel elec-
`trophoresis by using the Laemmli system (10).
`Preparation of Duplex cDNA for Cloning. Preparation of
`cDNA from mRNA with avian myeloblastosis virus reverse tran-
`scriptase, second-strand synthesis with DNA polymerase, nu-
`clease S1 digestion, selection of the longest cDNA by fraction-
`ation on a column of Bio-Gel A-150m, addition ofoligo(dC) tails
`and hybridizing of the tailed duplex cDNA with Pst I-cut and
`oligo(dG)-tailed pBR322 were performed essentially as de-
`scribed (11).
`Transformation and Screening of Recombinant Bacteria.
`The hybrid DNA was used to transform calcium-shocked Esch-
`erichia coli strain C600 (12). Transformants were isolated on
`tetracycline-containing plates. e cDNA clones were selected by
`colony hybridization (13) with 32P-labeled cDNA made from the
`sucrose gradient-enriched E mRNA by reverse transcription
`and hybridization selection and translation (14).
`Characterization of E cDNA. Restriction endonuclease sites
`within the inserts were identified and used to generate frag-
`ments that were subjected to nucleotide sequence analysis fol-
`lowing the procedure of Maxam and Gilbert (15).
`RESULTS
`Identification of a Polypeptide Synthesized by in Vitro
`Translation of E mRNA. The cloning of e cDNA described in
`this report relied heavily on the in vitro translation of E mRNA.
`When total polyadenylylated RNA isolated from IgE hybridoma
`cells was translated, numerous polypeptides were produced.
`However, no prominent band within the expected size range
`of e chain was apparent on NaDodSO4/polyacrylamide gels. By
`immunoprecipitation with RAME antibodies, a Mr 62,000 poly-
`peptide was identified as the in vitro synthesized e chain. This
`in vitro translation assay was used to identify fractions enriched
`in E mRNA from the sucrose density gradient fractionation of
`crude polyadenylylated RNA. Fig. 1 presents a gel electropho-
`resis display of the in vitro translation products of the sucrose
`density gradient-enriched E mRNA (lane b). The immunopre-
`cipitates by RAME of the total translation products are shown
`in lane c. From the quantity ofRAME-precipitable translation
`products, the purity of the enriched e mRNA was estimated to
`be 5%.
`
`a
`
`b
`
`c d
`
`69-
`
`46-
`
`30 -
`
`.:_
`
`..-'
`
`-&- X
`0-,*
`AL
`
`s---
`Fluorograph of [35Slmethionine-labeled polypeptides syn-
`FIG. 1.
`thesized by in vitro translation of mRNA (lanes a-c) or synthesized in
`vivo (lane d) and electrophoresed on 10% polyacrylamide gels. Lanes:
`a, no added mRNA; b, total translation products of sucrose density
`gradient-purified mRNA; c, polypeptides precipitatedfrom translation
`products (lane b) by RAME antibodies conjugated to Sephatose 4B; d,
`RAME-Sepharose 4B-immunoprecipitated polypeptides from the su-
`pernatant of IgE-secreting hybridoma (H1-DNP-c-26.82) cultured in
`the presence of [85Slmethionine. 6, E*, K, and K* designate unprocessed
`and processed E chain and unprocessed and processed K chain, respec-
`tively. Molecular weights are shown as Mr X 10-'.
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`7853
`
`The E chain polypeptide synthesized in vitro has an apparent
`molecular weight that is significantly lower than the in vivo syn-
`thesized product (Mr 72,000; Fig. 1, lane d). This difference
`most likely reflects the lack of glycosylation [the carbohydrate
`content of the mature mouse hybridoma IgE is 13% (8)] and
`other post-translational modifications of the polypeptides syn-
`thesized in the rabbit reticulocyte lysate system. Indeed, in
`vitro translation of E mRNA in the presence of dog pancreatic
`microsomal membranes, which ficilitates processing of the
`translation products (16), yielded apolypeptide that comigrated
`with E chain synthesized in vivo (data not shown).
`Another polypeptide synthesized in vitro from the partially
`purified E mRNA was the light chain of IgE (Fig. 1, lane c). This
`light chain product migrated more slowly than the in vivo-pro-
`duced polypeptide in NaDodSO4/polyacrylamide gels (Fig. 1,
`lane d). Again, this is due to the lack of post-translational mod-
`ification, because inclusion of microsomal membranes in in vi-
`tro translation resulted in a proper processing ofthe translation
`product (data not shown).
`Molecular Cloning and Identification of e cDNA Clones.
`From 20 ng of duplex cDNA, approximately 1,800 tetracycline-
`resistant and ampicillin-sensitive bacterial transformants were
`obtained. The number of potential E cDNA clone candidates
`was decreased to about 300 by a screening procedure employing
`[32P]cDNA derived from the partially purified E mRNA as a
`hybridization probe. Hybridization selection and translation
`was used to identify an E cDNA clone. In this procedure, plas-
`mids from bacterial clones were bound to nitrocellulose filters
`and hybridized to total polyadenylylated RNA from IgE hybri-
`doma cells; the hybridized mRNA then was eluted and trans-
`lated in vitro and the products were analyzed by gel electro-
`phoresis. The presence of a polypeptide comigrating with
`previously identified in vitro-synthesized E chain indicated the
`presence ofan E cDNA clone. Immunoprecipitation ofthe poly-
`peptide so obtained with RAME antibodies definitively estab-
`lished the identity of the E cDNA clones.
`To screen many clones in one assay, six pools of five clones
`each were screened first and one pool was found to be positive.
`Clones from this pool then were subjected individually to the
`same analysis and one bonafude E cDNA clone was finally iden-
`tified. As demonstrated in Fig. 2, DNA from this clone hy-
`bridized to a mRNA that could be translated to a polypeptide
`(lane d) with a mobility on the gel equal to unprocessed E chain
`(lane g). Furthermore, the translated polypeptide was precip-
`itated by RAME antibodies (lane h) and not by antibodies to
`mouse IgG (not shown). Polypeptides translated from mRNA
`hybridized with two other irrelevant clones (lanes e and f) were
`not precipitated by RAME (lanes i and j, respectively), dem-
`onstrating the specificity of the immunoprecipitation reactions.
`The E cDNA insert was excised from the plasmid by Pst I
`digestion and was used as a probe to hybridize with colonies of
`all 300 clones. Twenty clones hybridized strongly and were ana-
`lyzed further. Pst I-digested plasmids obtained from these
`clones were analyzed on 1% agarose gels. Most of these clones
`yielded a single insert fragment with a size of 800-900 base
`pairs. One clone gave two fragments with sizes of ca. 900 and
`400 base pairs. This clone (C230) was selected for further anal-
`ysis.
`Nucleotide Sequence of the Cloned e cDNA. The nucleotide
`sequence of the E cDNA C230 was determined and a sequence
`of 1,279 nucleotides was established as shown in Fig. 3. A sin-
`gle, long open reading frame was found and the amino acid se-
`quence predicted from the nucleotide sequence is very ho-
`mologous to the kmown human 6 chain sequence (7) with which
`it is compared in Fig. 3. The mouse E chain that was subjected
`to sequence analysis apparently includes about half of the Cj1
`
`Merck Ex. 1057, pg 1417
`
`

`
`7854
`
`Immunology: Liu et al.
`f
`e
`a
`c
`b
`d
`
`g
`
`h
`
`93 -
`69-
`
`30 -
`
`mo
`
`*_
`
`-'E!
`
`_0 K
`
`FIG. 2.
`Identification of an e cDNA clone. Fluorograph of [355]-
`methionine-labeled polypeptides synthesized by in vitro translation of
`mRNA and electrophoresed on 10% polyacrylamide gels. In the hy-
`bridization-selection-translation procedure, plasmid DNA was bound
`to nitrocellulose filters and hybridized to total polyadenylylated RNA
`from the IgE hybridoma cells essentially as described (14). After ex-
`tensive washing of the filters, the bound RNA was eluted as described
`(14) and then translated. Lanes: a, no added mRNA; b, total translation
`products of crude polyadenylylated RNA from IgE hybridoma cells; c-
`f, translation products from mRNAs hybrid-selected by recombinant
`plasmids (lane c, background control; lanes d-f, each with recombinant
`plasmid from one clone); g, h, i, andj, RAME-Sepharose 4B immuno-
`precipitated translation products from lanes b, d, e, and f, respectively.
`The positions of the
`chain
`and thelight chain (K) are indicated.
`Molecular weights are shown as Mr x 10-.
`
`domain (residues 164-224) and the complete C62 (residues 225-
`330), C,3 (residues 331-437), and C,4 (residues 438-547) do-
`mains. The boundary demarcation of each domain was guided
`by comparison with the known junctional sequences of mouse
`ti chain (18), which has a significant homology with E chain. The
`cloned cDNA C230 also contains 93 nucleotides of 3' untrans-
`lated region, which is comparable in length to that of mouse 'Yi
`and Y2b mRNA (19, 20) and a poly(A) tail (19 nucleotides). The
`typical A-A-T-A-A-A sequence is found 14-19 bases before the
`poly(A) addition site.
`
`DISCUSSION
`The present study describes the isolation and structural char-
`acterization of a bacterial clone containing a DNA sequence
`corresponding toE mRNA. The identification of this clone was
`based on its hybridization to a mRNA species that, when trans-
`lated in vitro, directs the synthesis of a polypeptide with a
`mobility on NaDodSO4/polyacrylamide gels of unprocessed E
`chain and that is reactive with anti-mouse IgE antibodies.
`A significant homology exists between the amino acid se-
`quence of mouseE chain (determined from the nucleotide se-
`quence) and humanE chain. Homologies of 36%, 47%, and 51%
`between C62, CE3 and CE4 domains, respectively, were found.
`However, these values are significantly lower than those be-
`tween constant region domains of mouse and human
`(21), y
`(22), or a (23) chains. This is especially true of the COOH-ter-
`minal domains where homology of 78% was found between
`mouse and human A (21) and a (23) chains. A number of gaps
`placed in the mouse and humanE
`sequences to maintain the
`homology alignment also may indicate extensive divergence.
`It is interesting to note that the gradient of homology from the
`NH2-terminal to the COOH-terminal region as found for CA also
`is apparent in CE-that is, the COOH-terminal portion of the
`constant region appears more conserved than the NH2-terminal
`portion, perhaps relating to the stronger selective constraints
`on the more COOH-terminal domains. This might be expected
`because the C63 and CE4 domains have been implicated in the
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`binding of IgE to the Fe receptors on mast cells and basophils
`(7).
`Both the amino acids tryptophan and cysteine are believed
`to be important for maintaining the domain structure of im-
`munoglobulins. Similar to other classes of immunoglobulins
`(21, 24), both of these residues are highly conserved in the E
`chain. Of the nine tryptophan residues identified in the mouse
`E chain, seven are conserved in the human counterpart. Sim-
`ilarly, all cysteine residues known to be involved in the CE2,
`CE3, and C.4 intradomain disulfide bonds as well as the two
`involved in interheavy chain disulfide bridges are conserved
`(7). One extra cysteine residue is present in the C82 domain of
`the mouse chain. Whether there is an additional interheavy
`chain disulfide bridge in mouse IgE has yet to be determined.
`Potential carbohydrate (CHO) attachment sites were re-
`vealed from the amino acid sequence. Six CHO attachment sites
`have been identified in the human E chain and five of these are
`in the region where the mouse E chain sequence has been de-
`termined in this study (7). The sequence Asn-X-Ser/Thr is
`found in identical positions in both the human and mouse E
`chains at amino acid residues 173, 371, and 394. The sequence
`Asn-Glu-Ser is found in the mouse E chain at amino acid residue
`217 (see Fig. 3), which is near a CHO attachment site in the
`human E chain (amino acid residue 219). Although the precise
`position varies between species, it appears that a glycosylation
`site in this region is biologically significant.
`The amino acid sequence determined from the nucleotide
`sequence of the mouse E chain has six additional amino acids
`at its COOH terminus as compared to the human E chain. In-
`terestingly, this COOH-terminal sequence is homologous to
`part of the COOH-terminal segment of the mouse u chain (21)
`(Fig. 4). In particular, a potential CHO attachment site is pres-
`ent corresponding to the CHO attachment site already identi-
`fied on the g chain. Mouse C. genes code for a COOH-terminal
`lysine that is apparently removed proteolytically after transla-
`tion (19, 20). Whether the mouse E COOH-terminal sequence
`also is removed post-translationally and the significance of this
`segment remain to be determined. Furthermore, a potential
`RNA splicing site, T-G/G-T-A-A-C, is present at the junction
`of the CE4 domain and the COOH-terminal segment. This site
`may permit the C,4 coding region to be associated with a se-
`quence coding for a membrane-bound form of the E chain, as
`already demonstrated for,u
`and8 chains (25, 26).
`The nucleotide sequence determined in this study is com-
`pletely identical to that reported by Nishida et al
`(6) for cloned
`genomicE DNA at the first 194 nucleotides of their sequence.
`The remaining 23 nucleotides of their sequence can be aligned
`with ours (762-794) if gaps are introduced into their sequence.
`It also should be mentioned that, while this manuscript was in
`preparation, a ratE cDNA clone was reported and the nucleo-
`tide sequence for the C83 domain of rat IgE was described (27).
`In the region where a sequence difference was found between
`our studies and those of Nishida et al
`(6), there are only two
`base differences (G- C and T--C) at nucleotide numbers 772
`and 774, respectively (Fig. 3), between mouse and ratE cDNA,
`resulting in an amino acid change of Asp--His.
`The clonedE cDNA will surely be a useful probe for studying
`regulation of 6 gene expression. A natural extension ofthis study
`would be the expression in bacteria of restriction fragments of
`the e cDNA corresponding to various regions of theE chain or
`the chemical synthesis of relevant regions. Identification of
`expression products or synthetic peptides with binding activity
`to mast cells would allow us to establish the peptide sequence
`in thee chain that is involved in thebinding to Fc receptors and,
`perhaps in the future, to artificially modulate immediate hy-
`persensitivity reactions.
`
`Merck Ex. 1057, pg 1418
`
`

`
`Immunology: Liu et al.
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`7855
`
`80
`60
`40
`20
`(G15)ACTGTGACCTGGTATTCAGACTCCCTGMCATGAGCACTGTGAACTTCCCTGCCCTCGGTTCTGAACTCMGGTCACCACCAGCCAAGTGACCAGCTGGG
`Q V jTS W
`F
`L NM SJT
`TTVT W Y SD S
`V
`N
`P A
`G SE L
`TT
`K
`V
`Mouse E
`MIV T WL DN T G IS
`LIJV S
`NJGT
`TLjJ G
`H
`A W I [jiL
`T
`A
`T
`P
`L
`L
`Human e
`Y
`170
`180
`190
`GCAAGTCAGCCAAGAACTTCACATGCCACGTGACACATCCTCCATCATTCAACGAAAGTAGGACTATCCTAGTTCGACCTGTCAACATCACTGAGCCCAC
`G
`K S A
`SF N
`F T C H VT H
`E S
`P
`R TI L
`R
`V N
`P
`I nE
`N
`T
`P IPLTl
`S [S
`K QMF T Cl
`T
`ST V
`N
`A
`T
`K
`W A
`R
`F
`F [
`C
`S
`R
`A
`D
`220
`210
`200
`230
`
`T
`
`LL
`
`Mouse E
`Human E
`
`Mouse E
`Human E
`
`Mouse E
`Human E
`
`Mouse e
`Human c
`
`CTTGGAGCTACTCCATTCATCCTGCGACCCCMATGCATTCCACTCCACCATCCAGCTGTACTGCTTCATTTATGGCCACATCCTMMATGATGTCTCTGTC
`F
`C
`G
`V
`V
`S
`N
`L
`I
`H
`I
`F
`L
`D
`Q
`Y
`I
`Y
`S
`T
`C
`A
`E L|
`H
`S
`D
`S
`P
`N
`L
`H
`PPT I E] [J L
`EJ
`V K I
`G
`H
`F
`Y
`V S
`T
`P G T I
`C
`S
`S
`L
`N
`I
`260
`240
`250
`AGCTGGCTMATGGACGATCGGGAGATMACTGATACACTTGCACMAACTGTTCTAATCMAGGAGGMAGGCAMACTAGCCTCTACCTGCAGTAAACTCMACA
`S W LM D DR EI T
`C SK L
`Q TV L
`L A
`T
`I K E
`E
`K
`L A S T
`N
`T
`DN- G[E V
`E
`W
`L
`T
`L
`M [
`V
`S T
`E
`S
`A
`A
`S T E
`Q
`Q
`E
`S
`L
`D
`S
`T
`290
`280
`270
`TCACTGAGCAGCAATGGATGTCTGAAAGCACCTTCACCTGCMAGGTCACCTCCCMAGGCGTAGACTATTTGGCCCACACTCGGAGATGCCCAGATCATGA
`K V S
`Q
`I T E
`S
`M
`T
`E
`F
`C
`L A
`G
`V
`D
`H
`R
`P
`R
`Q
`Y
`E
`H
`C
`G H
`H LT Cl Q |V TVYI
`K LC A
`Q DS ] K
`Q
`S
`L
`K
`F
`T
`S N
`300
`320
`310
`
`330
`
`100
`
`200
`
`300
`
`400
`
`500
`
`Cel
`
`CE2
`
`Mouse e
`Human e
`
`Mouse c
`Human e
`
`Mousee
`Human e
`
`Mousee
`HumanE
`
`Mouse c
`HumanE
`
`Mouse E
`Human E
`
`Mouse e
`Human e
`
`L
`
`S
`
`I
`
`600
`
`700
`
`CE3
`
`800
`
`900
`
`1000
`
`1100
`
`C 4C
`
`GCCACGGGGTGTGATTACCTACCTGATCCCACCCAGCCCCCTGGACCTGTATCAAAACGGTGCTCCCMAGCTTACCTGTCTGGTGGTGGACCTGGAAAGC
`T
`K
`L
`A
`N
`G
`Y
`Q
`D
`L
`C
`L
`V
`V
`L
`E
`T
`G V I
`P
`R
`P
`S
`I
`P
`P
`LIA PS
`LI F
`PI F D
`R IP
`A IY* S
`S L] T
`I
`V
`S
`R
`K
`I
`T C
`L
`V
`V
`D
`S
`G
`P
`R
`360
`340
`350
`GAGMGAATGTCAATGTGACGTGGAACCAAGAGAAGAAGACTTCAGTCTCAGCATCCCAGTGGTACACTAAGCACCACAATAACGCCACAACTAGTATCA
`N FVNl V
`I
`S
`E
`Q
`K
`A
`A
`S
`Q
`S
`T
`W
`Y
`E
`T
`K
`T
`K
`H
`H
`K
`N
`N
`T
`'G
`G
`L
`K
`A
`S
`Q
`R
`S
`G
`K
`P
`T
`N
`H
`E
`E
`R
`K
`K
`T
`R
`V
`370
`390
`380
`CCTCCATCCTGCCTGTAGTTGCCMAGGACTGGATTGAAGGCTACGGCTATCAGTGCATAGTGGACCACCCTGATTTTCCCMAGCCCATTGTGCGTTCCAT
`I VO
`DOF P
`V
`A
`E
`V
`G
`K
`G
`C
`I
`K
`P
`V
`R
`Q
`I
`P
`L
`Y
`Y
`I
`Q cl
`G E
`T
`R
`T
`H
`L
`R
`A
`L
`T
`M R
`T
`V G
`E
`Y
`T
`R D W
`P
`L
`400
`410
`430
`420
`CACCMAGACCCCAGGCCAGCGCTCAGCCCCCGAGGTATATGTGTTCCCACCACCAGAGGAGGAGAGCGAGGACAMACGCACACTCACCTGTTTGATCCAG
`[TK T
`G
`R
`F
`ED K
`T
`C
`V
`L
`P
`Q
`A
`P
`T
`Q
`E
`L
`R
`S
`E
`P
`P E E
`P
`Y V
`EI W P G1
`T [P
`P[LJ A
`|T
`K T S 1
`P
`E
`V Y A
`A
`A
`R D K
`F
`R
`T
`L
`A
`C
`L
`Q
`440
`460
`450
`AACTTCTTCCCTGAGGATATCTCTGTGCAGTGGCTGGGGGATGGCAAACTGATCTCMMACAGCCAGCACAGTACCACMACACCCCTGAAATCCMATGGCT
`L KS Njm
`F
`N S Q
`F
`Q
`E
`S
`D
`I
`V
`P
`T
`W
`T
`T
`G
`G
`H
`S
`L
`D
`K
`S
`L
`I
`Q
`L
`W
`S
`V
`H
`N
`E
`V
`Q
`L
`P
`D
`D
`I
`E
`A
`R H S T
`T
`Q
`N F M
`T
`K
`K §
`P
`R
`480
`490
`500
`470
`CCMATCMGGCTTCTTCATCTTCAGTCGCCTAGAGGTCGCCMAGACACTCTGGACACAGAGMMACAGTTCACCTGCCMAGTGATCCATGAGGCACTTCA
`Q V I H E A L Q
`Q
`K
`T
`Q
`R
`K
`Q
`T
`G FF I
`N
`V A
`E
`F
`T
`S
`L
`R
`L
`S
`FI V
`I
`E V T RAE [E
`F
`S R
`L
`F
`Q
`E
`K
`E
`I
`R
`A
`V H E
`A
`A
`F
`S
`D
`510
`520
`530
`GAAACCCAGGAAACTGGAGAAAACAATATCCACAAGCCTTGGTAACACCTCCCTCCGTCCCTCCTAGGCCTCCATGTAGCTGTGGTGGGGMGGTGGATG 1200
`I
`K P R K L E
`T
`T S
`L
`K
`N T S L R P S
`P g K
`V Lj V
`S Q
`Q
`A
`P
`T V
`R
`N
`540
`ACAGACATCCGCTCACTGTTGTAACACCAGGMGCTACCCCAATAAACACTCAGTGCCTGAl9 (C18)
`Complete nucleotide sequence of cloned E cDNA (C230). The entire cDNA insert was subjected to sequence analysis on both strands with
`FIG. 3.
`the exception of a segment (nucleotides 1,229-1,260) that was subjected to sequence analysis on only one strand; 99.8% was subjected to sequence
`analysis more than once on one or both strands. The coding strand is inserted in the opposite orientation as the ampicillin resistance gene of pBR322
`(17). The nucleotide sequence of the strand corresponding to the mRNA is displayed 5' to 3'. The amino acids predicated from the nucleotide sequence
`are presented below the coding sequence. The amino acid sequence of human E chain is shown below the mouse £chain sequence. Boxes around
`the amino acid residues indicate identity between two sequences. Numbers below the amino acid residues refer to human Echain (7). Protein domains
`are approximately demarcated in the right margin. Amino acids are expressed by a one-letter code as follows: A, alanine; C, cysteine; D, aspartic
`acid; E, glutamic acid; F, phenylalanine; G, glycine; H, histidine; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q,
`glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine.
`
`Merck Ex. 1057, pg 1419
`
`

`
`7856
`
`Immunology: Liu et al.
`
`CH4
`
`C-terminal
`
`CHO
`
`Mouse p
`Mouser
`
`D KHT K P T L YNI V[LI M[D T G G T C Y
`
`T
`STL[LJ
`
`T[
`
`R P
`
`FIG. 4. The COOH-terminal (C-terminal) sequences of mouse ,u
`and E chains. A gap is placed in the e chain sequence for a maximal
`homology with the ,u chain. Homologous sequences are boxed.
`
`We thank Dr. Robert Milner for help on the cloning procedures, Dr.
`Michael Wilson, Dr. Hans Spiegelberg, and Mary Ann Brow for helpful
`discussions, Dr. Ian Kennedy for critically reading the manuscript, Phil
`Van Hook for technical assistance, and Beverly Burgess for preparing
`the manuscript. This work was supported by National Institutes of
`Health Grant AI 19476. F.-T.L. is a Scholar of the Leukemia Society
`of America. This is publication no. 3 from the Medical Biology Institute,
`La Jolla, CA, and publication no. 2724 from the Research Institute of
`Scripps Clinic, La Jolla, CA.
`
`1.
`
`2.
`
`3.
`
`4.
`
`5.
`
`6.
`
`7.
`
`Ishizaka, K., Ishizaka, T. & Hornbrook, M. M. (1966)J. Immu-
`nol 97, 840-853.
`Bach, M., ed. (1978) Immediate Hypersensitivity (Dekker, New
`York).
`Capron, A., Dessaint, J. P. & Capron, M. (1980)J. Allergy Clin.
`Immunol. 66, 91-96.
`Katz, D. H. (1982) in Progress in Allergy, ed. Ishizaka, K. (Kar-
`ger, Basel, Switzerland), Vol. 32, p. 105.
`Shimizu, A., Takahashi, N., Yamawaki-Kataoka, Y., Nishida, Y.,
`Kataoka, T. & Honjo, T. (1981) Nature (London) 289, 149-153.
`Nishida, Y., Kataoka, T., Ishida, N., Nakai, S., Kishimoto, T.,
`Bottcher, I. & Honjo, T. (1981) Proc. Natl Acad. Sci. USA 78,
`1581-1585.
`Dorrington, K. J. & Bennich, H. H. (1978) Immunol. Rev. 41, 3-
`25.
`
`Proc. Nati. Acad. Sci. USA 79 (1982)
`
`8.
`
`9.
`
`10.
`11.
`
`12.
`13.
`
`14.
`
`15.
`16.
`
`17.
`
`18.
`
`19.
`
`20.
`
`21.
`
`22.
`23.
`
`24.
`
`25.
`
`26.
`
`27.
`
`Liu, F.-T., Bohn, J. W., Ferry, E. L., Yamamoto, H., Molinaro,
`C. A., Sherman, L., Klinman, N. R. & Katz, D. H. (1980)J. Im-
`munol 124, 2728-2737.
`Marcu, K. B., Valbuena, 0. & Perry, R. P. (1978) Biochemistry
`17, 1723-1733.
`Laemmli, U. K. (1970) Nature (London) 227, 680-689.
`Gough, N. M., Webb, E. A., Cory, S. & Adams, J. M. (1980)
`Biochemistry 19, 2702-2710.
`Tanaka, T. & WeisbIum, B. (1975)J. Bacteriol. 121, 354-362.
`Grunstein, M. & Hogness, D. S. (1975) Proc. Natl Acad. Sci. USA
`72, 3961-3965.
`Parnes, J. R., Velan, B., Felsenfeld, A., Ramanathan, L., Fer-
`rini, U., Appella, E. & Seidman, J. G. (1981) Proc. Nati Acad.
`Sci. USA 78, 2253-2257.
`Maxam, A. & Gilbert, W. (1980) Methods Enzymol 65, 499-560.
`Scheele, G., Dobberstein, B. & Blobel, G. (1978) Eur. J. Bio-
`chem. 82, 593-599.
`Sutcliffe, J. G. (1979) Cold Spring Harbor Symp. Quant. Biol. 43,
`77-90.
`Kawakami, T., Takahashi, N. & Honjo, T. (1980) Nucleic Acids
`Res. 8, 3933-3945.
`Honjo, T., Obata, M., Yamawaki-Kataoka, Y., Kataoka, T., Ka-
`wakami, T., Takahashi, N. & Mano, Y. (1979) Cell 18, 559-568.
`Tucker, P. W., Marcu, K. B., Newell, N., Richards, J. & Blatt-
`ner, F. R. (1979) Science 206, 1303-1306.
`Kehry, M., Sibley, C., Fuhrman, J., Schilling, J. & Hood, L. E.
`(1979) Proc. Natl Acad. Sci. USA 76, 2932-2936.
`Adetugbo, K. (1978) J. Biol. Chem. 253, 6068-6075.
`Robinson, E. A. & Appella, E. (1980) Proc. Natl Acad. Sci. USA
`77, 4909-4913.
`Lin, L.-C. & Putnam, F. W. (1981) Proc. Natl Acad. Sci. USA 78,
`504-508.
`Rogers, J., Early, P., Carter, C., Calame, K., Bond, M., Hood,
`L. & Wall, R. (1980) Cell 20, 303-312.
`Tucker, P. W., Liu, C.-P., Mushinski, J. F. & Blattner, F. R.
`(1980) Science 209, 1353-1360.
`Hellman, L., Pettersson, U. & Bennich, H. (1982) Proc. Natl.
`Acad. Sci. USA 79, 1264-1268.
`
`Merck Ex. 1057, pg 1420