`
`1111111111111111111111111111111111111111111111111111111111111
`US008586610B2
`
`c12) United States Patent
`Wolfgang et al.
`
`(10) Patent No.:
`(45) Date of Patent:
`
`US 8,586,610 B2
`*Nov. 19, 2013
`
`(54) METHODS FOR THE ADMINISTRATION OF
`ILOPERIDONE
`
`2005/0032070 A1
`2008/0166357 A1
`2009/0298880 A1
`
`2/2005 Raimundo eta!.
`7/2008 Golz eta!.
`12/2009 Wolfgang eta!.
`
`(75)
`
`Inventors: Curt D. Wolfgang, Germantown, MD
`(US); Mihael H. Polymeropoulos,
`Potomac, MD (US)
`
`(73) Assignee: Vanda Pharmaceuticals, Inc.,
`Washington, DC (US)
`
`( *) Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by 763 days.
`
`This patent is subject to a terminal dis(cid:173)
`claimer.
`
`(21)
`
`Appl. No.:
`
`11/576,178
`
`(22)
`
`PCTFiled:
`
`Sep.30,2005
`
`(86)
`
`PCTNo.:
`
`PCT /US2005/035526
`
`§ 371 (c)(l),
`(2), ( 4) Date: Mar. 28, 2007
`
`(87)
`
`PCT Pub. No.: W02006/039663
`
`PCT Pub. Date: Apr. 13, 2006
`
`(65)
`
`Prior Publication Data
`
`US 2009/0298880 AI
`
`Dec. 3, 2009
`
`Related U.S. Application Data
`
`(60)
`
`Provisional application No. 60/614,798, filed on Sep.
`30,2004.
`
`(51)
`
`(52)
`
`(58)
`
`(56)
`
`(2006.01)
`(2006.01)
`
`Int. Cl.
`A61K 311445
`C12Q 1168
`U.S. Cl.
`USPC .......................... 514/320; 435/6.11; 435/6.18
`Field of Classification Search
`None
`See application file for complete search history.
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`4,965,188 A
`5,130,238 A
`5,364,866 A
`5,846,717 A
`5,981,174 A
`6,001,567 A
`7,179,597 B2
`200110034023 A1
`2002/0022054 A1
`2002/0127561 A1
`2003/0083485 A1
`2003/0091645 A1
`2003/0144220 A1
`2003/0170176 A1
`2004/0072235 A1
`2004/0091909 A1
`2004/0096874 A1
`2004/0133352 A1
`
`10/1990 Mullis et al.
`7/1992 Malek et al.
`1111994 Strupczewski et a!.
`12/1998 Browet a!.
`1111999 Wolf eta!.
`12/1999 Browet a!.
`2/2007 Woosley
`10/2001 Stanton, Jr. et al.
`212002 Sawada eta!.
`9/2002 Bee eta!.
`5/2003 Milos eta!.
`5/2003 Ahlheim et a!.
`7/2003 Obach
`9/2003 Leyland-Jones
`4/2004 Dawson
`5/2004 Huang
`5/2004 Neville eta!.
`7/2004 Bevilacqua et al.
`
`FOREIGN PATENT DOCUMENTS
`
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`wo
`
`0055624 A2
`0059486 A2
`0149883 A2
`W00179554 A1 *
`0244994 A2
`0250283 A2
`02064141 A1
`03017946 A2
`03020707 A1
`03038123 A2
`03054226 A3
`2004006886 A2
`2004009760 A2
`2004009760 A3
`2006039663 A2
`2008121899 A2
`2008144599 A2
`2010030783 A1
`
`9/2000
`10/2000
`7/2001
`10/2001
`6/2002
`6/2002
`8/2002
`3/2003
`3/2003
`5/2003
`7/2003
`112004
`112004
`112004
`4/2006
`10/2008
`1112008
`3/2010
`
`OTHER PUBLICATIONS
`
`Australian IP, Examination Report dated Nov. 13, 2009, Australian
`Application No. 2005292246, 2 pages.
`Patent Cooperation Treaty, International Search Report and the Writ(cid:173)
`ten Opinion of the International Searching Authority dated Nov. 27,
`2009, International Application No. PCT/US2009/056517, 18 pages.
`Caccia,
`"New Antipsychotic Agents
`for
`Schizophrenia:
`Pharmacokinetics and Metabolism Update", Jul. 2002, pp. 1073-
`1080, Current Opinion in Investigational Drugs, vol. 3, No.7.
`Subramanian, N. et al., "Receptor profile of P88-8991 and P95-
`12113, metabolites of the novel antipsychotic iloperidone," Progress
`in Neuro-Psychopharmacology & Biological Psychiatry, vol. 26, No.
`3, Mar. 15, 2002, pp. 553-560, England.
`Kelleher, J.P. et a!., "Advances in Atypical Antipsychotics for the
`Treatment of Schizophrenia-New Formulations and New Agents,"
`CNS Drugs, ADIS International, Auckland, NZ, vol. 16, No.4, 2002,
`pp. 249-261.
`Bradford, "CYP2D6 allele frequency in European Caucasians,
`Asians, Africans and their decendants," 2002, , pp. 229-243, Ashley
`Publications Ltd. ISSN 1452-2416,Pharmacogenomics 2002 3(2).
`Bertilsson eta!., "Molecular genetics ofCYP2D6: Clinical relevance
`with focus on psychotropic drugs," 2002, pp. 111-122, 2002
`Blackwell Science Ltd.
`Chainuvati eta!., "Combined phenotypic assessment of cytochrome
`p450 1A2, 2C9, 2C19, 2D6, and 3A, N-acetyltransferase-2, and
`xanthine oxidase activities with the"Cooperstown 5+ 1 cocktail, Nov.
`2003, 2 pages, Clin Pharmacol Ther. Nov. 2003; 74(5), National
`Library of Medicine, abstract only.
`Dahl et a!., "Genetic analysis of the CYP2D locus in relation to
`debrisoquine hydroxylation capacity in Korean, Japanese and Chi(cid:173)
`nese subjects," 1995, pp. 159-164, Pharmacogenetics 5.
`
`(Continued)
`
`Primary Examiner- Diana Johannsen
`(74) Attorney, Agent, or Firm- Jayme M. Torelli; Hoffman
`WamickLLC
`
`ABSTRACT
`(57)
`The present invention relates to methods for the identification
`of genetic polymorphisms that may be associated with a risk
`for QT prolongation after treatment with iloperidone and
`related methods of administering iloperidone to patients with
`such polymorphisms.
`
`16 Claims, No Drawings
`
`Vanda Exhibit 2016 - Page 1
`
`
`
`US 8,586,610 B2
`Page 2
`
`(56)
`
`References Cited
`
`OTHER PUBLICATIONS
`Gough et a!., "Identification of the primary gene defect at the
`cytochrome P 450 CYP2D locus," Oct. 25, 1990, pp. 773-776,
`Nature, vol. 374.
`Hanioka et al, "The Human CYP2D Locus Associated with a Com(cid:173)
`mon Genetic Defect in Drug Oxidation: A G 1934-A Base Change in
`Intron 3 of a Mutant CYP2D6 Allele Results in an Aberrant 3' Splice
`Recognition Site," 1990, pp. 994-1001, Am. J. Hum. Genet. 47.
`Jaanson et al., "Maintenance therapy with zuclopenthixol decanoate:
`associations between plasma concentrations, neurological side
`effects and CYP2D6 genotype," 2002, pp. 67-73, Psychopharmacol(cid:173)
`ogy 162.
`Johansson et a!., "Genetic Analysis of the Chinese Cytochrome
`P4502D Locus: Characterization ofVariant CYP2D6 Genes Present
`in Subjects with Diminished Capacity for Debrisoquine Hydroxyla(cid:173)
`tion," Jun. 1994, pp. 452-459, Copyright by The American Society
`for Pharmacology and Experimental Therapeutics, Molecular Phar(cid:173)
`macology, 46.
`Kagimoto et a!., "Multiple Mutations of the Human Cytochrome
`P450IID6 Gene (CYP2D6) in Poor Metabolizers of Debrisoquine,"
`Oct. 1990, pp. 17209-17214, The Journal of Biological Chemistry,
`vol. 265, No. 28.
`Lyamichev et a!., "Polymorphism Identification and Quantitative
`Detection of Genomic DNA by Invasive Cleavage of Oligonucleotide
`Probes," Mar. 1999, pp. 292-296, Nature America Inc., Nature
`Biotechnology, vol. 17.
`McElroy eta!., "CYP2D6 Genotyping as an Alternative to Phenotyp(cid:173)
`ing for Determination of Metabolic Status in a Clinical Trial Setting,"
`Oct. 2000, pp. 1-11, AAPS Pharmsci 2000; 2 (4) article 33 (http://
`www.pharmsci.org/).
`Neville et a!., "Characterization of Cytochrome P450 2D6 Alleles
`Using the Invader System," Jun. 2002, 9 pages, BioTechniques 32,
`pp. S34 -S43.
`Yokota eta!., "Evidence for a New Variant CYP2D6 Allele CYP2D6J
`in a Japanese Population Associated with Lower in Vivo Rates of
`Sparteine Metabolism," 1993, pp. 256-263, Pharmacogenetics 3.
`Jain, "An Assessment of Iloperidone for the Treatment of Schizo(cid:173)
`phrenia," Dec. 2000, 2 pages, Expert Opinion, Summary Expert
`Opinion on Investigational Drugs, vol. 9, No. 12, abstract only.
`Mutlib et al., "Application of Liquid Chromatography/Mass Spec(cid:173)
`trometry in Accelerating the Identification of Human Liver
`Cytochrome P450 Isoforms Involved in
`the Metabolism of
`Iloperidone," May 1998, pp. 1285-1293, The Journal of Pharmacol(cid:173)
`ogy and Experimental Therapeutics, Copyright 1998 by the Ameri(cid:173)
`can Society for Pharmacology and Experimental Therapeutics.
`Unknown, "Home Page of the Human Cytochrome P450 (CYP)
`Allele Nomenclature Committee," from: http:/ /www.cypalleles.ki.
`se/, May 2008 2 pages, printed May 28, 2008.
`
`Wang et al., "G 169R Mutation Diminishes the Metabolic Activity of
`CYP2D6 in Chinese," Mar. 1999, pp. 385-388, Drug Metabolism and
`Disposition, vol. 27, No.3, XP-001036785, ISSN: 0900-9558.
`European Patent Office, Examination Report for Application No.
`05803436.1 dated Apr. 21,2010, 8 pages.
`Fuselli et al., "Molecular diversity at the CYP2D6locus in the Medi(cid:173)
`terranean region," Nov. 2004, pages 916-924, European Journal of
`Human Genetics, vol. 12, No. 11, ISSN: 1018-4813.
`Sachse et al., "Cytochrome P450 2D6 Variants in a Caucasian Popu(cid:173)
`lation: Allele Frequencies and Phenotypic Consequences," Feb.
`1997, pp. 284-295, American Journal of Human Genetics, vol. 60,
`No.2, ISSN: 0002-9297.
`Australian IP, Examination report dated Jan. 12, 2011, Australian
`Application No. 2005292246, 2 pages.
`Patent Cooperation Treaty International Preliminary Report of the
`International Searching Authority dated Mar. 24, 2011, International
`Application No. PCT/US2009/056517, 10 pages.
`Shimada eta!., "Characterization ofBufuralol Hydroxylation Activi(cid:173)
`ties in Liver Microsomes of Japanese and Caucasian Subjects
`Genotyped for CYP2D6," 2001, pp. 143-156, Pharmacogenetics
`2001.
`Johannsen, Office Action Communication for U.S. Appl. No.
`12/208,027 dated Mar. 30,2011,31 pages.
`Patent Cooperation Treaty, Notifcation of Transmittal of the Interna(cid:173)
`tional Search Report and The Written Opinion of the International
`Searching Authority, or the Declaration for PCT/US2005/035526
`dated Aug. 23,2006, 11 pages.
`Patent Cooperation Treaty, Notificaton of Transmittal of the Interna(cid:173)
`tional Preliminary Report on Patentability for PCT/US2005/035526
`dated Jun. 8, 2007, 5 pages.
`European Patent Office, Extended Search Report for Application No.
`05803436.4 dated Feb. 25, 2008, 12 pages.
`European Patent Office, Examination Report for Application No.
`05803436.4 dated May 28, 2008, 1 page.
`Johannsen, Office Communication Restriction Requirement for U.S.
`Appl. No. 12/208,027 dated Jan. 19,2011, 9 pages.
`Johannsen, Office Communication Restriction Requirement for U.S.
`Appl. No. 12/208,027 dated Aug. 31, 2011, 25 pages.
`Johannsen, Diana B., U.S. Appl. No. 12/208,027, filed Sep. 10, 2008,
`Non-final Office Action Dec. 20, 2012, 19 pages.
`Johannsen, Office Action Communication for U.S. Appl. No.
`12/208,027, dated Jul. 3, 2012, 22 pages.
`European Patent Office, European Search Report for Application No.
`EP12164353 dated Aug. 29,2012, 13 pages.
`Sheridan et a!., "Empirical Regioselectivity Models for Human
`Cytochromes P450 3A4, 2D6, and 2C9," Jun. 2007, pp. 3173-3184,
`J. Med. Chern. vol. 50, American Chemical Society.
`Ryan et al., "Non-PCR-Dependent Detection of the Factor V Leiden
`Mutation From Genomic DNA Using a Homogeneous Invader
`Microtiter Plate Assay," 1999, pp. 135-144, Molecular Diagnosis,
`vol. 4, No.2.
`* cited by examiner
`
`Vanda Exhibit 2016 - Page 2
`
`
`
`US 8,586,610 B2
`
`1
`METHODS FOR THE ADMINISTRATION OF
`ILOPERIDONE
`
`CROSS-REFERENCE TO RELATED
`APPLICATIONS
`
`This application is a 35 USC 371 national stage application
`of co-pending International Patent Application No. PCT/
`US2005/035526, filed Sep. 30, 2005, which claims the ben(cid:173)
`efit of U.S. Provisional Application No. 60/614,798, filed
`Sep. 30, 2004, each of which is hereby incorporated herein.
`
`2
`variant prior to the administration of a drug. United States
`Patent Application Publication No. 2004/0072235 to Dawson
`describes a primer set useful in identifying variants of the
`CYP2D6 gene. Similarly, United States Patent Application
`5 Publication No. 2004/0091909 to Huang describes methods
`for screening an individual for variants in the CYP2D6 gene
`and other cytochrome P450 genes and tailoring the individu(cid:173)
`al's drug therapy according to his or her phenotypic profile.
`Finally, United States Patent Application Publication No.
`10 2004/0096874 to Neville eta!. describes methods for identi(cid:173)
`fYing cytochrome P450 variants.
`
`SEQUENCE LISTING
`
`SUMMARY OF THE INVENTION
`
`The sequence listing contained in the electronic file titled 15
`"VAND-0002-US_SeqiD_2009-07-16.txt" created Jul. 16,
`2009, comprising 4 KB, is hereby incorporated herein by
`reference.
`
`BACKGROUND OF THE INVENTION
`
`Several genes associated with drug metabolism have been
`found to be polymorphic. As a result, the abilities of indi(cid:173)
`vidual patients to metabolize a particular drug may vary
`greatly. This can prove problematic or dangerous where an 25
`increased concentration of a non-metabolized drug or its
`metabolites is capable of producing unwanted physiological
`effects.
`The cytochrome P450 2D6 gene (CYP2D6), located on
`chromosome 22, encodes the Phase I drug metabolizing 30
`enzyme debrisoquine hydroxylase. A large number of drugs
`are known to be metabolized by debrisoquine hydroxylase,
`including many common central nervous system and cardio(cid:173)
`vascular drugs. One such drug is iloperidone (1-[4-[3-[4-(6-
`fluoro-1 ,2-benzisoxazol-3-yl)-1-piperidinyl]propoxy ]-3-
`methoxyphenyl]ethanone). Iloperidone and methods for its
`production and use as an antipsychotic and analgesic are
`described in U.S. Pat. No. 5,364,866 to Strupczewski et a!.
`The diseases and disorders that can be treated by administra(cid:173)
`tion of iloperidone include all forms of schizophrenia (i.e., 40
`paranoid, catatonic, disorganized, undifferentiated, and
`residual), schizoaffective disorders, bipolar mania/depres(cid:173)
`sion, cardiac arrhythmias, Tourette's Syndrome, brief psy(cid:173)
`chotic disorder, delusional disorder, psychotic disorder NOS
`(not otherwise specified), psychotic disorder due to a general 45
`medical condition, schizophreniform disorder, and sub(cid:173)
`stance-induced psychotic disorder.
`P88 is an active metabolite of iloperidone. See, e.g., PCT
`W02003020707, which is incorporated herein by reference.
`Among the unwanted physiological effects associated with 50
`an increased concentration of iloperidone or its metabolites is
`prolongation of the electrocardiographic QT interval.
`Mutations in the CYP2D6 gene have been associated with
`a number of drug metabolism-related phenotypes. These
`include the ultra rapid metabolizer (UM), extensive metabo- 55
`lizer (EM), intermediate metabolizer (IM), and poor metabo(cid:173)
`lizer (PM) phenotypes. Where a particular drug is capable of
`producing unwanted physiological effects in its metabolized
`or non-metabolized forms, it is desirable to determine
`whether a patient is a poor metabolizer of the drug prior to its 60
`administration.
`A number of references are directed toward the identifica(cid:173)
`tion of CYP2D6 mutations and their corresponding pheno(cid:173)
`types. For example, United States Patent Application Publi(cid:173)
`cation No. 2003/0083485 to Milos et a!. describes a novel 65
`CYP2D6 variant associated with the PM phenotype and
`methods for assessing whether an individual possesses the
`
`The present invention comprises the discovery that treat-
`ment of a patient, who has lower CYP2D6 activity than a
`normal person, with a drug that is pre-disposed to cause QT
`prolongation and is metabolized by the CYP2D6 enzyme, can
`be accomplishing more safely by administering a lower dose
`20 of the drug than would be administered to a person who has
`normal CYP2D6 enzyme activity. Such drugs include, for
`example, dolasetron, paroxetine, venlafaxin, andiloperidone.
`Patients who have lower than normal CYP2D6 activity are
`herein referred to as CYP2D6 Poor Metabolizers.
`This invention also relates to methods for the identification
`of genetic polymorphisms that may be associated with a risk
`for QT prolongation after treatment with compounds metabo(cid:173)
`lized by the CYP2D6 enzyme, particularly iloperidone or an
`active metabolite thereof or a pharmaceutically acceptable
`salt of either (including, e.g., solvates, polymorphs, hydrates,
`and stereoisomers thereof), and related methods of adminis-
`tering these compounds to individuals with such polymor(cid:173)
`phisms.
`The present invention describes an association between
`35 genetic polymorphisms in the CYP2D6 locus, corresponding
`increases in the concentrations of iloperidone or its metabo(cid:173)
`lites, and the effect of such increases in concentrations on
`corrected QT ( QTc) duration relative to baseline. Any number
`offormulas may be employed to calculate the QTc, including,
`for example, the Fridericia formula (QTcF) and the Bazett
`formula (QTcB), among others. The present invention
`includes any such formula or method for calculating a QTc.
`A first aspect of the invention provides a method for treat(cid:173)
`ing a patient with iloperidone or an active metabolite thereof
`or a pharmaceutically acceptable salt of either, comprising
`the steps of determining the patient's CYP2D6 genotype and
`administering to the patient an effective amount of iloperi(cid:173)
`done or an active metabolite thereof or a pharmaceutically
`acceptable salt of either based on the patient's CYP2D6 geno(cid:173)
`type, such that patients who are CYP2D6 poor metabolizers
`receive a lower dose than patients who are CYP2D6 normal
`metabolizers.
`Another aspect of the invention provides a method for
`treating a patient who is a CYP2D6 poor metabolizer with
`iloperidone or an active metabolite thereof or a pharmaceu(cid:173)
`tically acceptable salt of either, wherein the patient is admin-
`istered a lower dosage than would be given to an individual
`who is not a CYP2D6 poor metabolizer.
`Another aspect of the invention provides a method of treat(cid:173)
`ing a patient with iloperidone or an active metabolite thereof
`or a pharmaceutically acceptable salt of either comprising the
`steps of determining whether the patient is being adminis(cid:173)
`tered a CYP2D6 inhibitor and reducing the dosage of drug if
`the patient is being administered a CYP2D6 inhibitor.
`Another aspect of the invention provides a method for
`determining a patient's CYP2D6 phenotype comprising the
`steps of administering to the patient a quantity of iloperidone
`
`Vanda Exhibit 2016 - Page 3
`
`
`
`US 8,586,610 B2
`
`10
`
`3
`or an active metabolite thereof or a pharmaceutically accept(cid:173)
`able salt of either, determining a first concentration of at least
`one of iloperidone and an iloperidone metabolite in the
`patient's blood, administering to the patient at least one
`CYP2D6 inhibitor, determining a second concentration of at
`least one of iloperidone and an iloperidone metabolite in the
`patient's blood, and comparing the first and second concen(cid:173)
`trations.
`Another aspect of the invention provides a method for
`determining whether a patient is at risk for prolongation of his
`or her QTc interval due to iloperidone administration com(cid:173)
`prising the step of: determining a patient's CYP2D6 metabo(cid:173)
`lizer status by either determining the patient's CYP2D6 geno(cid:173)
`type or CYP2D6 phenotype. In the case that a patient is
`determined to be at risk for prolongation of his or her QTc
`interval, the dose of iloperidone administered to the patient 15
`may be reduced.
`Another aspect of the invention provides a method of
`administering iloperidone or an active metabolite thereof, or
`a pharmaceutically acceptable salt of either, for the treatment
`of a disease or disorder in a human patient comprising the 20
`steps of determining the activity of the patient's CYP2D6
`enzyme on at least one of iloperidone and its metabolites
`relative to the activity of a wild type CYP2D6 enzyme and
`reducing the dose of at least one of iloperidone and its phar(cid:173)
`maceutically acceptable salts if the patient's CYP2D6 25
`enzyme activity is less than that of the wild type CYP2D6.
`Another aspect of the invention relates to modifying the
`dose and/or frequency of dosing with iloperidone or a phar(cid:173)
`maceutically acceptable salt thereof based on the P88:P95
`ratio and/or the (P88+iloperidone):P95 ratio in a blood
`sample of a patient being treated with iloperidone or P88,
`especially patients susceptible to QT prolongation or to harm-
`ful effects associated with QT prolongation.
`Another aspect of the invention provides a kit for use in
`determining a CYP2D6 genotype of an individual, compris(cid:173)
`ing a detection device, a sampling device, and instructions for 35
`use of the kit.
`Another aspect of the invention provides a kit for use in
`determining a CYP2D6 phenotype of an individual, compris(cid:173)
`ing a detection device, a collection device, and instructions
`for use of the kit.
`Another aspect of the invention provides a kit for use in
`determining at least one of a P88 to P95 ratio and a P88 and
`iloperidone to P95 ratio in an individual, comprising a detec(cid:173)
`tion device, a collection device, and instructions for use of the
`kit.
`Yet another aspect of the invention provides a method for
`commercializing a pharmaceutical composition comprising
`at least one of iloperidone, a pharmaceutically acceptable salt
`of iloperidone, an active metabolite of iloperidone, and a
`pharmaceutically acceptable salt of an active metabolite of
`iloperidone, said method comprising: obtaining regulatory
`approval of the composition by providing data to a regulatory
`agency demonstrating that the composition is effective in
`treating humans when administered in accordance with
`instructions to determine whether or not a patient is a
`CYP2D6 poor metabolizer prior to determining what dose to
`administer to the patient; and disseminating information con(cid:173)
`cerning the use of such composition in such marmer to pre(cid:173)
`scribers or patients or both.
`The foregoing and other features of the invention will be
`apparent from the following more particular description of
`embodiments of the invention.
`
`30
`
`4
`Data from placebo-controlled Phase III studies of iloperidone
`showed a Fridericia correction of QT duration (QTcF)
`increase of 0.1 to 8.5 msec at doses of 4-24 mg, when com(cid:173)
`paring a single ECG at baseline to a single ECG at endpoint.
`At lower doses ofiloperidone (4 mg-16 mg) QTcF prolonga(cid:173)
`tion was minimal (0.1-5 msec). In the most recent study, a
`greater prolongation was observed when higher doses of ilo(cid:173)
`peridone (20-24 mg/day) were studied. The mean change in
`the QTcF at doses 20-24 mg/day was 8.5 msec, and 4.6 msec
`in the 12-16 mg/day dose range in this study. These data
`suggest that treatment with iloperidone can be associated
`with prolongation of the QT interval similar to other drugs in
`this class, and that the effect may be dose sensitive in the
`clinical dose range.
`The research leading to the present invention was designed
`to examine the effect of different doses of iloperidone relative
`to the effect of ziprasidone and quetiapine on QTc duration
`under carefully controlled conditions. To further evaluate the
`possible relationship between exposure to iloperidone and the
`comparators to QTc duration, reassessment after pharmaco(cid:173)
`logical inhibition of the principle metabolic pathways for
`each drug, under steady-state conditions, was also planned.
`Blood samples for pharmacogenetic analysis were col(cid:173)
`lected at screening. Two polymorphisms previously associ(cid:173)
`ated with poor metabolizing status were genotyped in the
`CYP2D6locus and 251 genotypes were collected. The indi-
`vidual genotypes were studied for detection of association
`between genotype class and concentrations of iloperidone
`and its metabolites P88 and P95. The functional effect of the
`polymorphisms was also evaluated by analyzing the effect of
`the addition of the CYP2D6 inhibitor paroxetine on the con-
`centrations of the parent drug and its metabolites.
`The research leading to the present invention identified a
`significant association between CYP2D6 genotype and con(cid:173)
`centrations ofP88 before the addition of inhibitors as well as
`the effect of this association on QTc prolongation.
`Iloperidone is a substrate for two P450 enzymes; CYP2D6
`and CYP3A4. Most metabolic clearance of iloperidone
`depends on these two enzymes. CYP2D6 catalyzes hydroxy-
`40 lation of the pendant acetyl group to form metabolite P94,
`which is converted to P95 after some additional reactions.
`Addition of the CYP2D6 inhibitor fluoxetine, along with
`iloperidone resulted in increases of the area under the curve
`(AU C) for iloperidone and P88 of 131% and 119% respec-
`45 tively. Addition of the CYP3A4 inhibitor ketoconazole in
`interaction studies resulted in a 38-58% increase in the con(cid:173)
`centrations of iloperidone and its main metabolites P88 and
`P95. P88 has a pharmacological profile including affinity for
`the HERG charmel similar to that of iloperidone. P95 is less
`50 lipophilic and is dissimilar in its binding profile compared to
`iloperidone, including having very low affinity for the HERG
`channel. For these reasons P95 is regarded as being pharma(cid:173)
`cologically inactive.
`The addition of metabolic inhibitors in this study therefore
`55 allowed for an evaluation of the effect of increasing blood(cid:173)
`concentration of iloperidone and/or its metabolites on QT
`duration. More specifically, this study allowed for an evalu(cid:173)
`ation of the effect ofiloperidone on QTc before and after the
`addition of the CYP2D6 inhibitor, paroxetine, as well as
`60 before and after the addition of the CYP3A4 inhibitor, keto(cid:173)
`conazole.
`The CYP2D6 gene is highly polymorphic, with more than
`70 allelic variants described so far. See, e.g., http://www.
`imm.ki.se/CYPalleles/cyp2d6.htm. Most embodiments of
`65 the present invention concern the two most common poly(cid:173)
`morphisms within the CYP2D6 gene in Caucasian popula(cid:173)
`tions, CYP2D6G1846A and CYP2D6P34S (also referred to
`
`DETAILED DESCRIPTION OF THE INVENTION
`
`Iloperidone is a benzisoxazole-piperidinyl derivative, cur(cid:173)
`rently in development for the treatment of CNS disorders.
`
`Vanda Exhibit 2016 - Page 4
`
`
`
`US 8,586,610 B2
`
`5
`
`15
`
`20
`
`6
`PCR products using the Invader® assay (Lyamichev 1999)
`(Third Wave Technologies, Inc) according to the manufactur(cid:173)
`er's recommendations.
`The genotypes of individuals distributed among the three
`iloperidone groups were not significantly different (Table 1A
`and 1B).
`
`TABLE 1A
`
`Genotype frequencies by iloperidone dose class for CYP2D6C100T
`
`Iloperidone
`
`dose group
`
`Ilo 8 mg bid
`Ilo 12 mg bid
`Ilo 24mg qd
`
`Total
`
`anumber of individuals
`
`Genotype
`
`CT
`
`2
`
`14
`
`cc
`
`19a
`23
`15
`
`57
`
`TT
`
`Total
`
`1
`
`-
`
`22
`30
`22
`
`74
`
`TABLE 1B
`
`Genotype frequencies by iloperidone dose class for CYP2D6G 1846A
`
`Iloperidone
`
`Genotype
`
`dose group
`
`AA
`
`AG
`
`GG
`
`Total
`
`Ilo 8 mg bid
`Ilo 12 mg bid
`Ilo 24mg qd
`
`Total
`
`0
`
`1
`
`2
`
`17
`23
`15
`
`55
`
`20
`30
`21
`
`74
`
`14
`
`5
`as CYP2D6C100T. These polymorphisms correspond to
`nucleotides 3465 and 1719, respectively, in GenBank
`sequence M33388.1
`(GI:181303). The CYP2D6P34S/
`CYP2D6C100T polymorphism also corresponds to nucle(cid:173)
`otide 100 in GenBank mRNA sequence M20403.1 (GI:
`181349).
`The CYP2D6G 1846A polymorphism (known as the
`CYP2D6*4 alleles, encompassing *4A, *4B, *4C, *4D, *4E,
`*4F, *4G, *4H, *4J, *4K, and *4L) represents a G to A
`transition at the junction between intron 3 and ex on 4, shifting 10
`the splice junction by one base pair, resulting in frameshift
`and premature termination of the protein (Kagimoto 1990,
`Gough 1990, Hanioka 1990). The CYP2D6P34S/
`CYP2D6C100T polymorphism (known as the CYP2D6*10
`and CYP2D6*14 alleles) represents a C to T change that
`results in the substitution of a Proline at position 34 by Serine
`(Yokota 1993, Johansson 1994). Both of these polymor(cid:173)
`phisms have been associated with reduced enzymatic activity
`for different substrates (Johansson 1994, Dahl1995, Jaanson
`2002, see also review by Bertilsson 2002)
`Methods
`A. Samples
`128 individuals consented to the pharmacogenetic study.
`Blood samples were collected according to the pharmacoge(cid:173)
`netics protocol and after the consent of patients. The DNA 25
`was extracted from whole blood by Co vance using the PURE(cid:173)
`GENE DNA isolation kit (D-50K).
`The 128 individuals that participated were a good repre(cid:173)
`sentation of the total sample of 165 individuals that partici(cid:173)
`pated in the trial. 22 of 29 total were from the iloperidone 8 30
`mg bid group, 30 of34 were from the iloperidone 12 mg bid
`group, 22 of 31 from the 24 mg qd group, 3 of 5 of the
`risperidone group, 28 of33 of the ziprazidone group, and 23
`of33 of the quetiapine group.
`B. Genotyping
`Genotypes for the CYP2D6G1846A polymorphism were
`ascertained for 123 of the 128 consenting individuals, while
`genotypes for the CYP2D6C1 OOT polymorphism were iden(cid:173)
`tified for all128 participants. Genotyping was performed on
`amplified DNA fragments. The CYP2D6 genomic region was 40
`amplified using a triplex PCR strategy (Neville 2002). In
`brief, primers used were:
`
`35
`
`C. Statistical Analysis
`The genotype effect of the two CYP2D6 polymorphisms
`on period 1 concentrations was evaluated using the following
`AN OVA model. Concentrations of iloperidone, P88, and P95
`at Period 1, without inhibitor, at the time at which maximum
`blood concentration of the parent compound or metabolite
`was reached (Tmax) were used as the dependent variable, the
`genotypes of each polymorphism as classes and the treatment
`as a covariate. In order to adjust for treatment effects after the
`single dose ofiloperidone, the 8 mg bid was coded as 8, the 12
`mg bid as 12 and the 24 mg qd as 24.
`The function of these polymorphisms on the degree of
`inhibition of the CYP2D6 enzyme was calculated from the
`ratio of concentrations of P88 and P95 in period 2, after the
`addition of the inhibitor ofCYP2D6. The concentrations of
`50 iloperidone and/or its metabolites (e.g., P88 and P95) may be
`determined in period 1 and/or period 2 by any known or
`later-developed method or device, including titration.
`Results and Discussion
`In order to understand the functional significance of the
`55 two CYP2D6 polymorphisms on the activity of the enzyme,
`we examined the association of the various genotypes with
`the relative concentrations of the metabolites P88 and P95. It
`is known that P88 is degraded by CYP2D6 and that CYP2D6
`is involved in the synthesis of P95. The relative amounts of
`60 P88 and P95 would therefore be controlled by the activity of
`the CYP2D6 enzyme. We calculated the ratio of P88/P95
`before inhibition in Period 1 and at the Tmax of the two
`metabolites, as well as the ratio ofP88/P95 in Period 2 after
`the addition of the CYP2D6 inhibitorparoxetine. In individu-
`65 als with the wild type enzyme the concentration of P88 is
`expected to increase in Period 2, while in the same period the
`concentration ofP95 is expected to decline.
`
`45
`
`Exons 1 & 2
`
`Exons 3, 4, 5 &
`
`Exons 7, 8 & 9
`
`2D6L1Fl,
`SEQ ID. 1
`2D6L1Rl,
`SEQ ID. 2
`
`2D6L2F,
`SEQ ID. 3
`2D6L2R2,
`SEQ ID. 4
`
`CTGGGCTGGGAGCAGCCTC
`
`CACTCGCTGGCCTGTTTCATGTC
`
`CTGGAATCCGGTGTCGAAGTGG
`
`CTCGGCCCCTGCACTGTTTC
`
`GAGGCAAGAAGGAGTGTCAGGG
`
`2D6L3F,
`SEQ ID. 5
`2D6L3R5B, AGTCCTGTGGTGAGGTGACGAGG
`SEQ ID.
`
`Amplification was performed on 40-100 ng of genomic
`DNA using a GC-rich PCR kit (Roche Diagnostics, Man(cid:173)
`nheim, Germany) according to the manufacturer's recom(cid:173)
`mendations. Thermocycling conditions were as follows: ini(cid:173)
`tial denaturation (3 min 95° C.), 10 cycles of 30 s of
`denaturation (30 sat 95° C.), annealing (30 sat 66° C.), and
`extension, (60s at no C.) followed by 22 cycles: 30 sat 95°
`C., 30 s at 66° C., 60 s+5 s/cycle at no C. A final extension
`followed (7 min at no C.).
`Third Wave Technologies, Inc (Madison, Wis.) developed
`the probe sets for genotyping. Genotyping was performed on
`
`Vanda Exhibit 2016 - Page 5
`
`
`
`US 8,586,610 B2
`
`7
`For Period 1 the mean P88/P95 ratio among the 91 iloperi(cid:173)
`done treated patients was equal to 1.0 with a range from 0.14
`to 8.19. Among the same individuals for Period 2 the mean
`ratio was 2.4 with a range from 0.5 to 8.49. The mean ratio of
`the ratios Period !/Period 2 was equal to 0.37 with a range
`from 0.11 to 2.75.
`Among the genotyped individuals the values were similar
`with means of 1, 2.45 and 0.37 for Period 1, Period 2 and
`Period !/Period 2 respectively, indicating no sample bias. For
`polymorphism CYP2D6G1846A the means were signifi(cid:173)
`cantly different between the three-genotype classes AA, AG
`and GG. For AA the respective values were 6.1, 3.41, and
`1.89, for AG they were 2.4, 4.2, and 0.52 and for GG 0.57,
`1.94 and 0.28 (Table 2).
`
`TABLE2
`
`Ratios ofP88, P95 concentrations according to genotype
`
`8
`TABLE4
`
`Ratios ofP88, P95 concentrations according to genotype
`
`Popu-
`
`lation
`
`P88/P95
`
`Period!
`
`P88/P95
`
`Period 2
`
`P88/P95
`
`(Periodl/Period2)
`
`All
`
`1.0 (0.14-8.19)
`
`2.45 (0.50-8.49)
`
`0.37 (0.11-2.75)
`
`10
`
`15
`
`cc
`CT
`
`TT
`
`CYP2D6ClOOT
`
`0.6 (0.14-2.28)
`
`1.93 (0.52-4.71)
`
`0.27 (0.11-0.61)
`
`2.2 (0.44-7.0)
`
`4.14 (2.2-7.57)
`