Proc. Natl. Acad. Sci. USA
`Vol. 77, No. 10, pp. 6027-6031, October 1980
`Genetics
`
`Cloning and partial nucleotide sequence of human immunoglobulin
`,t chain cDNA from B cells and mouse-human hybridomas
`(immunoglobulin mRNAs/in vitro translation/immunoglobulin secretion)
`THOMAS W. DOLBY, JOANNA DEVUONO, AND CARLO M. CROCE
`The Wistar Institute of Anatomy and Biology, Philadelphia, Pennsylvania 19104
`Communicated by Hilary Koprowski, June 16,1980
`
`Purified mRNAs coding for # and K human
`ABSTRACT
`immunoglobulin polypeptides were translated in vitro and their
`products were characterized. The p-specific mRNAs, derived
`from both human lymphoblastoid cells (GM607) and from a
`mouse-human somatic cell hybrid secreting human p chains
`(aD5-DH11-BC11), were copied into cDNAs and inserted into
`the plasmid pBR322. Several recombinant cDNAs that were
`obtained were identified by a combination of colony hybrid-
`ization with labeled probes, in vitro translation of plasmid-
`selected p mRNAs, and DNA nucleotide sequence determina-
`tion. One recombinant DNA, for which the sequence has been
`partially determined, contains the codons for part of the C3
`constant region domain through the carboxy-terminal piece (155
`amino acids total) as well as the entire 3' noncoding sequence
`up to the poly(A) site of the human p mRNA. The sequence A-
`A-U-A-A occurs 12 nucleotides prior to the poly(A) addition site
`in the human p mRNA. Considerable sequence homology is
`observed in the mouse and human p mRNA 3' coding and non-
`coding sequences.
`Surface monomeric IgM immunoglobulins consist of two heavy
`chain (,u) and two light chain (K or less frequently X) polypep-
`tides covalently crosslinked by disulfide bonds (1, 2). Circulating
`secreted IgM molecules are usually pentamers of the mono-
`meric form, which are held together by a small J protein (3).
`Based on their primary structure, u chains isolated from se-
`creted IgM have been subdivided into an NH2-terminal vari-
`able (V) region, four constant (C) region domains (C1, C2, C3,
`and C4), and a COOH-terminal sequence of 19 amino acids
`ending in tyrosine (4, 5).
`A great deal of information has accumulated recently con-
`cerning the organization and expression of mouse immuno-
`globulin genes by using homogeneous probes obtained through
`the application of recombinant DNA technology. Virtually
`nothing of this nature has been reported for the human im-
`munoglobulin gene system other than some early attempts at
`purification and in vitro translation of the ,u and X chain
`mRNAs (6, 7).
`Part of the difficulty in cloning human immunoglobulin
`mRNAs has been due to the relatively low abundance of these
`mRNAs [0.5-1% of poly(A)+RNA (unpublished data) compared
`to several mouse plasmacytomas (6-7% of total poly(A)+RNA)]
`(ref. 8; unpublished data). Although we have been successful
`in purifying mRNAs coding for ,u, 72, a2, K, and X polypeptides
`(unpublished data) from various human lymphoblastoid and
`myeloma cell lines, only a small amount of highly enriched
`mRNAs coding for these polypeptides has been obtained.
`During our phenotypic chromosome mapping studies of the
`genes coding for human heavy (H) chain (9) and light (L) chains
`
`The publication costs of this article were defrayed in part by page
`charge payment. This article must therefore be hereby marked "ad-
`vertisement" in accordance with 18 U. S. C. §1734 solely to indicate
`this fact.
`
`by using mouse-human B cell hybridomas, we observed that
`many of our hybrid cells synthesized and secreted more human
`H or L chain polypeptides than did their human parental B
`cells. We took advantage of the apparent biological enrichment
`of the human H and L chain mRNAs in these somatic cell hy-
`brids to facilitate purification of mRNAs for molecular
`cloning.
`We report in this paper the properties of the human A and
`K mRNAs and their in vivo and in vitro directed polypeptide
`products. We also describe the methods used to obtain and
`characterize recombinant plasmids containing human ,u se-
`quences from both human B cells and mouse P3x63Ag8-normal
`human peripheral lymphocyte hybridomas. We also make some
`comparisons between the human and mouse 3' coding and
`noncoding nucleotides in their ,u mRNAs.
`MATERIALS AND METHODS
`Cell Lines and Hybrid Production. Human lymphoblastoid
`(GM607, GM1056, GM923) or myeloma (GM1500) cells were
`obtained from the Human Genetic Mutant Cell Repository
`(Camden, NJ). SED cells were obtained from Shu Man Fu (The
`Rockefeller University); these cells were maintained in
`RPMI-1640 supplemented with 10% fetal calf serum under
`standard conditions. Normal human peripheral blood lym-
`phocytes were obtained from healthy donors. All somatic cell
`hybrids were produced (9) with mouse BALB/c P3x63Ag8 cells
`deficient inyhypoxanthine phosphoribosyl transferase derived
`from the MOPC 21 plasmacytoma that secretes IgGl K (10, 11)
`or the nonsecreting subline (12). Hybrid cells were selected,
`maintained, and characterized as to their human isotype se-
`cretion (H and L chains) as described (9) and as indicated in the
`legend of Table 1.
`Purification of H and L mRNAs. Minimally degraded H
`and L chain mRNAs were prepared from all B-cell lines and
`hybrids by the following method. Pelleted cells were lysed for
`10 min in 5 vol of cold 50 mM Tris-HCl, pH 7.4/25 mM NaCl/5
`mM magnesium acetate/10 mM 2-mercaptoethanol/30%
`(wt/vol) sucrose containing polyvinyl sulfate at 20 ,ug/ml and
`0.8% Nonidet P-40, followed by centrifugation at 15,000 X g
`for 15 min at 1°C to remove nuclei and mitochondria. The
`supernatant was adjusted to 1.5% NaDodSO4 and immediately
`an equal volume of redistilled phenol/chloroform/isoamyl
`alcohol, 1:1:0.01 (vol/vol), saturated with 10 mM Tris-HCI, pH
`7.4/1 mM EDTA/0.1 M NaCI/1.5% NaDodSO4 was added.
`The solution was mixed for 10 min and centrifuged at 10,000
`X g for 15 min at 20°C. The aqueous phase was precipitated
`with 3 vol of ethanol at -200C after three extractions. The total
`
`Abbreviations: V, variable; C, constant; H, heavy; L, light; dsDNA,
`double-stranded DNA; NaCI/Cit, standard saline citrate (0.15 M
`NaCI/0.015 M sodium citrate, pH 7); ssDNA, single-stranded DNA.
`
`6027
`
`Merck Ex. 1056, pg 1411
`
`

`
`6028
`
`Genetics: Dolby et al.
`
`- -4
`
`-
`
`r
`
`p_
`
`8
`
`9 lO
`
`12 13
`
`14 15
`
`mm-
`
`IL
`
`I!
`
`I
`
`4.
`
`-K
`-K
`
`I
`
`*4
`
`Proc. Natl. Acad. Sci. USA 77 (1980)
`
`34
`
`_
`
`II
`
`.....4
`
`to
`
`at"In .....
`
`An..I
`
`......
`
`Autoradiogram of [35S]methionine-labeled proteins from
`FIG. 1.
`in vitro translation with GM607 mRNAs as resolved on one-dimen-
`sion reducing NaDodSO4/polyacrylamide gels. Lanes: 1 and 2, total
`in vivo labeled (16 hr) cellular protein of GM607; 3, control in vitro
`translation (no RNA); 4, labeled products, total polyadenylylated
`mRNA; 5, immunoprecipitate of lane 7 translation with human a
`antisera; 6, immunoprecipitate of lane 7 translation with human ji
`antisera; 7, in vitro translation of three-times sucrose gradient-pu-
`rified 20S human A mRNA from GM607; 8, immunoprecipitate oflane
`7 translation with human y antiserum; 9, immunoprecipitate of
`GM607 cell medium with human K antiserum; 10, in vitro translation
`of three-times sucrose gradient-purified human K mRNA; 11, im-
`munoprecipitate of lane 10 translation with human K antiserum; 12,
`immunoprecipitate of lane 10 translation with human X antiserum;
`13, immunoprecipitate of labeled GM607 cell medium with normal
`rabbit serum; 14, immunoprecipitate of labeled GM607 cell medium
`with human X- and a-specific antisera; 15, labeled GM607 cell me-
`dium immunoprecipitated with human u antiserum. The positions
`of the in vivo synthesized and secreted As and K and their in vitro
`synthesized A' and K' products are indicated.
`
`cytoplasmic RNA was subjected to two rounds of oligo(dT)-
`cellulose chromatography with heating at 700C for 5 min prior
`to the second round (13). The polyadenylylated RNA was then
`fractionated by neutral 5-25% sucrose gradient centrifugation
`(8). Gradient fractions enriched in H and L chain mRNAs based
`on in vitro translation criteria (14) and immunoprecipitation
`(9) were centrifuged repeatedly until in vitro translation in-
`dicated substantial purification.
`Synthesis of Double-Stranded (ds) cDNA. Two to 3sg of
`human , poly(A)+mRNA from GM607 or a somatic cell hybrid
`aD5-DH11-BC11 was primed with oligo(dT) (P. L. Bio-
`chemicals) at 50 ug/ml and subjected to reverse transcription
`essentially as described (15), with 900-1500 units of avian
`myeloblastosis virus reverse transcriptase (obtained from J.
`Beard, St. Petersburg, FL) per ml. Second-strand synthesis was
`carried out as described (15) except that Escherichia coli DNA
`polymerase I (Boehringer Mannheim, grade I) at 150 units/ml,
`additional dNTPs (to 1 mM), and 10 mM MgCl2 were found
`necessary to promote about 60-70% synthesis of the second
`strand. The dscDNA was extracted with chloroform and
`chromatographed on Sephadex 0-100 in 20 mM NaCl/25 mM
`EDTA; void fractions were pooled and precipitated with 3 vol
`of ethanol.
`The dscDNA was trimmed to blunt ends with S1 nuclease
`(Miles) at 100 units/ml as described (16), extracted, rechro-
`matographed on Sephadex 0-100, and precipitated. Homo-
`polymeric tracts of dC were added to the 3' ends of the dscDNA
`or dG tracts were added to the cloning vector pBR322 at its Pst
`I site according to the conditions described (17).
`
`Autoradiogram of [35S]methionine-labeled proteins
`FIG. 2.
`synthesized with mRNAs isolated from mouse P3x63Ag8-human B
`somatic cell hybrids secreting human g chains and separated on
`polyacrylamide gel. Lanes: 1, total in vivo labeled cellular protein of
`aD5-BH11-BC11; 2, immunoprecipitate of lane 3 in vitro translation
`with human g antiserum; 3, in vitro translation of three-times sucrose
`gradient-purified human u mRNA from 57-55-F7 somatic cell hybrid;
`4, immunoprecipitate of lane 5 translation with human IA antiserum;
`5, in vitro translation of three-times sucrose gradient-purified human
`IA mRNA from aD5-BH11-BC11; 6, in vitro products of total mRNA
`from aD5-DH11-BC11; 7, in vitro products of total mRNA from
`57-55-F7; 8, immunoprecipitate of intracellular proteins of
`aD5-DH11-BC11 with human ,u and mouse y and K antisera; 9, in
`vitro translation of mouse P3 K mRNA (13S); 10, immunoprecipitate
`of lane 9 translation with mouse K antiserum; 11, as in 10 with human
`K antiserum; 12, as in 10 with human X antiserum; 13, aD5-
`DH11-BC11 cell medium immunoprecipitate with mouse ,u antiserum;
`14, aD5-DH11-BC11 cell medium immunoprecipitate with human
`,g antiserum. The positions of human g polypeptides synthesized in
`vivo and in vitro (j') and the positions of mouse K polypeptides in vivo
`and in vitro (K') are indicated.
`
`Bacterial Transformation. The hybridized recombinant
`plasmids (18) were used to transform E. coli X1776 (under
`P2-EK2 conditions as required under earlier National Institutes
`of Health guidelines) as described (18, 19). About 50 recom-
`binants were obtained per ng of cDNA. Bacteria were selected
`on Luria agar plates containing 15 ,g of tetracycline per ml
`(18), and all tetracycline-resistant bacteria were picked and
`ordered on gridded 8.5-cm Luria agar plates containing 15 ug
`of tetracycline per ml.
`Screening of Recombinant Bacteria. Recombinant bacteria
`were felt-lifted and transferred to replica plates (containing
`8.3-cm Whatman 541 paper on the surface of Luria agar plates
`supplemented with tetracycline at 15 gg/ml). Filters were
`processed for hybridization essentially as described by Sippel
`et al. (20). Between 30 and 50 filters (2100-3500 colonies) were
`prehybridized for 16 hr at 370C in a mixture of 4X standard
`saline citrate (Nadl/Cit), 44% (vol/vol) formamide, 0.5% Na-
`DOdS04, and Denhardt's solution (21) containing 200,Mg of
`denatured E. coli DNA per ml. Hybridization with labeled
`probes was carried out in the same buffer, using 4-300 X 106
`cpm of probe for 30 hr. Human is-specific probes were pre-
`pared by 5'-32P end-labeled partially hydrolyzed mRNA (22),
`the synthesis of 32P-labeled single-stranded (ss) cDNA (23), and
`nick translation of dscDNA (24) inserts rescued by plasmid
`digestion with Pst I (Bethesda Research Laboratories, Rockville,
`MD) and isolated from 5% polyacrylamide gels (25) by the
`method of Maxam and Gilbert (26). After a wash with prehy-
`bridization buffer for 16 hr at 370C, the filters were washed
`
`Merck Ex. 1056, pg 1412
`
`

`
`Genetics: Dolby et al.
`
`Proc. Natl. Acad. Sci. USA 77 (1980)
`
`6029
`
`Table 1.
`
`Properties of human immunoglobulin mRNAs and their in vivo and in vitro synthesized polypeptides
`
`Mr X 10-3
`
`Hchain,
`Cell
`Source*
`Ig secretedt
`ng/106 cells/hr
`GM607
`Lymphoblastoid
`IgM K
`10
`SED
`Chronic lymphocytic leukemia
`IgM K + IgD K
`14
`GM1500
`Myeloma
`IgG2 K
`27
`Lymphoblastoid
`GM1056
`IgA2 X
`6
`GM923
`Lymphoblastoid
`IgAl X
`2
`A(IgG1 K)
`HPL-P3
`aD5-DH11-BC11
`58
`D3 D24.3
`HPL-P3
`g(IgG1 K)
`46
`us(IgGl K)
`57-77-F7
`HPL-P3
`32
`CSK-10-2B1-C14
`GM607-P3
`,u(IgG1 K)
`21
`CSK-NS6-201-C7
`GM607-NP3
`30
`A
`GM1500-P3
`106.2-B4-3G6
`'y2;(IgGl K)
`35
`GM1500-NP3
`FSK-4-2B2-C1
`Y2;K
`40
`24
`DSK-13-2A5-C8
`GM1056-P3
`a2;X(IgGl K)
`171
`24
`ai;X(IgG1 K)
`GM923-P3
`ESK-12-ID2-C3
`ND
`63
`P3x63Ag8
`Plasmacytoma
`(IgG1 K)
`0
`23
`-
`Nonsecreting P3
`NP3
`-
`-
`0
`Human Ig secreted and class identification were determined by NaDodSO4polyacrylamide gel analysis of cell medium class-specific immu-
`noprecipitates labeled with [35S]methionine (9), quantitative immunofluorescence, Ouchterlony precipitin rings with class-specific antisera,
`radioimmunoassays with class-specific reagents, and subclass Marchalonis assays. ND, not determined.
`* HPL, human peripheral lymphocytes.
`t Mouse Ig secreted is shown in parentheses.
`s2oR was determined in neutral 5-25% sucrose gradient of twice-purified oligo(dT)-cellulose polyadenylylated RNA relative to agarose gel-
`purified 4S and 18S rRNA.
`
`mRNA
`s20,R,* S
`Hchain
`Lchain
`H
`L
`In vivo In vitro In vivo In vitro chain chain
`77
`69
`20
`13
`24
`26.5
`69
`77
`13
`26.5
`20
`24
`49
`23
`25
`12
`50
`17
`60
`58
`13
`26.5
`18
`24
`ND
`ND
`ND ND
`60
`24
`-
`20
`77
`69
`-
`ND
`ND -
`77
`69
`20
`77
`-
`ND
`ND
`77
`ND
`ND
`77
`ND
`ND -
`50
`ND
`ND ND
`50
`60
`58
`13
`18
`ND
`ND ND
`60
`54;50
`57
`13
`17
`
`ND
`26.5
`ND
`25;26
`
`batchwise with 6X, 2X, 1x, and 0.5X NaCI/Cit, each con-
`taining 0.5% NaDodSOh for 2 hr each at 230C. The filters were
`autoradiographed with XRP film for 2-5 days at -200C. Re-
`combinant plasmids were isolated from 1-liter stationary phase
`cultures that were treated with chloramphenicol (44 ,g/ml)
`for 6 hr prior to standard CsCl/ethidium bromide banding (27).
`Hybrid Selection Translation. About 50 ,Ag of each re-
`combinant plasmid that was positive to s probes was covalently
`linked to 1-cm discs of diazobenzylmethoxy-paper as described
`(28). These filters were used with 0.5-1.2 mg of polyadenyl-
`ylated RNA isolated from GM607 cells for selective batchwise
`
`hybridization (28) to their complementary mRNAs. The
`mRNAs eluted from individual filters were coprecipitated with
`10 ,g of yeast tRNA and translated in vitro (14) in the presence
`of [a5S]methionine. The labeled polypeptides were resolved on
`11% reducing NaDodSO4/polyacrylamide gels, embedded, and
`autoradiographed (9).
`DNA sequence determination was carried out (26) by G,
`G+A, T+C, C, and A>C reactions with 5'-end-labeled Pst I-
`rescued inserts that were secondarily cleaved with Ava II, Hha
`I, Hpa II, or HinfI and separated on and eluted from gels (25,
`26) prior to base-specific chemical cleavage.
`
`0- N f)
`
`t XD -t0 O 0 - N n v to
`a3 O 0 - N
`0 r-
`NN-cN N N N N N N N N N n
`n
`
`__I
`
`_m
`
`K-
`K -/-
`
`1*.
`
`4_ w
`
`4S
`
`as, q
`4bd
`
`3a *
`
`_am Uabam
`ow
`
`- 94
`
`-68
`
`.-
`
`_0
`w w
`10 w.04'4
`
`-30
`
`24
`
`0
`Autoradiogram of [35S]methionine-labeled proteins synthesized in vitro with mRNAs hybrid-selected from total human B cell mRNA
`FIG. 3.
`by recombinant plasmid cDNAs. GM607 polyadenylylated RNA (1 mg) was hybridized with H and L recombinant plasmids linked to diazo-
`benzylmethoxy-paper and the products of in vitro translation directed by eluted mRNA were resolved on composite NaDodSO4polyacrylamide
`gels. Lanes: 7 and 29, endogenously labeled products of the reticulocyte lysate; 1 and 24, background translation products of mRNAs eluted
`from vector-linked filters (pBR322). The other lanes show the translation products ofmRNAs eluted from 28 independent recombinant filters:
`6, pTD-HK-(607:1-31); 12 and 30, pTD-HK-(607:8-14), plasmids that selectively hybridize human K mRNA; 9, pTD-Hju-(aD5:11-10); 10, pTD-
`Hu-(aD5:11-16); 23, pTD-H;&-(607:6-9) and 25, pTD-Hp-(607:7-12) all selectively hybridize human mRNA. Mr X 10-3 of standard proteins
`are sbown. ,A, Ai', K, and K', Positions of in vivo and in vitro synthesized polypeptides.
`
`-14
`-12
`
`Merck Ex. 1056, pg 1413
`
`

`
`6030
`
`Genetics: Dolby et al.
`
`Proc. Natl. Acad. Sci. USA 77 (1980)
`
`Residue
`Amino acid
`5,
`3,
`
`430
`440
`421
`GtyGtuAogPheTkCy6 ThtVatThAHZ6ThkA~pLeuPtoSeAPto LeuLys GtnTht
`GG(31)CCGGGGAGAGGTTCACCTGCACCGTGACCCACACAGACCTGCCCTCGCCACTGAAGCAGACC
`ACGTCC(31) GGCCCCTCTCCAAGTCCACGTGGCACTGGGTGTGTCTGGACGGGAGCGGTGACTTCGTCTGG
`
`460
`450
`I eSeAAMPg'to Ly4Gty~atta LeuHe-kg ftoAplatTyrtLeu Leu Rto ftoAtaAhgtGtn Le
`TACAGGGCCGGGCTTCCCC:(C(;(A('(,':CS(((''(A:''G((A:.;l((l(((G((lC;'(A
`
`480
`470
`AsnLeuAhgGtuSe'AtaThitl eeThtCy4s LeuVatTh4GtyPheSeAPto~taAspVaePheVaeGtnT1p
`AACCTCCCGGACTCGCCCACCATCACCTGCCTGGTCACGGGCTTCTCTCCCGCGGACGTCTTCGTGCAGTGC
`TTGCACGCCCTCACCCGCTGTACTCCACGCACCACTCCCCGAAGAGACCCCCCCTGCAGAACCACGTCACC
`
`509
`490
`500
`MevtGtnAtgGeyiGnPo LeuSeAPoGeu Ly6 TyAVatThISekAt-aP LoMetPkoGeuP'o
`ATCCAGCGCCGCCACCCCTTGTCCCCCCAGAACTATCTCACCACCCCCCCTATCCCGGAACCC-
`TACCTCGCCCCCCTCCGCAACACCCC('CTCTTCATACACTGGTCCCGGCCGATACGGCCTTGGG-
`
`576
`570
`560
`ThAhLejuTy4A, nVftSeALeu VatMetSetAApThvAtaGteThv'Cy Tq *
`ACCCTGTACAACCTGTCCCTGGTCATGTCAGACACACCTGCCACCTGCTACTGACCCTGCTGGCCTCCCCAC
`TGCGACATCTTCCACAGGCACCAGTACACTCTGTGTCCACCGTCGACGATCACTCGGACCACCGGACGGCTG
`
`AGGCTCGGGCGGCTGGCCGCTCTCTGTGTGCATGCAAACTAACCGTGTCAACGGGGTCGAGATGTTGCATCT
`TCCGAGCCCGCCGACCGGCGAGACACACACGTACGTTTGATTGGCACAGTTGCCCCAGCTCTACAACGTAGA
`
`3'
`
`5'
`3'
`
`5'
`3'
`
`5'
`3'
`
`5'
`3'
`
`t
`5'
`TATAAAATTAGAAATAAAAAGATCCATTCA (12)C (26)CTGCA
`3'
`ATATTTTAATCTTTATTTTTCTAGGTAAGT (12) G (26) G
`Partial nucleotide sequence of human p[pTD-HIA(aD5:11-16)]-cDNA insert rescued from a Pst I digestion ofthe recombinant plasmid
`FIG. 4.
`(26). Residue refers to amino acid residue from NH2 terminus of human OU (4). The nucleotide sequence between residues 510 and 559 is pending.
`*, Termination codon UGA; $, termination codon UAA; t, beginning of poly(A) tail. Sequences underlined are homologous sequences observed
`in the mouse ,u untranslated sequence (31, 32).
`
`RESULTS AND DISCUSSION
`Many of the somatic cell hybrids tested (Table 1) secreted sig-
`nificantly more human H chains than did their human parental
`B cells. This was observed with a number of hybridomas se-
`creting different clases or subclasses of human H chains (is, ac,
`a2, or Y2). Because hybridomas produced with the mouse
`P3x63Ag8 cell line or its nonsecreting subline (NP3) still showed
`an increased rate of secretion of human H chain compared to
`their human B-cell parents (Table 1, compare GM607, CSK-
`10-2B1-C14, and CSK-NS6-201-C7; GM1500, 106.2-B4-3G6,
`and FSK-4-2B2-C1), the coupling of a more rapid mouse im-
`munoglobulin L chain secretion with the human H chain
`cannot solely account for the increased secretion rate. These H
`chain-"hypersecreting" hybrids have enabled us to purify
`human H (and L) chain mRNAs in much greater yields than
`from an equivalent mass of any of the human B cell lines ex-
`amined. As can be seen in Table 1, the hybrid aD5-DH11-BC11
`secreted 4-6 times more human u chain than did the human
`B cell lines GM607 or SED. We recovered 6-7 times more gu
`mRNA sedimenting at 20S (per g of hybrid cells) than from
`GM607 or another IgM K-producing B cell line (SED) obtained
`from a patient with chronic lymphocytic leukemia (data not
`shown).
`Figs. 1 and 2 show autoradiograms of polyacrylamide gel
`separations of the labeled polypeptides synthesized with par-
`tially purified human , and K mRNAs as well as their in vivo
`synthesized and secreted polypeptides. The in vivo secreted u
`chain had a mobility, on reducing gels, corresponding to 77,000
`daltons, whereas its in vitro directed product migrated as 69,000
`daltons. We observed this in two human cell lines (GM607, Fig.
`1, lane 7; and SED, data not shown) and in two somatic cell
`hybrids (57-77-F7 and aD5-DH1I BCG1, Fig. 2, lanes 3 and
`5, respectively). Our observations are contrary to the report by
`Klukas et al. (7) that, in RPMI 1788 cells, the in vitro directed
`immunoprecipitated ,u polypeptide comigrated with the in vio
`
`secreted form. It is possible that RPMI 1788 secretes a nongly-
`cosylated ,u chain. In vitro translations of It mRNA with
`['4C]mannose instead of [asS]methionine showed no labeling
`of any polypeptides on polyacrylamide gel autoradiograms.
`These observations and the lack of functional endoplasmic
`reticulum and Golgi apparatus in reticulocyte lysates, combined
`with the known 10-12% carbohydrate component of human
`,u chains secreted in vivo (2) all are consistent with the absence
`of glycosylation of the in vitro synthesized ,u polypeptides and
`their faster mobility on reducing gels. Furthermore, mouse H
`chains contain an additional NH2-terminal signal peptide and
`still show similar mobility relationships between in vitro and
`in vivo synthesized polypeptides (29). Human K polypeptide
`(26,500 daltons) synthesized in vitro appears to be about 2500
`daltons larger than its in vivo secreted form (24,000 daltons)
`(Fig. 1, lanes 10 and 9, respectively). A similar observation has
`been made with human X (6). This is most likely due to signal
`peptides that are known to be cleaved from the NH2 terminus
`during Ig assembly in the mouse system (30) and that are not
`cleaved during in vitro translation unless microsomes are
`supplemented. The somatic cell hybrid aD5-DH11-BC11 does
`not secrete any detectable human L chain (Table 1) nor does
`it contain any translatable human L chain mRNAs (Fig. 2, lanes
`11 and 12). Human Y2, a2, and X mRNAs were isolated and
`characterized in a similar fashion and their properties are shown
`in Table 1.
`These mRNAs were converted into dscDNA and cloned. The
`, recombinant bacteria were screened sequentially with
`[32P]cDNA or mRNA probes of (i) homologous derived gu
`mRNA; (ii) heterologous u mRNA; and (iii) sucrose gradient
`RNA fractions containing no detectable ,u mRNA based on
`translation (data not shown). These procedures narrowed the
`potential number of ,u cDNA recombinants to about 250.
`Sixty of these recombinant plasmids were isolated, linked to
`DBM-paper, and used for hybridization-selection of their
`
`Merck Ex. 1056, pg 1414
`
`

`
`Genetics: Dolby et al.
`complementary mRNA. Four of these plasmids (two from
`GM607 and two from aD5-BCII-DH1I) were capable of se-
`lectively hybridizing mRNA that coded predominantly for a
`polypeptide with the properties of in vitro synthesized human
`,q chain (Fig. 3, lanes 9, 10, 23, and 25). Plasmid hybridiza-
`tion-selected mRNA translations from human K (GM607) cDNA
`clonings and several others were included on these gels but will
`be thoroughly discussed elsewhere with accompanying se-
`quence data.
`Fig. 4 shows part of the DNA nucleotide sequence of one of
`the 40 ,u cDNA recombinants identified [pTD-HAs-(aD5: 11-
`16)]. This Pst I-rescued Mi cDNA insert (655 base pairs) contains
`enough sequences to code for amino acids glycine (residue 421)
`through the terminal tyrosine (residue 576) of the human M
`chain as well as the entire 3'-noncoding sequence including 12
`residues of poly(A). The partial amino acid sequence as deter-
`mined from the base sequence is in almost total agreement with
`the primary structures of both human OU and GAL A chains
`isolated from patients with immune disorders (4, 33). In the
`human OU gu chain, glutamate residues occur at positions 487
`and 493 (4) whereas our sequence data indicate glutamine co-
`dons. The human GAL /i chain has an extra glutamine residue
`at position 488 (33) where no glutamine codon occurs. These
`inconsistencies are most likely attributable to partial deami-
`nation of glutamine during sequential degradation and amino
`acid analysis.
`Comparison of the human 3' noncoding sequence with that
`published for mouse ,u (31, 32) shows a striking conservation
`in certain regions (Fig. 4), as well as the codons of many amino
`acid residues shared in common (5, 31, 32). When the common
`amino acid codons differ in the mouse and human mRNA, they
`involve third base neutral codon substitutions (i.e., 560, Tyr;
`563, Asn; 564, Val; 569, Ser; and 576, Tyr) (Fig. 4 and refs. 31
`and 32). Unlike several other 3' noncoding regions, the sequence
`A-A-U-A-A begins 12 residues from the poly(A) addition site
`in the human ,u mRNA rather than the usual 20-30 residues
`observed with other mammalian 3' untranslated sequences
`(34-38) (see Fig. 4). The differences observed in the 3' non-
`coding sequences of mouse and human mRNA tend to be
`clustered, high in G+C content, and remote from the highly
`homologous regions near the A-A-U-A-A and the initial 3'
`noncoding sequences. A more thorough analysis comparing the
`codon preferences and coding and noncoding sequence
`homologies and divergences should await completion of the
`mouse and human ,u genomic sequence data.
`The production of a number of independently derived
`human H and L chain probes obtained from normal circulating
`lymphocytes via hybridomas and lymphoblastoid cell lines
`would be of considerable value in examining the molecular basis
`of several well-characterized human immunoglobulin disor-
`ders.
`We thank K. Edelberg for her technical assistance, Drs. S. M.
`Tilghman and G. C. Overton for their advice on molecular cloning,
`and Dr. P. Schur for subclass isotyping. This research was supported
`by U.S. Public Health Service Research Grants CA23568, CA16685,
`CA25875, CA20741, and CA10815, from the National Cancer Institute
`and GM20700 from the Institute of General Medical Services and by
`Grant 1-522 from the National Foundation-March of Dimes. C.M.C.
`is the recipient of a Research Career Development Award from the
`National Cancer Institute (CA00163).
`Williams, P. B., Kubo, R. T. & Grey, H. M. (1978) J. Immunol.
`1.
`121,2435-2439.
`Metzger, H. (1970) in Advances in Immunology, eds. Dixon, F.
`J. & Kunkel, H. G. (Academic, New York), Vol. 12, pp. 57-
`116.
`
`2.
`
`Proc. Natl. Acad. Sci. USA 77 (1980)
`
`6031
`
`3.
`
`4.
`
`5.
`
`Inman, F. P. & Mestecky, J. (1974) in Contemporary Topics in
`Molecular Immunology, ed. Ada, G. L. (Plenum, New York),
`Vol. 3, pp. 111-141.
`Putnam, F. W., Florent, G., Paul, C., Shinoda, T. & Shimizu, A.
`(1973) Science 182, 287-291.
`Kabat, E. A., Wu, T. T. & Bilofsky, H. (1979) in Sequences of
`Immunoglobulin Chains (U.S. Dept. of Health, Education, and
`Welfare), pp. 89-96.
`Yaffe, L. & Pestka, S. (1978) Arch. Biochem. Biophys. 190,
`495-507.
`Klukas, C. K., Cramer, F. & Gould, H. (1977) Nature (London)
`269,262-264.
`Marcu, K. B., Valbuena, 0. & Perry, R. P. (1978) Biochemistry
`17, 1723-1733.
`Croce, C. M., Shander, M., Martinis, J., Cicurel, L., D'Ancona,
`G. G., Dolby, T. W. & Koprowski, H. (1979) Proc. Natl. Acad.
`Sci. USA 76,3416-3419.
`Horibata, K. & Harris, W. A. (1970) Exp. Cell. Res. 60,61-69.
`Potter, M. (1972) Physiol. Rev. 52, 631-659.
`Kearny, J. F., Radbruch, A., Liesegang, B. & Rajewsky, K. J.
`(1979) Immunology 123, 1548-1550.
`Stephens, R. E., Pan, C., Ajiro, K., Dolby, T. W. & Borun, T. W.
`(1977) J. Biol. Chem. 252, 166-172.
`Pelham, H. & Jackson, R. J. (1976) Eur. J. Biochem. 67, 247-
`256.
`Wickens, M. P., Buell, G. N. & Schimke, R. T. (1978) J. Biol.
`Chem. 253, 2483-2495.
`Schenk, T. E., Rhodes, C., Rigby, P. W. J. & Berg, P. (1975) Proc.
`Natl. Acad. Sci. USA 72, 989-993.
`Roychoudhury, R., Jay, E. & Wu, R. (1976) Nucleic Acids Res.
`3, 101-116.
`Villa-Komaroff, L., Efstratiadis, A., Broome, S., Lomedico, P.,
`Tizard, R., Naber, S. P., Chick, W. L. & Gilbert, W. (1978) Proc.
`Natl. Acad. Sci. USA 75,3727-3731.
`Enea, V., Vovis, G. F. & Zinder, N. D. (1975) J. Mol. Biol. 96,
`495-509.
`Sippel, A. Z., Land, H., Lindenmaier, W., Nguyon-Huu, M.,
`Wurtz, J., Timmis, K. N., Giescoke, K. & Schultz, G. (1978) Nu-
`cleic Acids Res. 5, 3275-3294.
`Denhardt, D. (1966) Biochem. Biophys. Res. Commun. 23,
`641-646.
`Humphries, P., Old, R., Coggins, L. W., McShane, T., Watson,
`C. & Paul, J. (1978) Nucleic Acids Res. 5, 905-924.
`Meyers, J. C., Spiegelman, S. & Kacian, D. L. (1977) Proc. Natl.
`Acad. Sci. USA 74,2840-2843.
`Rigby, P. W. J., Dieckmann, M., Rhodes, C. & Berg, P. (1977)
`J. Mol. Biol. 113,237-251.
`Maniatis, T., Jeffrey, A. & Van de Sande, A. (1975) Biochemistry
`14,3787-3794.
`Maxam, A. & Gilbert, W. (1980) Methods Enzymol. 65, 499-
`560.
`Kuperstock, Y. M. & Helinski, D. R. (1973) Biochem. Biophys.
`Res. Commun. 54,1451-1459.
`Goldberg, M. L., Lifton, R. P., Stark, G. R. & Williams, J. G.
`(1979) Methods Enzymol. 68, 206-220.
`Jilka, R. L. & Pestka, S. (1977) Proc. Natl. Acad. Sci. USA 74,
`5692-5696.
`Burstein, Y. & Schechter, I. (1977) Proc. Natl. Acad. Sci. USA
`74,716-720.
`Calane, K., Rogers, J., Early, P., Davis, M., Livant, D., Wall, R.
`& Hood, L. (1980) Nature (London) 284,452-455.
`Matthyssens, G. & Rabbitts, T. H. (1980) Nucleic Acids Res. 8,
`703-713.
`Watanabe, S., Barbikol, H. U., Horn, J., Bertram, J. & Hil-
`schmann, N. (1973) Z. Physiol. Chem. 354, 1505-1509.
`Zakut, R., Givol, D. & Mory, Y. Y. (1980) Nucleic Acids Res. 8,
`453-466.
`Kafatos, F. C., Efstratiadis, A., Forget, B. G. & Weissman, S. M.
`(1977) Proc. Natl. Acad. Sci. USA 74,5618-5622.
`Konkel, D. A., Tilghman, S. M. & Leder, P. (1978) Cell 15,
`1125-1132.
`Seeburg, P. H., Shine, J., Martial, J. A., Baxter, J. D. & Goodman,
`H. M. (1977) Nature (London) 270,486-494.
`Honjo, T., Obata, M., Yamawaki-Kataoka, T., Kawakami, T.,
`Takahashi, N. & Mawo, Y. (1979) Cell 18, 559-568.
`
`6.
`
`7.
`
`8.
`
`9.
`
`10.
`11.
`12.
`
`13.
`
`14.
`
`15.
`
`16.
`
`17.
`
`18.
`
`19.
`
`20.
`
`21.
`
`22.
`
`23.
`
`24.
`
`25.
`
`26.
`
`27.
`
`28.
`
`29.
`
`30.
`
`31.
`
`32.
`
`33.
`
`34.
`
`35.
`
`36.
`
`37.
`
`38.
`
`Merck Ex. 1056, pg 1415