(CANCER RESEARCH57. 3723-3727. September 1. 19971
`
`Comparison of Estrogen Receptor DNA Binding in Untreated and Acquired
`Antiestrogen-resistant
`Human Breast Tumors1
`
`Stephen R. D. Johnston,2 B. Lu, Mitchell Dowsett, X. Liang, Manfred Kaufmann,3 Gary K. Scott, C. Kent Osborne,
`and Christopher C. Benz
`
`Royal Marsden Hospital and Institute of Cancer Research, Fulham Road, London SW3 6ff, United Kingdom fS. R. D. J.. M. DI:
`of Biochemistry,
`Academic Department
`Department of Medicine and Cancer Research Institute. University of California, San Francisco, California 94143-1270 lB. L. X. L. G. K. S., C. C. B.!: Universitat Frauenklinik,
`Heidelberg. Germany (M. K.J: and Department of Medicine, The Unis'ersitv of Texas Health Science Center at San Antonio, San Antonio, Texas 78284-7884 [C. K. O./
`
`ABSTRACT
`
`Preliminary studies have suggested that measuring the ability of im
`munoreactive
`67-kDa
`estrogen
`receptor
`(ER)
`to bind DNA and form in
`vitrocomplexeswith its cognateestrogenresponseelement(ERE) might
`serve to identify breast tumors most likely to respond to antiestrogens like
`tamoxifen. Data from two different
`surveys of untreated
`primary
`breast
`tumors
`confirmed
`that only 67% (74 of 111) ofER-positive
`tumors
`express
`a receptorcapableof formingER-EREcomplexesby gel-shiftassay,with
`tumors
`of lower ER content
`having significantly
`reduced ER DNA-bind
`big frequency (56%)
`relative to those of higher ER content
`(82%;
`P = 0.007). In contrast to these untreated tumors, a panel of 41 receptor
`positive breast
`tumors
`excised after acquiring
`clinical
`resistance
`to tamox
`ifen during
`either primary
`(n
`26) or adjuvant
`therapy
`(n
`15) showed
`a significantlygreater ER DNA-bindingfrequency,with nearly 90%
`capable of forming ER-ERE complexes (P < 0.02). To assess experimen
`tally whether ER DNA-binding function is altered during the development
`of antiestrogenresistance,nude mouse MCF-7tumor xenograftswere
`analyzed before and after the acquisition of in vivo resistance to either
`tamoxifenor a pure steroidal antiestrogen,ICI 182,780.Tamoxifen-resist
`ant MCF-7tumorsretainedfull expressionof 67-kDaDNA-bindingER,
`and despite
`a markedly
`reduced ER content
`in the ICI 182,780-treated
`tumors,
`the expressed ER in these antlestrogen-resistant
`tumors
`exhibited
`full abffity to form ER-ERE complexes. These findings
`indicate
`that breast
`tumors with acquired
`antiestrogen
`resistance
`continue
`to express ER of
`normal size and DNA-binding ability and suggest
`that
`the failure of
`antiestrogens
`to arrest
`tumor growth during
`emergence
`of clinical
`resist
`mice results from an altered gene-regulatory mechanism(s) other
`than
`ER-ERE complex formation.
`
`INTRODUCTION
`
`that express ER4 are more likely to
`Human breast carcinomas
`respond to endocrine therapy with tamoxifen (1). However, 30—70%
`of ER-positive primary tumors (according to their coexpression of the
`estrogen-inducible
`PgR) exhibit de novo resistance to endocrine ther
`apy (2). This could be explained if a significant proportion of endo
`crime-resistant ER-positive primary tumors produced a ligand-binding
`and immunoreactive
`isoform of ER that was transcriptionally
`incapa
`ble of mediating
`growth arrest when bound by a tamoxifen-like
`antagonist.
`Biochemical
`man tumors
`
`and antibody-based
`recognize
`specific
`
`assays that quantitate ER in hu
`regions within the ligand-binding
`
`domainof the receptorprotein.It is believedthat ER-mediatedgene
`regulation requires the binding of ligand-occupied
`receptor dimers to
`a defined hormone-responsive DNA sequence called the ERE, usually
`located in an upstream regulatory region of the target gene. Defects
`within the zinc-finger DNA-binding domain of the ER can result in an
`immunoreactive
`receptor
`capable of binding ligand but unable
`to
`complex with ERE-containing DNA. Thus, mutation,
`transcriptional
`splicing error, or a posttranslational
`ER modification
`affecting the
`receptor's DNA-binding
`domain can each result
`in a nonfunctional
`receptor
`in an apparently ER-positive tumor. Electrophoretic mobility
`shift (gel-shift) assay measures the ability of ER to bind a DNA probe
`containingthe cognate ERE sequenceand has been used to detect
`immunoreactive DNA-binding ER from human breast
`tumors. Both
`truncated DNA-binding ER isoforms and intact (67-kDa)
`immunore
`active ER that have lost the ability to bind DNA have been identified
`from a small collection (n
`5 1) of unselected primary breast
`tumor
`samples (3, 4). In particular,
`this initial survey found that
`30% of
`ER-positive breast
`tumors express a 67-kDa ER isoform incapable of
`binding DNA and forming ER-ERE complexes
`in vitro, suggesting
`that
`the gel-shift assay might
`identify ER-expressing
`breast
`tumors
`unable to respond to antiestrogen therapy (4).
`Loss of ER from originally ER-positive primary tumors by the time
`of their first relapse and treatment with tamoxifen may account
`for
`acquired resistance
`in a proportion
`of cases
`(5, 6). However, we
`recently reported that primary breast
`tumors
`that become
`resistant
`after an initial objective clinical
`response to tamoxifen usually con
`tinue to express ER at
`the time of relapse, although a significant
`proportion (—50%) failed to express the estrogen-regulated
`proteins
`PgR and p52 (7). These results are consistent with clinical
`studies
`indicating that more than half of tumors with acquired tamoxifen
`resistance
`fail
`to respond to second-line
`endocrine
`therapy (8).
`It
`remains unclear whether or not
`the lack of second-line
`endocrine
`responsiveness
`results from an acquired alteration in tumor ER func
`tion, such as loss of ER DNA binding, which might also account
`for
`an absence of PgR or pS2 expression in these tumors. Therefore,
`the
`present study was undertaken to determine whether acquired antics
`trogen resistance
`is associated with the inability of ER to form
`ER-ERE complexes
`in vitro along with absent PgR and pS2 tumor
`expression. We studied 41 ER-positive
`tumors excised from breast
`cancer patients after their development of clinical resistance to tamox
`ifen. For comparison,
`an additional 60 untreated tumors were also
`analyzed to expand upon our preliminary survey, resulting in a total of
`111 unselected ER-positive
`primary breast
`tumors, many of which
`would be expected to exhibit de novo tamoxifen resistance. Lastly,
`results
`from these human tumor analyses were compared with an
`experimental
`study of ER-positive human breast
`tumors excised from
`a nude mouse MCF-7 tumor xenograft model before and after ac
`quired antiestrogen resistance to assess independently
`in this model
`whether ER DNA-binding function is altered by the in vivo develop
`ment of resistance to either tamoxifen or the pure steroidal antiestro
`gen IC! 182,780.
`3723
`
`Received 3/19/97; accepted 7/3/97.
`The costs of publication of this article were defrayed in part by the payment of page
`charges. This article must therefore be hereby marked advertisement in accordance with
`18 U.S.C. Section 1734 solely to indicate this fact.
`and Hazel
`the Janet Landfear
`1 Supported
`in part by the Sussan G. Komen
`Foundation,
`and P5O-CA58183 from the
`P. Munroe Memorial Funds, and Grants ROl-CA71468
`National Cancer Institute. S. R. D. J. was funded by a Cancer Research Campaign Clinical
`Research Training Fellowship.
`should
`2 To whom requests
`for
`reprints
`sion 2884 or 2745; Fax: 0171-352-5441.
`3 Present
`address:
`J. W. Goethe
`University,
`Germany.
`element;
`response
`estrogen
`ERE,
`receptor;
`estrogen
`used are: ER,
`abbreviations
`4 The
`PgR, progesterone receptor; E2, estradiol; EIA, enzyme immunoassay; CHO, Chinese
`hamster
`ovary.
`
`be addressed.
`
`Phone:
`
`0171-352-8171,
`
`exten
`
`Theodor-Stern-Kai
`
`7, 60596
`
`Frankfurt,
`
`Downloaded from
`
`cancerres.aacrjournals.org
`
`on December 3, 2015. © 1997 American Association for Cancer
`Research.
`
`MYLAN PHARMS. INC. EXHIBIT 1017 PAGE 1
`
`

`
`ER DNA BINDING IN TAMOXIFEN-RESISTANTBREAST CANCER
`
`MATERIALS AND METHODS
`
`breast
`Primary untreated ER-positive
`for ER Analysis.
`Human Tumors
`carcinomas
`(n = 60) were derived from United Kingdom (Royal Marsden
`Hospital), United States
`(San Francisco)
`and German
`(Heidelberg)
`breast
`tumor banks. Tamoxifen-resistant ER-positive tumors (n = 41) were derived
`from two different previously reported sample collections
`at the Royal Mars
`den Hospital
`(7):
`(a) 26 primary
`breast
`tumors
`from patients
`initially
`respon
`sive
`to tamoxifen
`(complete
`and
`partial
`objective
`clinical
`responses)
`and
`surgically
`excised
`only after
`the development
`of acquired
`tamoxifen
`resistance;
`and (b) 15 tumor samples excised from patients
`relapsing with local-regional
`disease after primary treatment with surgery and
`2 years of adjuvant
`tamox
`ifen, with relapses occurring while on tamoxifen.
`Tumor extracts
`for ER analysis were prepared from 100—200mg of cryo
`preserved
`( —80°C) samples
`of tumor
`that were pulverized
`in a tissue dismem
`brator (Braun Medical Ltd.). Frozen tumor powder was added to 1.5 ml of
`ice-cold extraction buffer containing
`appropriate
`protease
`inhibitors
`[20 mM
`Tris (pH 7.5), 10 mMDli', 20% glycerol, 0.4 MKCI, 5 @xg/mlleupeptin, 2 mM
`phenylmethylsulfonyl
`fluoride, 10 @xg/mlaprotinin, and 1 @xg/mlpepstatin] and
`solubilized
`by polytron homogenization.
`The resulting homogenate was cen
`trifuged at 10,000 rpm for 15 mm at 4°C,and the clear
`supernatant was
`removed and stored at —80°Cuntil assayed. Total immunoreactive ER was
`assayed in the cytosol by ER EIA (Abbott Laboratories),
`and protein concen
`tration was quantified by the Bradford method.
`MCF-7XenograftModel. Xenograftswereestablishedin athymicnude
`mice as described previously (9). Estrogen supplementation was provided in
`the form of a 0.25-mg E2 pellet (Innovative Research, Rockville, MD) placed
`s.c.
`in the interscapular
`region
`of
`the mice. The effects
`of
`tamoxifen
`and ICI
`182,780 on the growth of established tumors were studied after the tumors had
`reached a size of 8—10mm (3—5weeks). At this time, the animals were
`randomly allocated into three treatment groups: (a) continued estrogen sup
`plementation;
`(b) removal of the E2 pellet plus treatment with 500 @gof
`tamoxifen
`citrate (Zeneca Pharmaceuticals, Wilmington, DE)
`in peanut oil
`(injected s.c. each day from Monday to Friday); and (c) removal of the E2
`pellet
`and
`treatment
`with
`5 mg of
`ICI
`182,780
`(Zeneca
`Pharmaceuticals,
`Macclesfield, United Kingdom)
`in castor oil (s.c.
`injections
`once a week).
`Tumor growth was assessed, and tumor volumes were measured twice a week
`as described
`previously
`(9).
`growth phase (i.e.,
`Tumors were harvested during the antiestrogen-sensitive
`2—4weeks after treatment initiation), when tumor volumes were regressing on
`either
`tamoxifen
`or ICI 182,780 (10). With continued
`tamoxifen
`treatment,
`tumors developed resistance
`and regrew after a median of 104 days, whereas
`with ICI I82,780,
`tumor progression did not occur until after a median of 200
`days. A total of nine tamoxifen-sensitive,
`nine IC! 182,780-sensitive,
`seven
`tamoxifen-resistant,
`and six ICI
`I 82,780-resistant
`tumors were harvested.
`Tumor homogenates were prepared as described above for analysis of ER
`content by EIA, Western blot, and for subsequent gel-shift analysis of ER
`DNA binding.
`Gel-Shift and Western Blot Assays for ER. Tumor samples were assayed
`for ER DNA binding (ER-ERE complex formation) by incubation with 2 @xg
`of poly(deoxyinosinic-deoxycytidylic
`acid)
`(Boehringer Mannheim)
`in 100
`mM KCI, 10 mM Tris (pH 7.5), 2 mM DTI', and 5% (v/v) glycerol with or
`without 0.1 @xgof anti-ER antibody (either D547 or D75) at room temperature
`for 10 mm,
`as described
`previously
`(3, 4). The D547
`and D75 monoclonal
`anti-ER antibodies (Abbott Laboratories) recognize widely separated epitopes
`in the D and E domains
`of
`the ER,
`respectively
`(I 1). DNA binding was
`initiated
`by further
`incubation
`for 10 mm at room temperature
`with 10 fmol of
`32P-5' end-labeled
`duplexed
`ERE oligomers
`(35-mer
`sense
`strand based on the
`Xenopus vitellogenin A2 consensus ERE sequence, 5'-GTCCAAAGTCAG
`GTCACAGTGACCTGATCAAAGTI'-3'), and the final reaction volume of 20
`pJ was incubated at 20°Cfor 20 mm. DNA-bound protein complexes were
`then electrophorectically separated on a 4.2% loosely cross-linked native
`polyacrylamide
`gel and visualized
`by autoradiography.
`Positive controls
`in
`cluded ER-transfected CHO cells (3, 4). Sensitivity of the gel-shift assay was
`0.25 fmol of ER, and positivity was defined as autoradiographic evidence of
`antibody-supershifted
`(immunoreactive)
`ER-ERE
`complexes,
`as described
`pre
`viously (3, 4).
`To measure total immunoreactive 67-kDa ER, sample extracts were dena
`tured by boiling in 1% SDS and 5% (3-mercaptoethanol
`and electrophorecti
`
`gel. Proteins were trans
`cally separated using a 10% SDS-polyacrylamide
`and after membranes
`were
`ferred
`onto a nylon membrane
`using a transblouer,
`blocked with 2% BSA for 1 h, they were incubated with anti-ER antibody.
`Detection of 67-kDa ER was performed as described previously (3, 4).
`PgR and p52 Expression.Theexpressionof PgRwasdeterminedfrom
`tumor cytosol by EIA (Abbott Laboratories), with a positive
`value being
`regarded as
`15 fmol/mg protein. Tumor expression
`of p52 was measured
`immunohistochemically
`using the BC-6 monoclonal
`antibody (gift from Prof.
`P. Chambon; Strasbourg, France) as described previously (12), with a positive
`value being assigned if
`!0% cells demonstrated cytoplasmic staining.
`
`RESULTS
`
`ana
`primary breast carcinomas
`Of the 60 untreated ER-positive
`lyzed in this survey, 41 (68%) contained ER capable of forming
`immunoreactive ER-ERE complexes by in vitro gel-shift assay. This
`frequency of ER DNA binding is similar to that found in our limited
`initial survey, and together,
`the data from both surveys demonstrate
`that 74 of 111 (67%) ER-positive
`primary tumors express DNA
`binding ER (Table 1). Tumors with an ER content of 10—99fmol/mg
`protein showed a significantly lower frequency of ER DNA-binding
`capability than tumors with an ER content of
`100 fmoL/mg protein
`(56 versus 82%; f = 7.2; P = 0.007). Fig. 1 illustrates representative
`gel-shift
`results from six tumors expressing ER incapable of produc
`ing ER-ERE
`complexes
`(Fig. 1A) and six others
`in which comparably
`loaded ER protein produces
`easily detectable
`immunoreactive ER
`ERE complexes
`(Fig.
`1B). Negative
`results with human
`tumors were
`verified using additional anti-ER monoclonal
`antibodies
`(e.g., H222,
`which recognizes an epitope in the ligand-binding domain)
`to rule out
`loss of epitopes as a possible reason for an absent supershifted band.
`Supershifting
`the ER-ERE complexes with anti-ER antibody serves
`the critical purpose of distinguishing DNA-bound ER from other
`potential ERE-complexing members of the nuclear hormone receptor
`superfamily. Using control
`forms of recombinant ER and cell-ex
`tracted ER (from CHO ER cells), both D547 and D75 seemed to
`supershift
`100% of the total
`retarded ER-ERE complex
`(Fig. 1).
`Therefore,
`any residual
`complex
`comigrating with unsupershifted
`ER-ERE in human tumor
`extracts
`is likely to represent
`non-ER
`protein (e.g., COUP and H-2RIIBP)
`found in cell and tumor extracts
`that can also bind ERE (3, 13).
`frequency observed with the
`Unlike the 67% ER DNA-binding
`collection of
`I 11 untreated ER-positive
`tumors,
`the 41 tamoxifen
`resistant
`ER-positive
`tumors
`exhibited
`a significantly
`greater
`ER
`DNA-binding frequency, with nearly 90% showing ER-ERE complex
`formation
`(x2
`5.7; P < 0.02). For
`the 26 ER-positive
`tumors
`relapsing after objective
`clinical
`responses
`to tamoxifen, mean ER
`content was 81 fmol/mg (range, 14—247fmol/mg) with full-length
`(67-kDa)
`immunoreactive
`receptor documented by Western blotting
`and normal ER DNA-binding function observed in 21 (81%) of these
`samples (Table 2). Thus, although in some tumor extracts more than
`one supershifted ER-ERE band was detected
`(Fig. 1B), Western
`blotting of these same extracts only revealed the full-length immuno
`reactive 67-kDa ER. For the 15 ER-positive
`tumors relapsing at
`
`2
`
`Table I Frequency of DNA-binding ER in untreated primary tumors in relation to
`absolute ER level
`Compiled results are from previous reports (3, 4) together with samples collected from
`London, Heidelberg, and San Francisco in the present survey, as described in “Materials
`and Methods.â€(cid:157)
`
`ER-EREPrior
`
`Binding
`
`ER content
`(fmol/mg)DNA
`surveyTotal(10—99)13/25
`
`(59%)37/66(56%)(>100)20/26
`
`reportsPresent
`
`(52%)24/41
`(77%)17/19
`
`(90%)37/45
`
`(82%)
`74/I11(67%)
`
`
`
`cancerres.aacrjournals.org Downloaded from
`
`on December 3, 2015. © 1997 American Association for Cancer
`Research.
`
`3724
`
`MYLAN PHARMS. INC. EXHIBIT 1017 PAGE 2
`
`

`
`ER DNA BINDING IN TAMOXIFEN-RESISTANTBREAST CANCER
`
`A.
`
`@
`
`32
`31
`Sample: CHO@ 23
`2.3
`2.0
`fmol ER
`ao
`2.6
`ii
`11
`I
`d@I
`D547antibody'@
`@+—+—+—+—+—+—+
`
`11
`1.0
`
`it
`
`19
`0.5
`
`
`
`@‘II
`
`30
`30
`
`B.
`16
`17
`18
`2.3
`3.0
`2.0
`—+--+—+—+—+—+
`
`21
`2.0
`
`11
`
`9
`2.0
`
`8
`2.3
`
`-t@
`
`(supershifted) DNA-binding ER and (B) six tumor samples with readily detectable
`immunoreactive
`Fig. 1. Gel-shift mobility assays of (A) six tumor samples with undetectable
`immunoreactive DNA-binding ER. Control ER extract was derived from CHO cells transfected with ER. Comparable amounts of ER (in femtomoles) were loaded in each lane as shown.
`In B, extracts from six tumors bound the radiolabeled ERE probe, and the resulting ER-ERE complex was supershifted by the anti-ER antibody D547 (arrow,
`supershifted complexes).
`In contrast, three of the six tumors in A showed a nonspecific band that was not supershifted by any of several anti-ER antibodies, including DM7. The free (unbound) probe that runs
`at the bottom of the gel is not shown.
`
`Table 2 Detection of immunoreactive DNA.binding ER (ER-ERE) in humanbreasttumors
`
`
`with acquired resistance to tamoxifen categorized by ER content(ER-E1Aquantification)
`PgRJpS2)Equal
`and phenotype
`(expression of
`
`tumor extracts were loaded for gel-shift
`volumes of ER-containing(ER-EREcomplex
`formation) assays.ER-EIA
`
`ImmunoreactiveTumor
`
`no.ER-EREER
`(fmol/mg)
`
`positive, PgR or pS2positive74
`+30
`247
`237
`—75
`177
`+36
`175
`+51
`139
`+54
`127
`+31
`97
`—84
`91
`+29
`91
`—4
`85
`+21
`83
`+17
`75
`+5
`69
`—8
`59
`+81
`41
`+38
`14
`
`positive)ER
`
`positive,PgRandpS2negative57
`+41
`203
`178
`+40
`97
`+22
`82
`+48
`79
`+18
`79
`+82
`76
`+86
`63
`+49
`21
`+28
`21
`
`PgR-EIA
`(fmol/mg)
`
`p52
`(% cells)
`
`1
`0
`60
`106
`7
`8
`83
`48
`64
`168
`74
`0
`23
`14
`5
`3
`
`3
`2
`0
`0
`13
`2
`0
`1
`1
`0
`
`80
`70
`90
`0
`90
`40
`60
`80
`0
`10
`50
`80
`0
`10
`80
`90
`
`0
`0
`0
`0
`0
`0
`0
`0
`0
`0
`
`+(12/16
`
`—(9/10
`positive)
`
`(Fig. 3). By comparison, MCF-7
`immunoreactive ER-ERE complexes
`tumors
`initially growth-inhibited
`by the pure steroidal antiestrogen
`IC! 182,780 containedlower levels of ER thanthe E2-treatedcontrols
`(mean, 43 ±23 versus 186 ±23 fmol/mg), and tumors that developed
`acquired resistance to IC! 182,780 expressed even lower ER levels
`(mean, 17 ±3 fmol/mg protein). Despite the reduced ER content of
`these IC! 182,780-treated
`tumors,
`the expressed receptor
`retained its
`normal67-kDasize and demonstratedDNA binding.
`
`DISCUSSION
`
`tumor ER
`types of breast
`In a previous report, we described several
`isoforms observed on the basis of their in vitro ability to bind DNA
`and form immunoreactive ER-ERE complexes
`(4). Truncated DNA
`binding isoforms may result from partial proteolytic cleavage of ER
`protein
`or alternative
`ER mRNA splicing
`(3, 14). The
`latter mecha
`nism may produce
`a truncated ER isoform (e.g., exon 5 variant)
`unable to bind ligand but capable of constitutively
`transactivating
`an
`estrogen-responsive
`gene like PgR (15). However, at the RNA level,
`such truncated ER variants do not seem to be expressed at sufficient
`levels
`in untreated
`and treated breast
`tumors
`to account
`for
`the
`emergence of most forms of tamoxifen resistance ( 16, 17). In contrast,
`our preliminary
`survey suggested that at
`least 30% of unselected
`ER-positive
`primary
`breast
`tumors
`contain a form of
`full-length
`(67-kDa) ER that
`is unable to bind DNA (4). This type of dysfunc
`tional ER could arise by posttranslational modification of the protein's
`
`Table 3 Detection of immunoreactis'e DNA-binding ER (ER.ERE) in human breast
`tumors that relapsed during adjuvant
`tamoxifen therapy categorized by ER content
`(ER-EJA quantification)
`and phenotype
`(expression
`of PgRJpS2)
`
`p52
`(% cells positive)
`
`Immunoreactive
`ER-ERE
`
`+ + + + + +
`
`(6/6 positive)
`
`+ + + + + ++ + +
`
`(9/9 positive)
`
`60
`0
`0
`50
`0
`0
`
`0 00000000
`
`PgR-EIA
`ER-EIA
`(fmol/mg)
`(fmol/mg)
`Tumor no.
`ERpositive.PgRor p52 positive
`59
`369
`73
`230
`52
`154
`12
`60
`55
`37
`45
`13
`
`17
`500
`463
`2
`25
`26
`
`00200070
`
`ER positive. PgR and pS2 negative
`76
`223
`71
`134
`80
`128
`33
`115
`14
`68
`77
`61
`60
`49
`78
`26
`56
`25
`
`I 12
`therapy, mean ER content was
`tamoxifen
`years of adjuvant
`fmol/mg (range, 13—369fmol/mg), and normal ER DNA binding was
`observed in all of these samples (Table 3). ER-ERE complex forma
`tion did not correlate with PgR or p52 expression in either set of
`tamoxifen-resistant
`tumors
`(Tables 2 and 3);
`it was notable
`that
`among the 19 ER-positive
`and tamoxifen-resistant
`tumors failing to
`express either PgR or pS2, all but 1 demonstrated
`normal ER DNA
`binding.
`ER content and DNA binding were also studied in xenografted
`MCF-7
`tumors
`demonstrating
`acquired
`antiestrogen
`resistance.
`Among the nude mouse tumors initially growth-inhibited
`(tamoxifen
`sensitive phase) and subsequently
`growth-stimulated
`(tamoxifen-re
`sistant phase) by tamoxifen,
`there was no significant difference in ER
`content
`(measured by EIA) when compared with control
`tumors
`in
`E2-treated animals (Fig. 2). Both tamoxifen-sensitive
`and tamoxifen
`resistant MCF-7 tumors contained the 67-kDa ER capable of forming
`
`3725
`
`Downloaded from
`
`on December 3, 2015. © 1997 American Association for Cancercancerres.aacrjournals.org
`
`
`Research.
`
`MYLAN PHARMS. INC. EXHIBIT 1017 PAGE 3
`
`

`
`@
`
`a@
`
`ER DNA BINDING IN TAMOXIFEN-RESISTANT
`
`BREAST CANCER
`
`U E2 (n=3)
`
`I@ TAM-Sensitive(n=9)
`
`D TAM-Resistant(n=7)
`
`N ICI-Sensitive(n=9)
`ICI-Resistant
`(n=6)
`
`aS
`
`e
`
`0I.a.
`55E
`
`0
`
`@
`
`Fig. 2. Mean ±SE ER protein levels determined by EtA in MCF-7
`xenografts treated with either E2, tamoxifen (TAM),or the pure antics
`trogen ICI I82,780. Tumors treated with either antiestrogen were har
`vested in either the sensitive or resistant phase of in s'is'ogrowth.
`
`oxidation of thiol groups
`intracellular
`domain (e.g.,
`DNA-binding
`structures) and could potentially account
`determining the zinc-finger
`for a significant proportion of ER-positive
`tumors exhibiting resist
`ance to receptor-binding
`antagonists
`such as tamoxifen (4). The data
`presented in Table 1 confirm and extend our earlier survey results and
`indicate that only two-thirds
`(74 of 111) of primary untreated ER
`positive breast
`tumors contain an immunoreactive
`receptor capable of
`binding DNA. Using a slightly different
`technique from the gel-shift
`assay procedure used here to survey primary breast
`tumors (n = 79),
`another group of investigators
`has reported a 30% discordance
`be
`
`MCF-7 NUDE MOUSE TUMORS: GEL-SHIFTED ER-ERE
`
`S
`
`Tumorno.:
`
`D75:
`
`I
`
`15
`
`— +
`
`5
`
`@1I
`— +
`
`8
`
`ii
`— .4-
`
`9
`
`tt
`— ÷
`
`‘I
`
`Ii
`— +
`
`A
`
`10
`
`II
`— +
`
`1
`
`— ÷
`
`II
`
`14
`
`— +
`
`7
`
`I;
`
`@,
`
`detection of tumor ER
`and ligand-binding
`tween the DNA-binding
`and has similarly concluded that assessment of both ER content and
`ER DNA-bindingfunctionmightimprovethe predictivespecificity of
`patients most
`likely to benefit
`from endocrine therapy (18).
`ER levels can fall with tamoxifen therapy (19—21),and clonal selec
`tion of low ER-expressing metastases from a primary breast tumor with
`heterogeneous ER expression represents a potential contributing mecha
`nism for acquired tamoxifen resistance (5, 6, 22). Using an immunohis
`tochemical
`ER assay unaffected
`by concurrent
`administration
`of tamox
`ifen, we have shown that breast
`tumor ER expression,
`although
`occasionally reduced in level, usually continues with the acquisition of
`tamoxifen resistance after an initial clinical response (7). However, up to
`50% of tamoxifen-resistant
`tumors may fail to coexpress PgR or pS2.
`Thus, given the observed conelation in primary untreated tumors be
`tween lower tumor ER and reduced ability to form ER-ERE complexes
`(Table 1), another feasible hypothesis for the development of tamoxifen
`resistance and loss of PgR and pS2 expression would be expression of a
`67-kDa ER isoform incapable of binding to DNA. The present study
`shows
`that
`in contrast
`to the 67% frequency
`of DNA-binding
`ER in
`untreated ER-positive tumors, breast
`tumors selected for having devel
`o_
`clinical resistance to tarnoxifen demonstrate a significantly greater
`DNA-binding ER frequency, with nearly 90% of these ER-positive
`tumors capable of forming ER-ERE complexes (P < 0.02).
`These ER-positive tumors had acquired their resistance to tamoxifen
`after an initial objective clinical response (n = 26) or after at least 2 years
`of tamoxifen adjuvant
`therapy (n = 15). Thus, these subsets of tamox
`ifen-resistant
`tumors represent
`relapses of primary breast
`tumors that
`most likely originally contained functionally intact ER mechanisms ac
`counting for their sensitivity to tamoxifen at the time this therapy was
`initiated. If the hypothesis is true that acquisition of tamoxifen resistance
`occurs independent of treatment-related variations in tumor ER, then the
`—90%frequencyofDNA-bindingERobservedintheserelapsingtumors
`probably reflects preservation of functioning ER as originally expressed
`in the pretreated tumors and suggests that gel-shift detection of DNA
`binding ER in primary tumors might predict for initial endocrine respon
`siveness. Taken together with our previous fmding of intact ER mRNA
`in these samples (16), the data indicate that most of the ER expressed in
`tumorswithacquiredclinicalresistanceto tamoxifenhas normalpmtein
`and transcript size as well as DNA-binding function. Furthermore,
`in
`3726
`
`(5) and four tamoxifen
`Fig. 3. Gel-shift mobility assay of four tamoxifen-sensitive
`resistant
`(R) MCF-7 xenografts grown in oophorectomized
`athymic (nude) mice. MCF-7
`xenografts were initially established with E2 and then treated with tamoxifen by daily s.c.
`injection.
`Tumors
`were
`harvested
`in either
`the sensitive
`phase when
`tumor
`volume was
`regressing (2—4weeks after
`initiation of therapy) or when acquired tamoxifen-resistant
`growth
`developed
`after
`a period
`of 4—6 months
`of tamoxifen
`therapy. All
`tumor
`extracts
`bound to the labeled oligonucleotide
`probe (a). and this band was further supershifted by
`the anti-ER monoclonal antibody D75 (a'). Free labeled probe (F) runs at the bottom of
`thegel.
`
`
`
`cancerres.aacrjournals.org Downloaded from
`
`on December 3, 2015. © 1997 American Association for Cancer
`Research.
`
`MYLAN PHARMS. INC. EXHIBIT 1017 PAGE 4
`
`

`
`ER DNA BINDING IN TAMOXIFEN-RESISTANTBREAST CANCER
`
`this was confirmed by more
`tumors with absent supershifted ER-ERE,
`than one ER monoclonal
`antibody
`to nile out epitope
`loss
`in the D/E
`region yielding a false negative result.
`between ER DNA bind
`Prior
`studies have established
`an association
`ing and PgR expression in ER-positive primary untreated breast tumors
`(3, 18). For the tamoxifen-resistant
`tumors analyzed in this study, ER
`DNA binding did not correlate with PgR or pS2 expression. As reported
`earlier, nearly half (19 of 41) of tumors with acquired tamoxifen resist
`ance failed to express either PgR or pS2 (7); notably, all but one of these
`demonstrated normal ER-ERE complex formation. Furthermore, 10% (4
`of 41) of the tamoxifen-resistant
`tumors demonstrated expression of
`either PgR or pS2 without detectable formation of ER-ERE complexes.
`These latter cases represented a subset of low ER-expressing tumors
`(5—31fmol/mg) for which the detection of ER-ERE complex formation
`can be technically more demanding,
`raising the possibility of false neg
`ative gel-shift results (4). Alternatively,
`these four cases might represent
`tumors in which the expressed ER is truly unable to bind DNA and in
`whichPgRor pS2 expressionis constitutiveand transcriptionallymdc
`pendent of ER-ERE complex formation. Because the responsiveness of
`the 41 tamoxifen-resistant
`tumors to second-line endocrine therapy was
`unknown,
`the predictive ability of either ER-ERE complex formation or
`PgR/pS2 expression in this setting could not be determined. However, the
`anticipated response rate to second-line endocrine therapy of patients
`exhibiting prior responsiveness to tamoxifen might be >50% (8). Thus,
`given the lack of correlation between ER DNA binding and PgR/pS2
`expression in these tumors with acquired tamoxifen resistance, a prospec
`tive clinical study would be of interest
`to determine whether either
`ER-ERE complex formationor PgR/pS2 expressionat the time of relapse
`is predictive of subsequent
`tumor
`response to second-line endocrine
`therapy.
`and
`of ER DNA binding, PgR/pS2 expression,
`The association
`antiestrogen resistance was tested experimentally
`in a well-character
`ized MCF-7 human xenograft model. Previous studies with this model
`have shown that
`in vivo acquisition of tarnoxifen resistance
`is not
`associated with any significant change in ER, PgR, or pS2 expression
`in s.c. implanted MCF-7 tumors (9, 23, 24). We not only verified that
`resistance to tamoxifen is unrelated to any significant change in ER
`content as compared to either E2-stimulated
`or tamoxifen-sensitive
`MCF-7 tumors
`(Fig. 2), but we also demonstrated
`expression
`of
`normal DNA-binding ER during each of the treatment
`responses (Fig.
`3). ICI 182,780, a pure steroidal
`antiestrogen
`distinguished
`by its
`ability to inhibit ER dimerization and down-regulate ER and PgR/pS2
`expression,
`is also associated with eventual development of resistance
`and tumor progression in the MCF-7 model, but after about
`twice as
`long a treatment
`interval as with tamoxifen (10). In the present study,
`IC! 182,780 not only reduced ER expression in both sensitive and
`resistant MCF-7 tumors, but
`the remaining ER expressed in these
`tumors seemed fully capable of binding DNA (Fig. 2). Thus,
`in this
`model system as well as with the human tumor samples, acquisition of
`antiestrogen resistance after an initial clinical
`response to therapy is
`associated with retention of ER DNA-binding ability,
`independent of
`alterations
`in the level of tumor ER and PgR/pS2 expression.
`In conclusion,
`it has been suggested that assessment of ER DNA
`binding(by in vitro formationof ER-EREcomplexes)mightprovide
`improved predictive information about the endocrine responsiveness of
`primal3@breast
`tumors. Whereas de novo resistance to tamoxifen is
`usually associated with lack of ER expression,
`it is also recognized that
`at least 30% of ER-positive tumors may be resistant to primary endocrine
`therapy. Based on this and earlier studies, it may be proposed that only
`those —70%of untreated ER-positive tumors that contain DNA-binding
`ER are capable of responding to an antiestrogen such as tamoxifen, and
`this suggestion deserves a prospective clinical analysis.
`In turn, when
`breast
`tumors that have shown an initial endocrine response become
`
`they seem to retain their DNA-binding
`clinically resistant to tamoxifen,
`ER, indicating that acquired tamoxifen resistance results in an an altered
`gene-regulatory mechanism(s) not affecting ER-ERE complex formation.
`Such tamoxifen-activated regulatory mechanisms that depend on ER but
`not on ER DNA binding have been identified and are currently under
`study in models of acquired antiestrogen resistance (25).
`
`REFERENCES
`
`their role in predicting prognosis and response
`I . McGuire, W. L. Hormone receptors:
`to endocrine therapy. Semin. Oncol., 5: 428—433,1978.
`2. McGuire, W. L. Steroid hormone receptors in breast cancer treatment strategy. Recent
`Prog. Horm. Res., 36: 135—156,1980.
`3. Scott, G. K., Kushner, P., Vigne, J-L.. and Benz, C. C. Truncated forms of DNA
`binding
`estrogen
`receptor.
`J. Clin.
`Invest.,
`88: 700—706.
`1991.
`4. Montgomery, P. A., Scott, G. K., Luce, M. C., Kaufmann, M., and Benz, C. C. Human
`breast tumors containing non-DNA-binding immunoreactive (67-kDa) estrogen re
`ceptor. Breast Cancer Res. Treat.. 26: 181—189,1993.
`5. Spataro, V., Price, K., Goldhirsch, A., Cavalli, F., Simoncini, E., and Castiglioni. M.
`Sequential estrogen receptor determinations from primary breast cancer and at re
`lapse: prognostic and therapeutic
`relevance. Ann. Oncol., 3: 733—740.1992.
`6. Kuukasjarvi, T., Kononen, J., Helm, H., Holli. K., and Isola, J. Loss of estrogen
`receptor
`in recurrent
`breast
`cancer
`is associated
`with
`poor
`response
`to endocrine
`therapy. J. Clin. Oncol., 14: 2584—2589, 1996.
`7. Johnston, S. R. D., Saccani-Jotti, G., Smith, I. E., Salter, J., Newby, J.. Coppen. M.,
`Ebbs, S. R., and Dowsett, M. Changes in estrogen receptor. progesterone receptor,
`and pS2 expression in tamoxifen-resistant human breast cancer. Cancer Res., 55:
`3331—3338, 1995.
`8. Howell, A., DeFriend, D., and Anderson, E. Mechanisms of response and resistance
`to endocrine
`therapy for breast cancer
`and the development
`of new treatment