This material may be protected by Copyright law (Title 17 U.S.Code)
`
`Hum Genet (2009) 126:329 -352
`DOI 10.1007/s00439- 009 -0717 -7
`
`1W4 , ©Mg Y ü lrAîrfiODN
`
`Novel human pathological mutations
`
`Published online: 31 July 2009
`© Springer -Verlag 2009
`
`Gene symbol: HEXA
`
`Disease: Tay -Sachs disease
`
`Ephrem Chin, L. Bean, B. Coffee, M.R. Hegde
`Human Genetics, Emory University, 2165 North Decatur, Road, 30033, Decatur, USA, Tel.: +1- 404 -778 8438, Fax:
`+1- 404 -778 8559, E -mail: elchin @emory.edu
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080090
`
`Codon number
`
`497
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TAT -TGT
`
`Tyr -Cys
`
`Gene symbol: SLC3A1
`
`Disease: Cystinuria
`
`Thomas Eggermann
`Institut für Humangenetik, RWTH Aachen, Pauwelsstr., 30, D- 52074, Aachen, Germany, Tel.: +49- 241 -8088008, Fax:
`+49 -241- 8082394, E -mail: tggermann @ukaachen.de
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080091
`
`Codon number
`
`397
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TAT -TGT
`
`Tyr -Cys
`
`1
`
`EXHIBIT
`
`42036
`3/47
`
`Springer
`
`Page 1 of 24
`
`Horizon Exhibit 2036
`Lupin v. Horizon
`IPR2016-00829
`
`

`

`330
`
`Gene symbol: SLC3A1
`
`Disease: Cystinuria
`
`f
`
`Hum Genet (2009) 126:329 -352
`
`Thomas Eggermann
`Institut für Humangenetik, RWTH Aachen, Pauwelsstr., 30, D- 52074, Aachen, Germany, Tel.: +49 241 8088008, Fax:
`+49 241 8082394, E -mail: teggermann@ukaachen.de
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080092
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`584
`
`aAGA -TGA
`
`Arg -Term
`
`Gene symbol: SLC7A9
`
`Disease: Cystinuria
`
`Thomas Eggermann
`Institut für Humangenetik, RWTH Aachen, Pauwelsstr., 30, 52074, Aachen, Germany, E -mail: teggermann@ukaachen.de
`
`Input for small deletions (<21 bp)
`
`Accession
`
`HD080027
`
`Deletion
`
`Codon number/location
`
`CCAAGGA^AACacAAAGAATTTT
`
`203
`
`Gene symbol: ABCA4
`
`Disease: Macular dystrophy
`
`Jana Aguirre- Lamban, R. Riveiro- Alvarez, D. Cantalapiedra, A. Avila- Fernandez, E. Vallespin,
`C. Villaverde- Montero, B. Gomez -Dominguez, C.L. Auz- Alexandre, M.J. Trujillo -Tiebas, C. Ayuso
`Genetics, Fundacion Jimenez Diaz, Reyes Catolicos, 2, 28040, Madrid, Spain, Tel.: +34- 91- 5504872, E -mail: jaguire @fjd.es
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080093
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`187
`
`CGT -CAT
`
`Arg -His
`
`: Springer
`
`Page 2 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`Gene symbol: UBE3A
`
`Disease: Angelman Syndrome
`
`331
`
`Evmorfia Tzagkaraki, Sofocleous Christalena, Fryssira Helen, Dinopoulos Argyris, Mavrou Ariadni,
`Kanavakis Emmanuel
`Medical Genetics, Athens University, Medical School, Thivon & Livadias, 11527, Athens, Greece, Tel.: 00302107467462,
`Fax: 00302107795553, E -mail: csofokl @med.uoa.gr
`
`Input for small insertions (<21 bp)
`
`Accession
`
`H1080014
`
`Insertion
`
`Codon number/location
`
`GCTGAGAGCATgTGGTACAGAG
`
`139
`
`Continents: The mutation was detected by ECMA (Enzymatic Cleavage Mismatch Analysis) and characterized by direct
`sequencing (performed twice).The proband is a 27 months boy with microcephaly and presents a typical for Angelman
`EEG. Mutation analysis for both parents revealed normal sequences. Sequencing results available upon request.
`
`Gene symbol: JAGT
`
`Disease: Allagille syndrome
`
`Jay Ellison
`Medical Genetics, Mayo Clinic, 200 First St SW, 55905, Rochester, USA, Tel.: 507- 284 -8208, Fax: 507- 284 -1067, E -mail:
`ellison.jay@mayo.edu
`
`Input for small insertions (<21 bp)
`
`Accession
`
`HI080015
`
`Insertion
`
`Codon number/location
`
`TCCTCCAG_I16E17_GTtAGACAGTCAGT
`
`706; c.21l5dupT; p.Asp706Stop
`
`Comments: cacgt(T)gaca T is the inserted base.
`
`Gene symbol: COL4A5
`
`Disease: Alport syndrome
`
`Jay Ellison
`Medical Genetics, Mayo Clinic, 200 First St SW, 55905, Rochester, USA, Tel: 607 -284 -8208, Fax: 507- 284 -1067, E -mail:
`ellison.jay @mayo.edu
`
`Input for small deletions (<21 bp)
`
`Accession
`
`HD080028
`
`Deletion
`
`Codon number/location
`
`CTTACTGAGCCctGAGTCTTTGG
`
`17
`
`Comments: Female with asymptomatic hematuria and proteinuria. c.49_50de1CT /p.Leu17GlufsX22.
`
`1 Springer
`
`Page 3 of 24
`
`

`

`332
`
`Gene symbol: F9
`
`Disease: Haemophilia B
`
`Hum Genet (2009) 126:329 -352
`
`Gulzar Niazi, Zeeshan Shaukat, Khalid Masood, Rashid Hussain
`Medical Genetics, Centre of Excellence in Molecular Biology, West canal bank road, 87, 57300, Lahore, Pakistan, Tel.:
`92425293142, Fax: 92425293149, E -mail: niazi@cemb.edu.pk
`
`Input for small insertions (<21 bp)
`
`Accession
`
`HI080016
`
`Insertion
`
`Codon number/location
`
`GTGGTT^TGCTcctgctCCTGTACTGA
`
`109
`
`Comments: Novel insertion in Pakistani patient.
`
`Gene symbol: FS
`
`Disease: Haemophilia A
`
`Gutzar Niazi, Zeeshan Shaukat, Khalid Masood, Rashid Hussain
`Medical Genetics, Centre of Excellence in Molecular Biology, West canal bank road, 87, 57300, Lahore, Pakistan, Tel.:
`92425293142, Fax: 92425293149, E -mail: niazi@cemb.edu.pk
`
`Input for small deletions (<21 bp)
`
`Accession
`
`H0080029
`
`Deletion
`
`Codon number/location
`
`GCTCAA^ACACtCTTGATGGAC
`
`298
`
`Comments: Novel deletion in a Pakistani patient.
`
`Gene symbol: RHD
`
`Disease: Rhesus negative blood group
`
`Janet Carvalho Pereira, N.P. Martins, M.L. Ribeiro
`Hematologia, Centro Hospitalar Coimbra, EPE, Av. Bissaya Barreto, S/N, 3000 -076, Coimbra, Portugal, Tel.:
`+351239480370, Fax: +351239717216, E -mail: uhm @chc.min -saude.pt
`
`Input for complex rearrangements
`
`Accession
`
`HP080001
`
`Description
`
`Hybrid with ex. 4 -9 RHCE
`
`Comments: Haplotype -cdE.
`
`Springer
`
`Page 4 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`Gene symbol: ALAS2
`
`Disease: Sideroblastic anaemia
`
`333
`
`Janet Carvalho Pereira, J. Barbot, M.L. Ribeiro
`Hematologia, Centro Hospitalar Coimbra, EPE/Hospital Maria Pia, Av. Bissaya Barreto, S/N, 3000 -076, Coimbra, Por-
`tugal, Tel.: +351239480370, Fax: +351239717216, E -mail: uhm @chc.min -saude.pt
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080094
`
`Codon number
`
`503
`
`Nucleotide substitution
`
`Amino acid substitution
`
`GCC -GTC
`
`Ala -Val
`
`Comments: Mutation found in the propositus and his mother.
`
`Gene symbol: SRY
`
`Disease: XY sex reversal
`
`Celia Ravel, B. Lakhal, H. Elghezal, R. Braham, A. Saad, A. Bashamboo, J.P. Siffroi, K. McElreavey,
`S. Christin- Maitre
`EA1533 Faculté de médecine Pierre et Marie Curie, Rue de chaligny, 27, 75012, Paris, France, E -mail: cravel @pasteur.fr
`
`Input for regulatory mutations
`
`Accession
`
`HR080003
`
`Nucleotide substitution
`
`TGGTTGGGCGGGGTTGAGGGGGTGTTGAGG(G-C)
`CGGAGAAATGCAAGTTTCATTACAAAAGTT
`
`Location relative to
`
`Initiator methionine
`
`Comments: A 34 year -old phenotypically normal female was referred to our attention for primary amenorrhea. The vagina
`was present but reduced in length. The weight was 69 kg; the height 1 m 69. F511, LH, estradiol, prolactin and testosterone
`levels reached 110 mUl/ml, 24.3 mUl/ml, 12 pg/ml, 12.6 ng/ml and 0.3 ng/ml, respectively. Karyotype was 46,XY. At
`ultrasound examination, gonads could not be identified. However, a small uterus was present. The two kidneys were normal.
`SRY mutational analysis revealed a single base -pair substitution. c. -130G > C located in a highly conserved Sp 1A motif
`that has previously been shown experimentally to be involved in regulation of SRY expression. tgttgagg(g -c)cggagaaa.
`
`Gene symbol: APC
`
`Disease: Adenomatous polyposis coli
`
`L.A. Mavrogiannis, C.E. Chu, R.S. Charlton
`DNA Laboratory, St James's Hospital, Beckett, Street, LS9 7TF, Leeds, United Kingdom, Tel: 00441132066058, Fax:
`00441132467090, E -mail: l ampros .mavrogiannis @leedsth.nhs.uk
`
`Input for splicing mutations (single base -pair substitution)
`
`Accession
`
`Intron designation, number or letter
`
`Donor /Acceptor
`
`Relative location
`
`Nucleotide substitution
`
`H$080016
`
`14
`
`Donor
`
`+1
`
`G-C
`
`Springer
`
`Page 5 of 24
`
`

`

`334
`
`Hum Genet (2009) 126:329 -352
`
`Comments: Familial case, multiple polyps and colorectal cancer. HGVS notation: c.1958 + 1G > C. Reference sequence:
`NM_000038.
`
`Gene symbol: FS
`
`Disease: Hemophilia A
`
`Gulzar Niazi, Mudassar Altaf, Rashid Hussain, Sohail Iqbal
`Medical Genetics, Centre of Excellence in Molecular Biology/University of the Punjab, West canal bank road, 87, 57300,
`Lahore, Pakistan, Tel.: 92425293142, Fax: 92425293149, E -mail: niazi@cemb.edu.pk
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080095
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`1888
`
`AGC -ATC
`
`Ser -Ile
`
`Comments: Novel missense mutation in a Pakistani patient.
`
`Gene symbol: COL7A1
`
`Disease: Epidermolysis bullosa dystrophica
`
`Natividad Cuadrado -Corrales, M. Garcia, M.J. Escamez, A. Carrillo, M.J. Trujillo -Tiebas, C. Ayuso, M. Del Rio
`Epithelial Biomedicine Division, CIEMAT -CIBERER, Av. Complutense, 22, 28040, Madrid, Spain, Tel.: 34 91 4962526,
`Fax: 34 91 346 6484, E -mail: natividad.cuadrado @ciemat.es
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080096
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`2434
`
`aGGA-AGA
`
`Gly-Arg
`
`Comments: This mutation was found in two members of a spanish family. The proband (children) presented typical
`clinical features of DEB whereas the mother was asymptomatic.
`
`Gene symbol: COL7A1
`
`Disease: Epidermolysis bullosa dystrophica
`
`Marta Garcia, M.J. Escamez, N. Cuadrado -Corrales, A. Carrillo, M.J. Trujillo -Tiebas, C. Ayuso, M. Del Rio
`Regenerative Medicine Unit, CIEMAT -CIBERER, Av. Complutense, 22, 28040, Madrid, Spain, Tel.: 34 -91- 346 -6051,
`Fax: 34 -91- 346 -6484, E -mail: marta.garcia @ciemat.es
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`1332
`
`GGC-GAC
`
`Gly-Asp
`
`Accession
`
`HM080097
`
`Springer
`
`Page 6 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`335
`
`Comments: Mutation identified in a 8 year -old- female patient from Spain, with recessive distrophic epidermolysis bullosa.
`This mutation has been identified in exon 33 of the COL7A1 gene.
`
`Gene symbol: COL7A1
`
`Disease: Epidermolysis bullosa dystrophica
`
`Natividad Cuadrado -Corrales, M. Garcia, M.J. Escamez, A. Carrillo, Mi. Trujillo- Tiebas, C. Ayuso, M. Del Rio
`Regenerative Medicine Unit, CIEMAT- CIEERER, Av. Complutense, 22, 28040, Madrid, Spain, Tel: 34 -91- 346-6051,
`Fax: 34 -91- 346 -6484, E -mail: natividad.cuadrado @ciemat.es
`
`Input for splicing mutations (single base -pair substitution)
`
`Accession
`
`Intron designation, number or letter
`
`Donor /Acceptor
`
`Relative location
`
`Nucleotide substitution
`
`HS080017
`
`96
`
`Donor
`
`+2
`
`T-C
`
`Comments: Mutation identifed in a year -old- male from Spain, with recessive distrophic epidermolysis bullosa. This
`mutation has been identified in intron 96 of the COL7A1 gene.
`
`Gene symbol: SLC3A1
`
`Disease: Cystinuria
`
`Anthoula Chatzikyriakidou, K.D. Kollios, I. Georgiou
`Obstetrics and Gynecology, Ioannina University, Genetics Unit, Panepistimiou Avenue, 1, 45110, Ioannina, Greece
`E -mail: chatzikyra @email.com
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080095
`
`Codon number
`
`264
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TGGc-TGA
`
`Ttp-Tenn
`
`Comments: The novel described SLC3A1 mutation W264X (c.792G > A) was found in one cystinuria patient from
`Macedonia (North Greece) in heterozygosity with the common SLC3A1 mutation T216 M.
`
`Gene symbol: ABCD1
`
`Disease: Adrenoleukodystrophy
`
`Pallavi Shukla, Neerja Gupta, Madhulika Kabra, Manju Ghosh, Sheffali Gulati, Veena Kalra
`Pediatrics (Genetic unit), All India Institute of Medical Sciences, Ansari Nagar, room no110, 110029, New Delhi, India,
`Tel.: 91- 9871404143, 91126594585, E -mail: pallavil5july @rediffmail.com
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080099
`
`Codon number
`
`132
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TOG -TAG
`
`Trp-Tenn
`
`Springer
`
`Page 7 of 24
`
`

`

`336
`
`Hum Genet (2009) 126:329 -352
`
`Comments: It is a nonsense mutation found in exon 1 of ABCD1 gene in an X -ALD patient from India. c.395G > A.
`
`Gene symbol: RHO
`
`Disease: Retinitis pigmentosa
`
`Juhua Yang
`Biomedical Engineering Center, Fujian Medical University, Jiaotong Road, 88, 350004, Fuzhou, China (P.R.), Tel.: 86-
`59183569055, E -mail: julian_yang @mail.fjmu.edu.cn
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HMO80I00
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`343
`
`gAGC -TGC
`
`Ser -Cys
`
`Comments: This mutation was heteroplasmic missense (Ser343Cys) and was found in an isolated Chinese retinitis
`pigmentosa (RP) patient (designated as RP0101201), who originated from Fujian province, China.
`
`Gene symbol: ECM1
`
`Disease: Lipoid Proteinosis
`
`Abdul Hameed, Muhammmad Nasir, Muhammad Ajmal, Amir Latif
`IBGE, Institute of Biomedical and Genetic Engineering, G.P.O. Box 2891, 24 -Mauve Area, G -9/1, Mauve Area, 44000,
`Islamabad, Pakistan, Tel: +92 -51- 9260639, Fax: +92 -51- 9260639, E -mail: ahameed0786 @yahoo.com
`
`Input for gross insertions and duplications
`
`Accession
`
`HNO8000I
`
`Description
`
`Insertion 62 bp nt 1209_1210
`
`Comments: A homozygous insertion, 1209_ 1210insTAGGAAGCCAATTGATATCATAGCTCAGACCATACCTATG
`TATCCAATGGTTCTTTTTTTCC in exon 8.
`
`Gene symbol: PROC
`
`Disease: Protein C deficiency
`
`Anil Pathare, Shoaib Al Zadjali, Wassifudeen Shah
`Haematology, Sultan Qaboos University Hospital, P.O Box, 35, 123, Muscat, Oman, Tel: +96899384951, Fax:
`+96824413419, E -mail: avp16 @hotmail.com
`
`Input for splicing mutations (single base -pair substitution)
`
`Accession
`
`Intron designation, number or letter
`
`Donor /Acceptor
`
`H5080021
`
`IVS8
`
`Acceptor
`
`Relative location
`-2
`
`Nucleotide substitution
`
`A-G
`
`: Springer
`
`Page 8 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`337
`
`Comments: This acceptor splice -site mutation (IVS 8, -2 A -G) results in a frameshift with a stop codon at codon
`274[TAG].
`
`Gene symbol: SCN1A
`
`Disease: Severe Myoclonic Epilepsy of Infancy
`
`Giovanni Provenzano, E. Mannarino, F. Annesi, E.V. De Marco, F.E. Rocca, V. Greco, V. Scornaienchi,
`P. Tarantino, D. Civitelli, A. Quattrone, G. Tortorella, G. Annesi
`Institute of Neurological Sciences, National Research Council, Contrada Burga, 44, 87050, Mangone (Cosenza), Italy, Tel:
`+39- 0984- 98011, Fax: +39- 0984 -969306, E -mail: g.provenzano @isn.cnr.it
`
`Input for small deletions (<.21 bp)
`
`Accession
`
`HD080030
`
`Deletion
`
`Codon number/location
`
`ATAGCAGG E717 GTAaGTCAATAATT
`
`342
`
`Comments: E7I7 IVS7 + 4delA. The gene SCN1A coding for the alphal subunit of the neuronal sodium channel, has been
`found mutated in various types of epilepsy. The associated phenotypes range from benign febrile seizures to extremely
`serious conditions, such as severe myoclonic epilepsy of infancy (SMEI). We have identified in a SMEI patient coming
`from the Southern Italy a novel mutation. This variation was found in the splicing donor site of intron 7, consisting in a
`deletion of a single nucleotide (IVS7 + 4delA). The IVS7 + 4delA was not present in 100 healthy controls with a negative
`family history from Southern Italy.
`
`Gene symbol: NR3C1
`
`Disease: Glucocorticoid receptor deficiency
`
`Carel Pretorius, Sarah K. McMahon, Jacobus P.K. Ungerer, Nathaniel Salmon, Louise Comwell, Jennifer A. Batch
`Chemical Pathology, Pathology Queensland, Herston Road, 4029, Brisbane, Australia, Tel: +61736360083, Fax:
`+61736363417, E -mail: Carel_Pretorius @health.gld.gov.au
`
`Input for small deletions (<21 bp)
`
`Accession
`
`HD080031
`
`Deletion
`
`Codon number/location
`
`AAAAAAACTTCtgTTTCATCAAA
`
`772
`
`Comments: We detected a homozygous TG deletion (c. 2318- 2319delTG) in a child with severe glucocorticoid resistance.
`The predicted effect on the glucocorticoid receptor protein is a frame shift mutation with a read -through of the stop codon
`and a 24 non -sense amino acid tail (p. F774S fs X24).
`
`Springer
`
`Page 9 of 24
`
`

`

`338
`
`Gene symbol: DMD
`
`Disease: Muscular dystrophy, Duchenne
`
`Hum Genet (2009) 126:329 -352
`
`Javier Garcia- Planells', M. Torres -Puente', J.J. VilchezZ, M. Perez -Alonso'
`'Medical Genetics Unit, Sistemas Genomicos, Ronda G Marconi, 6, E46980, Valencia ( Paterna), Spain, Tel: +34-
`903364669, Fax: +34- 902364670, E -mail: jgplanells @hotmail.es
`2Department of Neurology, University Hospital La Fe, Valencia, Spain
`
`Input for small insertions (<21 bp)
`
`Accession
`
`H1080017
`
`Insertion
`
`Codon number/location
`
`CTTACAG_I3IE32_^AAAaAAATTACAAG
`
`1449
`
`Gene symbol: DMD
`
`Disease: Muscular dystrophy, Duchenne
`
`Javier Garcia -Planells,' Manoli Torres -Puente,' Juan J. Vilchez,2 Manuel Pérez -Alonso'
`'Medical Genetics Unit, Sistemas Genomicos, Ronda G Marconi, 6, E46980, Paterna (Valencia), Spain, Tel.:
`+34902364669, Fax: +34902364670, E -mail: jgplanells @hotmail.es
`2Department of Neurology, University Hospital La Fe, Valencia, Spain
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080102
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`1362
`
`gCAA -TAA
`
`Gin -Tenn
`
`Comments: Unpublished.
`
`Gene symbol: DMD
`
`Disease: Muscular dystrophy, Duchenne
`
`Javier Garcia- Planells', Manoli Torres -Puente', Juan J. Vilchez2, Manuel Pérez -Alonso'
`'Medical Genetics Unit, Sistemas Genomicos, Ronda G Marconi, 6, E46980, Valencia ( Paterna), Spain, Tel.:
`+34902364669, Fax: +34902364670, E -mail: jgplanells @hotmail.es
`2Department of Neurology, University Hospital La Fe, Valencia, Spain
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080103
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`35
`
`gCAG-TAG
`
`Gln-Tenn
`
`Comments: Unpublished.
`
`Springer
`
`Page 10 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`Gene symbol: HMBS
`
`Disease: Porphyria, acute intermittent
`
`339
`
`Elena Di Pierror, V. Brancaleonia, F. Stanziala, F. Benedicentia, C. Castellana, M.D. Cappellinia
`'Internal Medicine, Maggiore Policlinico Foundation IRCCS- University of Milan, F. Sforza, 35, 20122, Milano, Italy, Tel:
`+390255033363, Fax: +390250320296, E -mail: elena.dipierro @unimi.it
`2Clinical Genetics Service, Department of Pediatrics, General Regional Hospital, Bolzano, Italy
`
`Input for small insertions (<21 bp)
`
`Accession
`
`Hí080018
`
`Insertion
`
`Codon number/location
`
`GCAGTAGTGCCcAGTAGCCGTG
`
`263
`
`Comments: The C duplication at position 791 (c.791dupC) dose not change the aminoacid at codon 264 but it causes a
`frameshift with a stop after 2 codons. p.Pro264ProfsX2.
`
`Gene symbol: SCN5A
`
`Disease: Brugada Syndrome
`
`Lia Crotti, M. Pedrazzini, R. Insolia, A. Cuoretti, A. Ghidoni, F. Dagradi, E. Taravelli, E. Chieffo,
`A. Vicentini, P.J. Schwartz
`PV, Fondazione IRCCS Policlinico San Matteo, Piazzale Golgi, 2, 27100, Pavia, Italy, Tel.: 039 -0382 -501322, Fax: 039-
`0382- 501322, E -mail: I.crotti @smatteo.pv.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HMO80101
`
`Codon number
`
`43
`
`Nucleotide substitution
`
`Amino acid substitution
`
`cCGA -TGA
`
`Arg -Term
`
`Comments: A 21- year -old Caucasian male, asymptomatic for syncopal events, with a positive family history for sudden
`cardiac death (father died suddenly at age 42) and a diagnosis of Brugada Syndrome, was referred to our attention for
`molecular screening. The basal ECG showed incomplete bundle- branch block and coved -type ST- segment elevation in the
`right precordial leads (V1 -V2), highly suggestive for Brugada Syndrome (BrS). The Flecainide test was positive, ven-
`tricular fibrillation was induced during electrophysiological study, and an implantable cardioverter defribillator (ICD) was
`implanted. His sister (18- year -old), asymptomatic for cardiac events, showed first -degree atrio- ventricular block, bor-
`derline interventricular conduction time and phases of diurnal sino- atrial blocks. The Flecanide test was interrupted
`prematurely for the occurrence of a stable sino- atrial block. SCN5A was screened through DHPLC and sequence analysis.
`A novel CI 27T transversion causing the nonsense mutation R43X and the premature truncation of the sodium channel
`protein was identified. The same mutation, not identified in 300 controls, was detected in the proband's sister. She
`performed an electrophysiological study that induced ventricular fibrillation and therefore an ICD was implanted. The
`father, who died suddenly, was an obligate mutation -carrier as the mother was negative at the molecular screening.
`Accordingly, the sodium channel mutation identified was related to BrS, conduction defects and sudden cardiac death.
`
`AZ Springer
`
`Page 11 of 24
`
`

`

`340
`
`Gene symbol: CYP17A1
`
`Disease: 17a- Hydroxylase/17,20 -Lyase Deficiency
`
`Hum Genet (2009) 126:329 -352
`
`Fengxia Yao, Tian qinjie
`Clinical Research Lab, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union
`Medical College, shuaifu yuan, 1 hao, 100730, Beijing, China (P.R.), Tel.: 86 -10- 65296285, E -mail: yaofx @yahoo.com.cn
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080104
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`209
`
`CTG -CCG
`
`Leu -Pro
`
`Gene symbol: VHL
`
`Disease: Von Hippel- Lindau syndrome
`
`Maurizio Castellano
`BS, Università degli Studi di Brescia, piazza Spedali Civili, 1, 25100, Brescia, Italy, Tel.: +390303995276, Fax:
`+390303995276, E -mail: castella @med.unibs.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080I05
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`112
`
`cTAC -TGC
`
`Tyr -Cys
`
`Gene symbol: SPG4
`
`Disease: Spastic paraplegia, autosomal dominant
`
`Antonella Fogli, Roberta Battini, Fulvia Baldinotti, Maria Elena Conidi, Angela Michelucci, Paolo Simi
`U.O. Citogenetica e Genetica Molecolare: Azienda Ospedaliero Universitaria Pisana, Roma, 67, 56100, Pisa, Italy, Tel.:
`+39 050 993377, Fax: +39 050 992103, E -mail: a.fogli @ao- pisa.toscana.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080106
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`454
`
`gGAG -AAG
`
`Glu -Lys
`
`Comments: Male patient with moderate spasticity and moderate disability.
`
`Springer
`
`Page 12 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`Gene symbol: SPG4
`
`Disease: Spastic paraplegia, autosomal dominant
`
`341
`
`Antonella Fogli, Roberta Battini, Fulvia Baldinotti, Michelucci Angela, Conidi Maria Elena, Simi Paolo
`U.O. Citogenetica e Genetica Molecolare: Azienda Ospedaliero Universitaria Pisana, Roma, 67, 56100, Pisa, Italy, Tel.:
`+39- 050- 993377, Fax: +39- 050- 993102, E -mail: a.fogli @ao- pisa.toscana.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080107
`
`Codon number
`
`413
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TCA -TTA
`
`Ser -Leu
`
`Comments: Female patient with mild spasticity and moderate disability.
`
`Gene symbol: ABCA4
`
`Disease: Stargardt disease
`
`Jana Aguirre- Lamban, R. Riveiro- Alvarez, M. Garcia -Hoyos, D. Cantalapiedra, M. Martinez- Garcia,
`E. Vallespin, A. Avila- Fernandez, C. Villaverde- Montero, M.J. Trujillo -Tiebas, C. Ayuso
`Genetics, Fundacion Jimenez Diaz, Avda. Reyes Catolicos, 2, 28040, Madrid, Spain, Tel.: +34- 915504872, E -mail:
`jaguine @fjd.es
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080108
`
`Codon number
`
`841
`
`Nucleotide substitution
`
`Amino acid substitution
`
`gCAG-AAG
`
`Gln-Lys
`
`Gene symbol: ASSI
`
`Disease: Citrullinaemia
`
`David Dimmock, Pamela Trapane, Annette Feigenbaum, Catherine E. Keegan, Stephen Cederbaum, James Gibson,
`Michael J. Gambello, Keith Vaux, Patricia Ward, Gregory M. Rice, Jon A. Wolff, William E. O'Brien, Ping Fang
`Pediatrics, Medical College of Wisconsin, 8701 Watertown Plank Rd, Genetics Lab: HRC PD169, 53226, Milwaukee,
`Country: USA, Tel.: +1- 414 -266 -2979, Fax: +1- 414 -266 -1616, E -mail: ddimmock @hmgc.mcw.edu
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080109
`
`Codon number
`
`272
`
`Nucleotide substitution
`
`Amino acid substitution
`
`CGC -CAC
`
`Arg -His
`
`Comments: c.815G > A.
`
`Springer
`
`Page 13 of 24
`
`

`

`342
`
`Gene symbol: ASSI
`
`Disease: Citrullinaemia
`
`Hum Genet (2009) 126:329 -352
`
`David Dimmock, Pamela Trapane, Annette Feigenbaum, Catherine E. Keegan, Stephen Cederbaum, James Gibson,
`Michael J. Gambello, Keith Vaux, Patricia Ward, Gregory M. Rice, Jon A. Wolff, William E. O'Brien, Ping Fang
`Pediatrics, Medical College of Wisconsin, 8701 Watertown Plank Rd, Genetics Lab: HRC PD169, 53226, Milwaukee,
`USA, Tel.: +1- 414 -266 -2979, Fax: +1- 414 -266 -1616, E -mail: ddimmock @hmgc.mcw.edu
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HMO801 10
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`72
`
`TTCa-TTG
`
`Phe-Leu
`
`Comments: c.216C > G.
`
`Gene symbol: HBA2
`
`Disease: Thalassemia alpha
`
`Chiara Refaldi, Maria Rosaria Fasulo, Claudia Cesaretti, Maria Domenica Cappellini
`Internal Medicine, Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, via Francesco Sforza, 35,
`20122, Milan, Italy, Tel: +390255033363, E -mail: chiararefaldi @hotmail.com
`
`Input for splicing mutations (single base -pair substitution)
`
`Accession
`
`Intron designation, number or letter
`
`Donor /Acceptor
`
`Relative location
`
`Nucleotide substitution
`
`HS080018
`
`IVS1
`
`Acceptor
`
`+1
`
`G-A
`
`Comments: The mutation HBA2 c.96 G > A was found in an Ecuadorian patient with alpha Thalassemia type 2.
`
`Gene symbol: CPDX
`
`Disease: Coproporphyria
`
`Sabrina Ausenda, E. Di Pierro, V. Brancaleoni, D. Tavazzi, M.D. Cappellini
`Milano, Fondazione Ospedale Maggiore Policlinico MA RE- Università degli Studi di Milano, F. Sforza, 35, 20122,
`Milano, Italy, Tel.: +390255033363, Fax: +390250320296, E -mail: labporfirie @policlinico.mi.it
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080111
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`205
`
`gGTG -TTG
`
`Val -Leu
`
`Comments: c.613 G > T.
`
`Springer
`
`Page 14 of 24
`
`

`

`Hum Genet (2009) 126 :329 -352
`
`Gene symbol: HBB
`
`Disease: Haemoglobin variant
`
`343
`
`Chiara Refaldi, Claudia Cesaretti, Maria Rosaria Fasulo, Maria Domenica Cappellini
`Internal Medicine, Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, via Francesco Sforza, 35,
`20122, Milan, Italy, Tel.: +390255033363, E -mail: chiararefaldi @hotmail.com
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080112
`
`Codon number
`
`3
`
`Nucleotide substitution
`
`Amino acid substitution
`
`cCTG -ATG
`
`Leu -Met
`
`Comments: HBB c.10 C > A.
`
`Gene symbol: HBB
`
`Disease: Haemoglobin variant
`
`Chiara Refaldi, Alberto Zanella, Maria Domenica Cappellini
`Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, via Francesco Sforza, 35, 20122, Milan, Italy,
`Tel.: +390255033363, E -mail: chiararefaldi @hotmail.com
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM0801 13
`
`Codon number
`
`103
`
`Nucleotide substitution
`
`Amino acid substitution
`
`cTTC -CTC
`
`Phe > Leu
`
`Comments: The mutation HBE c.310 T > C was found in a heterozygous Italian patient with polycythemia.
`
`Gene symbol: HBA1
`
`Disease: Haemoglobin variant
`
`Chiara Refaldir, Francesca Gensini2, Maria Domenica Cappellini'
`'Internal Medicine, Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, via Francesco Sforza, 35,
`20122, Milan, Italy, Tel.: +390255033363, E -mail: chiararefaldi @hotmail.com.
`2Department of Pathophysiology -Medical Genetics, University of Florence
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080114
`
`Codon number
`
`90
`
`Nucleotide substitution
`
`Amino acid substitution
`
`cAAG -GAG
`
`Lys -Glu
`
`Comments: HBA1 c.271A > G.
`
`Springer
`
`Page 15 of 24
`
`

`

`344
`
`Gene symbol: ABCD1
`
`Disease: Adrenoleukodystrophy
`
`Hum Genet (2009) 126:329 -352
`
`Neeraj Kumar, K.K. Taneja, Veena Kalra, Madhuri Behari, S. Aneja, S.K. Bansal
`Department of Biochemistry, VP Chest Institute, 98919350, 40, 110007, Delhi, India, Tel.: +919891935040, Fax:
`27667420, E -mail: nirwal_niraj @yahoo.co.in
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM080121
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`617
`
`cCGC -AGC
`
`Arg -Ser
`
`Continents: We have submitted this mutation recently in the X -ald database (http: / /www.x- ald.nl). Other mutations also
`found at this position in the ABCD1 gene that results into the substitution of other amino acids. But this novel mutation
`results substitution of arginine to serine identified by our group first time.
`
`Gene symbol: JAG1
`
`Disease: Alagille syndrome
`
`Daniela Marchetti, M.R. Iascone, L. Pezzoli
`Lab. Genetica Moelcolare, Ospedali Riuniti, Largo Barozzi, 1, 24128, Bergamo, Italy, Tel.: +39 -35- 269348, Fax: +39 -35-
`266176, E -mail: dmarchetti@ospedaliriuniti.bergamo.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HMO80I15
`
`Codon number
`
`Nucleotide substitution
`
`Amino acid substitution
`
`702
`
`TGCc-TGA
`
`Cys-Term
`
`Comments: JAG1 gene were analyzed by sequencing of entire coding region. This transversion in exon 16 was found in one
`Italian patient in an heterozygous state. This nonsense mutation was de novo and it truncates the protein at codon 702, which
`is 517 amino acids from the end of the protein. Clinical phenotype: the age at diagnosis was 7 years old. She is a female
`patient with typical features of Alagille syndrome. The histological analysis revealed bile ducts paucity. c.2106C > A.
`
`Gene symbol: JAG1
`
`Disease: Alagille syndrome
`
`Daniela Marchetti, M.R. Iascone, L. Pezzoli
`Lab. Genetica Moelcolare, Ospedali Riuniti, Largo Barozzi, 1, 24128, Bergamo, Italy, Tel.: +39 -35- 269348, Fax: +39 -35-
`266176, E -mail: dmarchetti @ospedaliriuniti.bergamo.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Codon number
`
`885
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TGCc > TGA
`
`Cys-Term
`
`Accession
`
`HMO80I16
`
`Springer
`
`Page 16 of 24
`
`

`

`Hum Genet (2009) 126:329 -352
`
`345
`
`Comments: JAG1 gene were analyzed by sequencing of entire coding region. This transversion in exon 22 was found in
`one Italian patient in an heterozygous state. This nonsense mutation was de novo and it truncates the protein at codon 885,
`which is 334 amino acids from the end of the protein. Clinical phenotype: The age at diagnosis was 1 year. She is a female
`patient with typical features of Alagille syndrome. Liver transplantation was performed when she was 1 year old. The
`histological analysis revealed bile ducts paucity. c.2655C > A.
`
`Gene symbol: JAG1
`
`Disease: Alagille syndrome
`
`Daniela Marchetti, M.R. Iascone, L. Pezzoli
`Lab. Genetica Moelcolare, Ospedali Riuniti, Largo Barozzi, 1, 24128, Bergamo, Italy, Tel.: +39 -35- 269348, Fax: +39 -35-
`266176, E -mail: dmarchetti @ospedaliriuniti.bergamo.it
`
`Input for Missense /Nonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HM0801 17
`
`Codon number
`
`1097
`
`Nucleotide substitution
`
`Amino acid substitution
`
`gCGG -TGG
`
`Arg -Trp
`
`Comments: JAG1 gene were analyzed by sequencing of entire coding region. This transition in exon 26 was found in
`one Italian patient in an heterozygous state. The mutation occurs 122 amino acids from the end of the protein. This
`missense mutation was not found in 480 alleles (healthy blood donors). This variant is predicted to be probably
`damaging (PolyPhen informatic tool) and intolerant (SIFT informatic tool). The aminoacid is conserved during evo-
`lution. The same mutation was found in the mother in heterozygous state. Clinical phenotype: The age at diagnosis was
`4 years. She is a female patient with typical features of Alagille syndrome. The mother shows a very mild phenotype.
`c.3289C > T.
`
`Gene symbol: JAG1
`
`Disease: Alagille syndrome
`
`Daniela Marchetti, M.R. Iascone, L. Pezzoli
`Lab Genetica Moelcolare, Ospedali Riuniti, Largo Barozzi, 1, 24128, Bergamo, Italy, Tel.: +39 -35- 269348, Fax: +39 -35-
`266176, E -mail: dmarchetti @ospedaliriuniti.bergamo.it
`
`Input for MissenselNonsense Mutations (single base -pair substitutions)
`
`Accession
`
`HMO80I18
`
`Codon number
`
`880
`
`Nucleotide substitution
`
`Amino acid substitution
`
`TGTa-TGA
`
`Cys-Term
`
`Comments: JAG1 gene were analyzed by sequencing of entire coding region. This transversion in exon 22 was found in
`one Italian patient in an heterozygous state. This nonsense mutation truncates the protein at codon 880, which is 339 amino
`acids from the end of the protein. The same mutation was found in the father in heterozygous state. Clinical phenotype: The
`age at diagnosis was 2 years. She is a female patient with typical features of Alagille syndrome. Liver transplantation was
`
`Springer
`
`Page 17 of 24
`
`

`

`346
`
`Hum Genet (2009) 126:329 -352
`
`performed when she was