Proc. NatL Acad. Sci. USA
`Vol. 79, pp. 7425-7429, December 1982
`Genetics
`
`Mutant immunoglobulin genes have repetitive DNA elements
`inserted. into their intervening sequences
`(hybridomas/gene, expression/transposable elements/intracisternal-A-particle-related sequences)
`ROBERT G. HAWLEY*t, MARC J. SHULMANtI, HELIOS MURIALDO§, DAVID M. GIBSON$, AND
`NOBUMICHI HOzuMI*t
`*Ontario Cancer Institute and tDepartment of Medical Biophysics, University of Toronto, Toronto, Ontario, Canada M4X 1K9; tRheumatic Disease Unit, Wellesley
`Hospital, Toronto, Ontario, Canada M4Y 1J3; §Department of Medical Genetics, University of Toronto, Toronto, Ontario, Canada M5S 1A8; and ¶Departement
`de Biochimie, Universit6 de Sherbrooke, Sherbrooke, Qu6bec, Canada JLH 5N4
`Communicated by Allan Campbell, September 3, 1982.
`
`ABSTRACT
`The K light chain genes from two mutant hybri-
`doma cell lines defective in K light chain synthesis were isolated
`and compared to the wild-type K light chain gene. In each case,
`the mutant K light chain genes-were found to contain repetitive
`DNA elements-in their intervening sequences that were not pres-
`ent in the intervening sequences of the wild-type K light chain
`gene. These elements were found to be related to the genes of in-
`tracisternal A particles. These results suggest that the decreased
`production of K light chain in the mutant cell lines is due to the
`presence of the intracisternal A particle-related genes.
`
`There are now several examples in which rearrangements of
`eukaryotic DNA are involved in the regulation of gene expres-
`sion. In particular, rearrangements are required for the acti-
`vation of immunoglobulin genes (1-5), the variation of try-
`panosome surface antigens (6, 7), and the switching ofthe yeast
`mating type (8, 9). The enhanced expression of a cellular gene
`due to proviral promoter insertion is also known to occur (10).
`Here we describe DNA rearrangements that have occurred
`in two mutant hybridoma cell lines and that may be responsible
`for the decreased production of the immunoglobulin K light
`chain in these lines. In both cases, we have found repetitive
`DNA segments at the sites of rearrangement. Analysis of these
`repetitive segments indicates that they are related to intracis-
`ternal A particle (IAP) genes and suggests that the reduction in
`K chain synthesis in these mutants is due to the insertion of IAP
`sequences into the intervening sequences ofthe mutant K chain
`genes.
`
`MATERIALS AND METHODS
`Mouse Strains and Cell Lines. Four-week-old females ofthe
`BALB/c strain of Mus musculus were obtained from The Jack-
`son Laboratory.
`X63-Ag8 is a MOPC 21 myeloma cell line (11). The origin of
`the wild-type Sp6 and the mutant hybridoma cell lines igk-1 and
`igk-20 has been described (12). Subclones ofthese mutants, igk-
`1/2-9-2 and igk-20/10-12, were compared here with a subclone
`of the wild-type cell line, Sp603 (12). All cell lines were grown
`as described (12).
`Bacterial and Phage Strains. Escherichia coli K-803 (rk-
`mk-, supE, supF) was obtained from G. Matthyssens for grow-
`ing phage. E. coli NS428, obtained from N. Sternberg, was used
`as a source of extract for in vitro packaging of phage A DNA.
`The cloning vector A Charon 28 was obtained from F. Blattner
`(13). The plasmid pL21-5, used to generate a probe of the K
`chain constant region (Ca,), was donated by R. Wall (14).
`The publication costs ofthis article were defrayed in part by page charge
`payment. This article must therefore be hereby marked "advertise-
`ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.
`
`7425
`
`A
`
`C
`
`b
`
`c
`
`d
`
`B
`
`a
`
`b
`
`c
`
`d
`
`V ww
`
`..#
`- * * * # I,.~~~~0-
`
`A. k
`
`Fi
`
`:..5
`
`23-
`
`9.8-
`
`66-
`
`4 5-
`
`2.1-
`[.9-
`
`FIG. 1.
`Identification of KT
`genes. BamHI-digested DNA (20 ,ug)
`from X63-Ag8 (lanes a), Sp6 (lanes b), igk-1 (lanes c), and igk-20 (lanes
`d) was electrophoresed through a 1% agarose gel at 2 V/cm for 40 hr.
`(A) After transfer to nitrocellulose, the blot was hybridized to a 32p
`labeled probe containing the 3' half of the CK coding region. This probe
`was isolated from the plasmid pL21-5 after digestion with Cfo I and
`Hpa 1 (14). The bands corresponding to fragments containing KTNp C,,
`gene segments are indicated with arrows. (B) The filter in A was
`washed according to Thomas (23) and the blot was rehybridized to a
`32P-labeled probe containing the 5' half of the KTNp VK coding region
`(Fig. 2). The bands corresponding to fragments containing KTNp V
`gene segments are indicated with arrows. Fragment sizes were deter-
`mined by comparison with HindEll-digested A phage DNA as size
`marker (sizes shown in kb).
`
`DNA Isolation, Nitrocellulose Blotting, and Cloning. Cel-
`lular, phage, and plasmid DNAs were isolated by standard tech-
`niques as described (15). The arms ofBamHl-digested A Charon
`28 DNA were isolated by density gradient centrifugation in 10-
`40% sucrose (16). DNA restriction fragments used for 32P-la-
`beled probes, cloning, restriction enzyme mapping, and DNA
`sequence analysis were isolated by preparative agarose or poly-
`acrylamide gel electrophoresis as described (17). Nitrocellulose
`blotting was done according to the method of Southern (18) as
`described (17). Hybridization was carried out by using 32P-la-
`beled probes with a specific activity of 5-10 x 107 cpm/,Lg of
`DNA. Packaging of recombinant DNA was done according to
`the method of Becker and Gold (19), using NS428 as the source
`of packaging extracts. Phage A DNA terminase was obtained
`from A. Becker. Recombinant phages were identified by using
`
`Abbreviations: bp, base pair(s); C region, constant region; IAP, intra-
`cisternal A particle; J segment, joining segment; kb, kilobase pair(s);
`TNP, 2,4,6-trinitrophenyl; V region, variable region.
`
`Mylan v. Genentech
`IPR2016-00710
`Merck Ex. 1119, Pg. 1
`
`

`

`7426
`
`Genetics: Hawley et al.
`the plaque assay procedure of Benton and Davis (20) as de-
`scribed (15).
`DNA Sequence Analysis. DNA fragments were labeled at
`their recessed 3' termini by using [a-32P]dNTPs and reverse
`transcriptase (RNA-dependent DNA nucleotidyltransferase) as
`described (15). Reverse transcriptase was obtained from J.
`Beard. DNA sequences were obtained by using the partial
`chemical degradation technique of Maxam and Gilbert (21) as
`described (15).
`RNA Isolation and Nitrocellulose Blotting. RNA was isolated
`from membrane-bound polyribosomes as described by Marcu
`et aL (22). RNA blotting to nitrocellulose was performed as de-
`scribed.by Thomas (23).
`Amino Acid Sequence Analysis. Immunoglobulin from Sp6
`ascites fluid was purified by ammonium sulfate precipitation.
`After partial reduction and alkylation the KTNP chain was sub-
`jected to NH2-terminal sequence analysis as described by La-
`zure et al. (24).
`Biohazard Containment. All recombinant DNA work was
`done under level B containment as prescribed by the Medical
`Research Council of Canada.
`
`RESULTS
`Identification and Cloning of the Wild-Type KTNp Gene.
`The region of germ-line DNA bearing the K joining (J,,) and
`constant (C,,) gene segments is contained in a 13-kilobase-pair
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`(kb) BamHI fragment (25). Expression ofa Kchain gene requires
`a productive rearrangement thatjoins one ofmany variable (V,,)
`gene' segments to one of the active J,, gene segments (3). As a
`consequence ofV,,-J,, joining, the size ofthe BamHI restriction
`fragment containing the C, gene segment is altered, so that
`digestion with this enzyme can be used to identify fragments
`bearing rearranged K chain genes. The Sp6 hybridoma, the
`wild-type cell line used here, secretes immunoglobulin specific
`for the hapten 2,4,6-trinitrophenyl (TN.P) (12). It was derived
`by fusing the MOPC 21 myeloma cell line X63-Ag8 with spleen
`cells from a BALB/c mouse immunized with TNP, and it pro-
`duces the myeloma K chain as-well as the TNP-specific K chain
`(KTNP). Therefore, the Sp6 cell line is expected to contain at least
`one of the K chain genes of the myeloma parent in addition to
`the K chain genes donated by the spleen cell. To identify the
`fragment bearing the KTNp gene, BamHI-digested DNA from
`X63-Ag8, Sp6, and the mutant cell lines igk-1 and igk-20, which
`are defective in the production of the KTNp chain, was hybrid-
`ized to a probe containing the 3' half of the C,, coding region
`(Fig. lA). 'All lanes were found to contain a 5.4-kb band, which
`corresponds to the productively rearranged myeloma K chain
`gene (26). The 5.9-kb band present in all lanes and the 6.9-kb
`band present in lane a (X63-Ag8) correspond to aberrantly rear-
`ranged K chain genes (27). A band unique to each of the hy-
`bridoma cell lines. was detected at 9.6 kb in lane b (Sp6), 5.2
`kb in lane c (igk-1), and 9.0 kb in lane d (igk-20). These results
`suggested that the 9.6-kb -band corresponds to the wild-type
`
`E
`
`Sp6
`
`-Hi Hp
`II
`
`I
`
`Hp
`Hi
`I L
`
`Bo
`
`Hi
`I
`
`E
`
`Hp
`
`TKI
`
`So-' Hi
`L
`I
`
`P HiBqHp P
`11
`
`89
`
`-
`
`egPXC
`I
`_
`_VYP N
`
`89 fHa
`I1L
`I .
`L
`
`Hf Ac
`I
`
`+If
`Ho
`l I
`
`V
`
`Probe
`
`Av
`-n
`1L
`
`~11
`Hp ag ""\ s~o
`I1
`
`-AK
`
`N Bg
`
`Hi
`I
`
`Hd
`I
`I
`
`Ikb
`
`Ikb
`
`100 bp
`
`igk- 20
`
`Ba
`
`Hp
`
`E Hi
`11
`
`__
`
`-Hi
`
`Ba
`
`Hp
`L
`
`Hi
`
`E
`
`Hp
`
`TK2
`
`Ba
`
`HpHp
`I
`
`P
`
`HpHp E E Hi
`I
`I
`I
`XcCC C
`CCC
`
`By p
`
`I
`
`xc
`
`Hi
`
`"A I
`
`Ikb
`
`I kb
`
`Ba
`HiE Hp BaBa
`Hp
`la I
`I
`I
`I_ 11
`L I
`I~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
`I kb
`
`Hi
`
`Hi
`
`E
`
`Hp
`
`Ba
`
`Hi
`
`p
`
`E
`
`igk- I
`
`11
`B'-1 H
`I
`I
`
`TK 3
`
`P mi-eft P
`I
`I
`I I
`
`89
`
`BP Pi EE E Hp \ Ba
`I
`
`xcc c
`
`x
`
`cc
`
`I kb
`
`Restriction enzyme maps of KTNp genes..The restriction enzyme maps of the cloned KTNp genes, TK1, TK2, and TK3, are shown beneath
`FIG. 2.
`the corresponding KTNP genomic restriction maps. Coding sequences are indicated with solid bars. The restriction map of the VTNP gene segment
`required to generate the DNA sequence of the VTNP coding region (Fig. 3) is shown beneath the TK1 restriction map. The 250'base-pair (bp) HinfI
`fragment used as a VT" region probe is indicated. The foreign sequences in TK2 and TK3 are indicated with-open bars. The distance between the
`two internal BamHI sites in the igk-1 KTNP genomicmap is notknown. The restriction maps of the cloned KTNP genes were obtained by using partial
`and double digestion analysis as-described by Hozumi et al. (28). The genomic restriction maps were constructed by comparing the sizes of bands
`detected in DNA blotting experiments with published maps of the C,, region (29,30) and with the restriction maps of the TK1, TK2, and TKS clones.
`Restriction enzyme abbreviations: Ac, AcC I; Av, Ava II; Ba, BantHI; Bg, Bgl H; C, Cfo I; E, EcoRI; Ha, Hae III; Hd, HindII; Hfj Hinfl; Hi, HindIll;
`Hp, Hpa I; P, Pst I; X, Xba I.
`
`Merck Ex. 1119, Pg. 2
`
`

`

`Genetics: Hawley et aL
`KTNp gene and that this gene has undergone subsequent re-
`arrangements in the mutant cell lines (see below). A fragment
`from Sp6 DNA corresponding to this band was cloned in A
`Charon 28. The restriction enzyme map of this fragment, de-
`noted TKI, is shown in Fig. 2. To confirm that TK1 corre-
`sponded to the KTNp gene, the KTNp chain was isolated from Sp6
`ascites fluid and the sequence of the first 23 amino acids was
`determined. As illustrated in Fig. 3, the sequence agreed with
`that predicted from the translation of the DNA sequence of the
`TK1 VK gene segment. From this analysis the KTNp VK region
`(VTNp) can be classified as a member of the VK-14 group of K
`chains (31). In this case, the VTNp gene segment is joined to the
`15 joining segment.
`Analysis of KTNP mRNA in Mutant Cell Lines. The mutants
`igk-1 and igk-20 were selected because they produce less than
`the normal amount of the KTNp chain. For igk-1, KTNp chain
`production was found to be about 10% of the wild-type Sp6
`level, whereas for igk-20 the KTNP chain was not detected (12).
`
`-20
`MetGZyPheLysMetGZuSeriisThr
`GATCTGAAATACATCAGACCAGCATGGGCTTCAAGATGGAGTCTCATACT
`-10
`GZnAZaPhe Va iPheAZaPheLeuTrpLeuSer
`
`TATTATAACAACTCAAAAGTAATTTATTTAAATAGCTTTTCCTATAGGAA
`
`GCCAATATTAGGCAGACAATGCCATTAGATAAGACATTTTGGATTCTAAC
`
`ATTTGTGTCATGAAATCTTTGTATATGTAAGTGTATACTCATTATCTATT
`
`1
`-4
`GZyVaZAspGZyAspIZeVaZMetThrGZnSerGZnLysP
`TCTGATTGCAGGTGTTGATGGAGACATTGTGATGACCCAGTCTCAAAAAT
`
`10
`20
`heMetSerThrSerVaZGZyAspArgVaZSerIZeThrCyisLysAZaSer
`TCATGTCCACATCAGTAGGAGACAGGGTCAGCATCACCTGCAAGGCCAGT
`
`30
`40
`GZnAsnVaZGZyThrAZaVaZAlZSrpTyrGZnGZnLysProGZyGZnSe
`CAGAATGTGGGTACTGCTGTAGCCTGGTATCAACAGAAACCAGGACAATC
`
`50
`rProLysLeuLeuIZeTyrSe rA ZaSensnArgTyrThrGly Va ZProA
`TCCTAAACTACTGATTTACTCGGCATCCAATCGGTACACTGGAGTCCCTG
`
`70
`60
`spArgPheThrGZySerGlySerGZyThrAspPheThrLeuTh rIZeSer
`ATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGC
`
`80
`90
`AsnMetGZnSerGZuAspLeuAZaAspTyrPheCysGZnGZnTyrSerSe
`AATATGCAGTCTGAAGACCTGGCAGATTATTTCTGCCAGCAATATAGCAG
`
`100
`rTyrProLeuThrPheGZyAZladZyThrLysLeuGZuLeuLysArg
`CTATCCTCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGTAAGT
`
`ACACTT
`
`Nucleotide sequence of the VTNP gene segment. Only the
`FIG. 3.
`coding strand is shown. The corresponding amino acids are shown
`above the nucleotide sequence. Negative numbers refer to the leader
`sequence. The segment beginning at amino acid 1 (Asp) and ending
`with amino acid 23 (Cys) (underlined) corresponds to the first 23 amino
`acids determined by analyzing the mature KTNp chain. The J5 joining
`segment is indicated with a broken line. The sequence was determined
`by analyzing complementary strands and overlapping fragments. The
`sequences of all fragments were determined at least twice.
`
`Proc. Nati. Acad. Sci. USA 79 (1982)
`
`7427
`
`To test if the mutants igk-1 and igk-20 also contain lower than
`normal amounts ofKTNp-specific mRNA, RNA was isolated from
`membrane-bound polyribosomes and analyzed by RNA blotting
`using a V region probe specific for the KTNP gene (Fig. 4). In
`agreement with the measurement of KTNp light chain produc-
`tion (12), the mutant igk-1 was found to produce a reduced
`amount of KTNp-specific mRNA. In contrast, although no KTNp
`chain was detected in igk-20 (12), this cell line was found to
`produce more KTNp-specific mRNA than did igk-1.
`Identification and Cloning of the Mutant KTNP Genes. To
`identify the KTNp genes in igk-1 and igk-20, the DNA blot in Fig.
`1A was washed and rehybridized to the probe containing the
`VTNP gene segment. Several bands common to all lanes were
`seen, presumably reflecting the various members of the VK-14
`group (Fig. 1B). In addition to these bands, DNA from igk-20
`contained a 9.0-kb band that was not present in the DNA from
`the other cell lines (Fig. 1B, lane d). A 9.0-kb band had pre-
`viously been detected with the CK probe (Fig. 1A, lane d), sug-
`gesting that the corresponding 9.0-kb BamHI fragment con-
`tained both the VTNP and the CK gene segments. In the case of
`igk-1, an 8.4-kb band was revealed both by a probe containing
`the VTNP gene segment (Fig. 1B, lane c) and by a probe con-
`taining the germ-lineJK gene segments (data not shown). A band
`at this position was not detected with the CK probe, although,
`as mentioned above, this probe detected a 5.2-kb band (Fig.
`1A; lane c).
`We cloned the 9.0-kb BamHI fragment from igk-20 DNA and
`the 8.4-kb BamHI fragment from igk-1 DNA with A Charon 28.
`These fragments have been designated TK2 and TK3, respec-
`tively. TK2 contains the VTNP and C, gene segments. However,
`comparison ofthe restriction enzyme map of TK2 to the restric-
`tion enzyme map of TK1 revealed a divergence in the TK2 pat-
`tern from the wild-type pattern, beginning approximately 100
`bp upstream of the VTNP gene segment and extending in the 5'
`direction (Fig. 2). Therefore, TK2 does not contain the se-
`quences encoding the KTNP leader sequence or the wild-type
`sequences further upstream. Instead, TK2 contains 4 kb of for-
`eign DNA. Conversely, TK3 contains the VTNP gene segment
`and the wild-type sequences upstream of the VTNP gene seg-
`ment, but it does not contain the CK gene segment. Comparison
`
`a
`
`b
`
`c
`
`d
`
`200 -
`
`N~
`
`FIG. 4. Measurement of KTNp-specific mRNA. RNA (10 ,ug) from
`X63-Ag8 (lane a), Sp6 (lane b), igk-1 (lane c), and igk-20 (lane d) was
`denatured with glyoxal, electrophoresed through a horizontal 1% agar-
`ose gel in 10 mM sodium phosphate buffer at pH 6.9, transferred to
`nitrocellulose as described by Thomas (23), and hybridized to a 32P-la-
`beled probe containing the 5' half of the VTNP coding region (Fig. 2).
`The size in nucleotides is indicated.
`
`Merck Ex. 1119, Pg. 3
`
`

`

`7428
`
`Genetics: Hawley et aL
`
`TK2
`
`P IEX E
`I
`I11
`
`P
`I
`
`Ba
`I
`
`E
`PHi EXE
`11
`11
`
`TK3
`
`P E X E
`XMIAI4 l I
`I L
`
`Probe
`
`Ba
`
`P
`I
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`a
`
`b
`
`c
`
`d
`
`e
`
`f
`
`9.8-
`6.6-
`4.5- I-Ijw "
`
`g
`
`* o
`
`Ikb
`
`P
`Hi
`I I
`
`Ba
`
`X
`
`Ba
`
`2.1i-
`1.9-=
`
`0.49-
`
`**,:
`.1
`
`*
`
`FIG. 5. Comparison of restriction maps of foreign sequences in
`TK2 and TK3 to the restriction map of a cloned LAP gene [A MIA14, from
`Kuff etal. (32)]. For comparison, the restriction map of the TK2 foreign
`sequence indicated in Fig. 2 has been inverted. The BamHI/EcoRI
`fragment from TK3 that was used as a probe in the DNA blotting ex-
`periment shown in Fig. 6 is indicated. Restriction enzyme abbrevia-
`tions are as in Fig. 2.
`
`of TK3 to TK1 indicated that the restriction enzyme pattern of
`TK3 diverged from the wild-type pattern approximately 500 bp
`downstream of the VTNP gene segment (Fig. 2). Therefore, TK3
`also contains a region of foreign DNA. In this case, it consists
`of a 2-kb sequence downstream of the VTNP gene segment.
`To confirm that these rearrangements were not cloning ar-
`tefacts, we constructed restriction enzyme maps of the KTNp
`genes in Sp6, igk-1, and igk-20 from DNA blotting experiments
`using genomic DNA and probes containing the VTNp gene seg-
`ment, the CK gene segment, or the JK gene segments (summa-
`rized in Fig. 2). In each case, the restriction enzyme sites pres-
`ent in the cloned KTNp genes were found to correspond to the
`restriction enzyme sites predicted by the hybridization patterns
`of genomic DNA.
`Analysis of the Sequences Present at the Rearrangement
`Sites in TK2 and TK3. The restriction enzyme maps ofthe for-
`eign sequences present at the rearrangement sites in TK2 and
`TK3 were found to be similar (Fig. 5) and hybridization exper-
`iments confirmed that these sequences were homologous (data
`not shown). Moreover, both of these restriction enzyme maps
`resemble the maps of cloned IAP genes reported by Kuff et al.
`(32), in that the order ofthe restriction enzyme sites is the same
`and the distances between sites are comparable (Fig. 5). Fur-
`ther evidence that these foreign sequences resemble IAP genes
`comes from experiments in which the foreign sequence from
`TK3 was used to probe BALB/c mouse genomic DNA that had
`been digested with various combinations ofrestriction enzymes
`(Fig. 6). The pattern obtained for each of the digestions was
`virtually identical to the pattern obtained by Lueders and Kuff
`after hybridization of similarly digested BALB/c DNA to IAP
`35S RNA (figure 1A of ref. 33). More recently, the presence of
`IAP-related sequences has been confirmed by analysis of het-
`eroduplexes between the foreign sequences in Ti2 and TK3 and
`a cloned IAP gene (E. Kuff and K. Lueders, personal com-
`munication).
`
`DISCUSSION
`We have isolated and characterized the KTNp gene from Sp6,
`a hybridoma that produces TNP-specific immunoglobulin. We
`have also isolated portions of the KTNp genes from the mutants
`igk-1 and igk-20, which are defective in KTNp chain synthe-
`sis. Both mutant genes have undergone rearrangements within
`intervening sequences.
`The fact that igk-1 produces the KTNp chain indicates that the
`VTNp and CK gene segments are still closely linked in the igk-
`1 genome. We attribute the 5.2-kb band detected by the CK
`
`FIG. 6.
`Sequences present in BALB/c mouse DNA homologous to
`TK3 foreign sequence. BALB/c kidney DNA (14 ,ug) was digested with
`various restriction enzymes and electrophoresed through a 1% agarose
`gel at 2 V/cm for 15 hr. After transfer to nitrocellulose, the blot was
`hybridized to a 32P-labeled probe containing a portion of the foreign
`sequence in TK3 (Fig. 5). The restriction enzyme digestions were as
`follows: lane a, EcoRI; lane b, EcoRI/Hindfll; lane c, HindI; lane d,
`HindlI/Xba I; lane e, Xba I; lane f, Xba I/Pst I; lane g,PstI. Fragment
`sizes (shown in kb) were determined as described for Fig. 1.
`
`probe in BamHI-digested igk-1 DNA to the KTNp C,, gene frag-
`ment (Fig. 1A, lane c). The results summarized in Fig. 2 suggest
`the possibility ofcloning an overlapping fragment containing the
`KNp C,, gene segment.
`In the case of igk-20, the KTNp chain has not been detected
`(12). However, the RNA blot analysis indicates that KTNp-spe-
`cific mRNA is produced by this cell line. The reason for the
`inability of this KTNp-specific mRNA to be translated into the
`KTNp chain is not known. In this respect, it will be of interest
`to determine whether this KTNp-specific mRNA contains se-
`quences corresponding to the leader sequence of the KTNp
`gene. DNA blot analysis with a probe corresponding to the
`leader sequence of the KTNp V,, gene segment has revealed a
`band that was present only in BamHl-digested igk-20 DNA
`(data not shown). We interpret this as evidence that the re-
`mainder of the KTNp gene is still present in the igk-20 genome.
`It remains to be determined if the KTNp leader and variable re-
`gion gene segments are closely linked in igk-20 genomic DNA.
`The DNA segments present in TK2 and TK3 at the sites of
`rearrangement appear to be portions of IAP genes. IAP genes
`are retrovirus-like elements that are present in about 1,000 cop-
`ies in the genome ofMus musculus (32-35). They are expressed
`in early embryos (36-38) and in several different cell types, both
`normal and neoplastic (39). In particular, IAPs are present in
`all mouse plasmacytomas (40). Recently, Shen-Ong and Cole
`have reported that IAP genes are amplified in plasmacytoma
`DNA and that the amplified genes are colinear with the pre-
`dominant IAP RNA from the IAPs (41). The predominant spe-
`cies of IAP RNA present in IAPs in Sp6 is not known, but the
`fact that the restriction patterns are different for the two foreign
`DNA segments present in TK2 and TK3 would imply activation
`of at least two different genes. Moreover, it is interesting that
`the IAP-like sequences have not only inserted into different
`intervening sequences in the KTNp gene in each of the mutant
`cell lines but also are in opposite orientations. This difference
`in orientation could be related to the difference in expression
`of the KTNp gene in these cell lines in that IAP transcription
`would be in the same direction as KTNp gene transcription in
`igk-1 and in the opposite direction to KTNp gene transcription
`in igk-20 (42).
`Several groups have observed analogous alterations in gene
`expression due to the insertion of viral sequences into a host
`genome (10, 43, 44). Furthermore, sequences homologous to
`IAP genes have been found flanking a transposed mouse pseu-
`
`Merck Ex. 1119, Pg. 4
`
`

`

`Genetics: Hawley et al.
`dogene (45). However, the role of these sequences in the cre-
`ation of the pseudogene is not clear. The data presented here,
`on the other hand, suggest that LAP-like sequences are respon-
`sible for the defect in KTNp light chain synthesis in the mutant
`hybridoma cell lines igk-1 and igk-20. Further studies should
`allow elucidation of the mechanisms responsible for the inser-
`tion of these sequences into the intervening sequences of the
`mutant KTNP genes and define their role in the alteration of KTNP
`gene expression in the mutant cell lines.
`We thank Nusrat Govindji, Catherine Filkin, and Wendy L. Fife for
`expert technical assistance and Dr. P. Sadowski and Mr. D. Vetter for
`helping us with DNA sequence analysis. This work was supported by
`grants from the Medical Research Council ofCanada, the National Can-
`cer Institute ofCanada, the University of Toronto, the Arthritis Society
`of Canada, and the Allstate Foundation. R.G. H. was supported by a
`studentship of the Medical Research Council of Canada.
`Hozumi, N. & Tonegawa, S. (1976) Proc. Natl. Acad. Sci. USA 73,
`1.
`3628-3632.
`Bernard, O., Hozumi, N. & Tonegawa, S. (1978) Cell 15, 1133-
`1144.
`Seidman, J. G., Max, E. E. & Leder, P. (1979) Nature (London)
`280, 370-375.
`Davis, M. M., Calame, K., Early, P. W., Livant, D. L., Joho,
`R., Weissman, I. L. & Hood, L. (1980) Nature (London) 283,
`733-739.
`Kataoka, T., Kawakami, T., Takahashi, N. & Honjo, T. (1980)
`Proc. Natl Acad. Sci. USA 77, 919-923.
`Pays, E., Van Meirvenne, N., LeRoy, D. & Steinert, M. (1981)
`Proc. Natl. Acad. Sci. USA 78, 2673-2677.
`Bernards, A., Van der Ploeg, L. H. T., Frasch, A. C. C. & Borst,
`P. (1981) Cell 27, 497-505.
`Nasmyth, K. A. & Tatchell, K. (1980) Cell 19, 753-764.
`Strathern, J. N., Spatola, E., McGill, C. & Hicks, J. B. (1980)
`Proc. Natl. Acad. Sci. USA 77, 2839-2843.
`Hayward, W. S., Neel, B. G. & Astrin, S. M. (1981) Nature (Lon-
`don) 290, 475-480.
`K6hler, G. & Milstein, C. (1975) Nature (London) 256, 495-497.
`K6hler, G. & Shulman, M. J. (1980) Eur. J. Immunol. 10, 467-
`476.
`Liu, C.-P., Tucker, P. W., Mushinski, J. F. & Blattner, F. R.
`(1980) Science 209, 1348-1353.
`Wall, R., Gilmore-Hebert, M., Higuchi, R., Komaromy, M.,
`Paddock, G., Strommer, J. & Salser, W. (1978) Nucleic Acids
`Res. 5, 3113-3128.
`Hozumi, N., Wu, G. E., Murialdo, H., Roberts, L., Vetter, D.,
`Fife, W. L., Whiteley, M. & Sadowski, P. (1981) Proc. Natl. Acad.
`Sci. USA 78, 7019-7023.
`Maniatis, T., Hardison, R. C., Lacy, E., Lauer, J., O'Connell,
`C., Quon, D., Sim, G. K. & Efstratiadis, A. (1978) Cell 15, 687-
`701.
`
`2.
`
`3.
`
`4.
`
`5.
`
`6.
`
`7.
`
`8.
`9.
`
`10.
`
`11.
`12.
`
`13.
`
`14.
`
`15.
`
`16.
`
`Proc. Natl. Acad. Sci. USA 79 (1982)
`
`7429
`
`17.
`
`18.
`19.
`
`20.
`21.
`
`22.
`
`23.
`24.
`
`25.
`
`26.
`
`27.
`
`28.
`
`29.
`
`30.
`
`31.
`32.
`
`33.
`
`34.
`35.
`
`36.
`
`37.
`
`38.
`
`39.
`40.
`
`41.
`42.
`
`43.
`44.
`
`45.
`
`Hozumi, N., Hawley, R. G. & Murialdo, H. (1981) Gene 13, 163-
`172.
`Southern, E. M. (1975) J. Mol Biol 97, 503-517.
`Becker, A. & Gold, M. (1975) Proc. Natl Acad. Sci. USA 72, 581-
`585.
`Benton, W. A. & Davis, R. W. (1977) Science 196, 180-182.
`Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65, 499-
`560.
`Marcu, K. B., Valbuena, 0. & Perry, R. P. (1978) Biochemistry
`17, 1723-1733.
`Thomas, P. S. (1980) Proc. Natl. Acad. Sci. USA 77, 5201-5205.
`Lazure, C., Hum, W.-T. & Gibson, D. M. (1981) J. Exp. Med.
`154, 146-155.
`Wilson, R., Miller, J. & Storb, U. (1979) Biochemistry 18, 5013-
`5021.
`Storb, U., Arp, B. & Wilson, R. (1980) Nucleic Acids Res. 8,
`4681-4687.
`Walfield, A. M., Storb, U., Selsing, E. & Zentgraf, H. (1980)
`Nucleic Acids Res. 8, 4689-4707.
`Hozumi, N., Brack, C., Pirrotta, V., Lenhard-Schuller, R. & To-
`negawa, S. (1978) Nucleic Acids Res. 5, 1779-1799.
`Sakano, H., Huppi, K., Heinrich, G. & Tonegawa, S. (1979) Na-
`ture (London) 280, 288-294.
`Schnell, H., Steinmetz, M. & Zachau, H. G. (1980) Nature (Lon-
`don) 286, 170-173.
`Potter, M. (1977) Adv. Immunol 25, 141-211.
`Kuff, E. L., Smith, L. A. & Lueders, K. K. (1981) Mol. Cell. Biol.
`1, 216-227.
`Lueders, K. K. & Kuff, E. L. (1980) Proc. Natl. Acad. Sci. USA
`77, 3571-3575.
`Lueders, K. K. & Kuff, E. L. (1977) Cell 12, 963-972.
`Ono, M., Cole, M. D., White, A. T. & Huang, R. C. C. (1980)
`Cell 21, 465-473.
`Biczysko, W., Pienkowski, M., Solter, D. & Koprowski, H.
`(1973) J. Natl. Cancer Inst. 51, 1041-1051.
`Calarco, P.G. & Szollosi, D. (1973) Nature (London) New Biol
`243, 91-93.
`Chase, D. G. & Pik6, L. (1973) J. Natl Cancer Inst. 51, 1971-
`1973.
`Wivel, N. A. & Smith, G. H. (1971) Int J. Cancer 7, 167-175.
`Dalton, A. J., Potter, M. & Merwin, R. M. (1961)J. Natl. Cancer
`Inst. 26, 1221-1235.
`Shen-Ong, G. L. C. & Cole, M. D. (1982)J. Virol. 42, 411421.
`Cole, M. D., Ono, M. & Huang, R. C. C. (1982) J. Virol. 42,
`123-130.
`Varmus, H. E., Quintrell, N. & Ortiz, S. (1981) Cell 25, 23-35.
`Jenkins, N. A., Copeland, N. G., Taylor, B. A. & Lee, B. K.
`(1981) Nature (London) 293, 370-374.
`Lueders, K., Leder, A., Leder, P. & Kuff, E. (1982) Nature
`(London) 295, 426-428.
`
`Merck Ex. 1119, Pg. 5
`
`