Clin. exp. Immunol. (1988) 71, 508-516
`
`Production of heavy-chain class-switch variants of human
`monoclonal antibody by recombinant DNA technology
`
`SHINJI KOMORI, NORIYUKI YAMASAKI, MINORU SHIGETA*, SHINZO lSOJIMA* & TAKESHI
`WATANABE Department of Molecular Immunology, Medical Institute of Bioregulation, Kyushu University, Fukuoka, and
`* Department of Obstetrics and Gynecology, Hyogo Medical College, Hyogo, Japan
`
`(Acceptedfor publication 22 September 1987)
`
`SUMMARY
`
`We have previously established a human—mouse heterohybridoma (H6-3C4), which produced a
`human sperm-immobilizing antibody ()1, A of human type). The human rearranged immunoglobulin
`it-chain and ).-chain genes were cloned from the hybridoma H6-3C4. The cloned V region of the
`heavy chain (VH) gene was ligated to human immunoglobulin y,-heavy chain constant region (Cyl)
`genes. This resulted in the heavy-chain class-switch from p-chain to yl-chain of H6-3C4 antibody.
`The class-switched heavy-chain gene as well as the cloned /l-chain gene were introduced into mouse
`myeloma cell line X63Ag8.653 by protoplast fusion and electroporation. The stable transformants
`produced the human IgG monoclonal antibody, which fully retained specificity to human spemi cells
`and sperm-immobilizing activity.
`
`recombinant DNA technology heavy chain class-switch
`Monoclonal antibody
`Keywords
`anti-spenn antibody sperm immobilization
`
`INTRODUCTION
`
`lmmunoglobulin molecules are encoded by three unlinked gene
`families, two light chain genes, kappa(i<) and lambda(A), and a
`heavy chain gene. Each chain is composed of variable (V) region
`and constant (C) region. The V region of the heavy chain (VH) is
`encoded by three distinct gene segments; VH, DH(diversity) and
`JH(ioining). The C region of heavy chain (CH) is encoded by Cp,
`C6, Cy, Ca and Ca. During B cell development, these gene
`segments are brought together to form a complete immunoglo-
`bulin gene (Tonegawa, 1983). Recently, novel antibody mole-
`cules, which are composed of a mouse V region and a human C
`region, have been constructed. They retained the antigen
`specificity of the original mouse antibodies(Morrison et al.,
`1984; Boulianne, Hozumi & Shulman, 1984; Neuberger et al.,
`1985; Sahagan et al., 1986; Nishimura et al., 1987). In these
`cases, a V” and/or a V._ gene was cloned from the mouse
`hybridoma cells which secreted a useful monoclonal antibody.
`The cloned mouse VH and/or V,_ gene was then ligated to a
`human constant region gene by the recombinant DNA tech-
`nique. Since the V region gene can be joined to any C region gene
`by this technique, it is possible to replace a C region gene with
`
`Correspondence: Takeshi Watanabe, Department of Molecular
`Immunology, Medical Institute of Bioregulation, Kyushu University,
`Maidashi 3-l-1, Higashi-ku, Fukuoka 812, Japan.
`
`any other C gene of appropriate heavy chain isotype to obtain
`the desired biological effect or function.
`We have previously established a human—mouse heterohy-
`bridoma, which produced a human IgM class antibody to
`human-sperm-coating antigen (Isojima et al., 1987). However,
`most of the naturally-occuring antibodies to human sperm anti-
`gens belong to the IgG class and exhibit the immobilization of
`spenn in vaginal exudates, which may result in sterility (Isojima,
`Li & Ashitaka, 1968). In human—mouse heterohybridomas,
`human chromosomes carrying immunoglobulin genes may
`often be lost from the hybrid cells during culture. To stabilize the
`genes coding for antibody molecules to human sperm antigen
`and to make IgG class monoclonal antibodies, the immuno-
`globulin genes were cloned from the heterohybridomas and
`human monoclonal IgM class antibody was class-switched to
`IgG by recombinant DNA technology. In the present study, we
`have isolated the human rearranged immunoglobulin [1 and A
`genes from the human—mouse heterohybridoma (H6-3C4),
`which produced a human antibody to human-sperm-coating
`antigen. The H6-3C4 monoclonal antibody could immobilize
`human sperm in the presence of complement (Isojima et al.,
`1987). The V region gene of the cloned H6-3C4 it-heavy chain
`gene was joined to the human Cy. region gene, which had been
`cloned from the human plasma cell leukaemia line, ARH-77
`(Kudo et al., 1985). The reconstructed genes contained a human
`heavy-chain enhancer region DNA in J-C intron as a heavy
`chain gene-expression control element (Gillies et al., 1983;
`
`Genzyme Ex. 1043, pg 950
`
`Genzyme Ex. 1043, pg 950
`
`

`
`A class—switched recombinant monoclonal antibody
`
`-kflndlfl
`\Ps’tI
`|—+—+—I———+-I-Iv—I——iII+—t——|
`
`\BamHI/Pstl
`
`-_.
`-.0
`
`Qm
`
`I" <L
`
`OF
`
`l—-4
`tkbp
`
`Fig. 1. Restriction map of DNA clones of 3C4VH and 3C4L2. Closed boxes indicate exons. the clone 3C4V“ is 8-2 kb in length and
`contains a functional rearranged V region gene. The clone 3C4L2 is 5-6 kb in length and contains functional rearranged V). and C}.
`genes. L, leader sequence; V, variable region; D, diversity segment; J, joining segment; C, constant region.
`
`Banerji, Olson & Schaffner, 1983; Queen & Baltimore, 1983).
`The cloned H6-3C4 A-light chain gene was also joined to the
`human heavy chain enhancer region DNA as a light chain gene-
`expression control element. This novel heavy chain gene was
`integrated into the pSV2gpt vector and transfected into the
`mouse myeloma cell line, X63Ag8.653. The resultant stable
`transfoimants, which produced human y-heavy chain, were
`then transfected with the A-chain gene derived from the H6-3C4
`hybridoma. The stable transfonnants ‘obtained after selection
`produced human IgG molecules (vi, 1), which showed human-
`sperrn-immobilizing activity.
`
`MATERIALS AND METHODS
`
`Southern blot analysis
`DNA was digested by restriction enzymes, electrophoresed on a
`0-7% agarose gel and blotted onto nitrocellulose filters. The
`
`filter was hybridized with "P-labelled DNA probes overnight at
`65°C in 10 x Denhardt’s solution, 1 M NaCl, 10 mM EDTA, 50
`mM Tris HC1 (pH 7-4) and 01% SDS. After hybridization, the
`filter was washed with 2 x SSC and 0- l % SDS at
`room
`temperature for 10 min, and with 0-1 X SSC and 0‘l°/0 SDS at
`65°C for 10 min before autoradiography.
`
`Genomic cloning
`High molecular weight DNA was prepared from the human-
`mouse heterohybridoma H6-3C4, which produced a human-
`sperm-immobilizing antibody (Isojima et al., 1987). The DNA
`was digested with Hindlll endonuclease and size-fractionated
`by a sucrose density gradient. Centrifugation was carried out at
`100,000 g for 16 h at 15°C. The DNA fractions in 8-10 kb size
`(containing heavy chain genes) and 5-6 kb size (containing light
`chain genes) were respectively ligated into 1 phage Charon 28.
`
`Genzyme Ex. 1043, pg 951
`
`Genzyme Ex. 1043, pg 951
`
`

`
`Shinji Komori et al.
`
`GGGTTTGGTGAGGGGAGGCCACAGGAAGAGAACTGAGTTCTCAGAGGGCA-CAGCAGCATACACCTCCCA
`ii_iiiiIt-i¢*i_fittitittiiiiiiiitGTtiiiiti*ii__-*icAficttiiiiiiit*iitit
`
`GGGTGAGCCCAAAAGACT-GGGGCCTCCCTCCATCCCTTTTTACCTATCCATACAAAGGCACCACCCACA
`iiiiiiiitfiifiiitiitciiiitiiiifii_ifititiitititiiiciiii*fi*i**iifiiiififitii?
`
`70
`
`140
`
`210
`
`TGCAAATCCTCACTTAGGCACCCACAGGAAATGACTACACATTTCCTTAAATTCAGGGTCCAGCTCACAT
`T«l'IT~l1T*tatit1:1--kt-kmtatatat1:atan:atat1:at1:-kt-I:-kTi'7l1'-Ea****~A-at-aA*******-A:-k-kit-:1-111-‘F
`
`Leader
`‘I9
`L
`L
`F
`F
`L
`H
`H
`K
`M
`GGGAAGTGCTTTCTGAGAGTCATGGACCTCCTGCACAAGAACATGAAACACCTGTGGTTCTTCCTCCTCC
`iifiticiiiitii-i*iitit*i**iiii*t*iiiiiiiiitiiitiittiitiiiiitciiiiiiii_
`
`280
`
`R
`P
`A
`A
`V
`L
`TGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGAATGCGGATATGAAGATATGAGATGCTGCCTCTGATCC
`iiiiiriiiiiiiiiiiiifiiittiiiiiiCCiiifiitttitttfittttiiifififififliififitiitttit
`
`350
`
`'4—Leader
`
`H V
`CAGGGCTCACTGTGGGTTTCTCTATTCACAGGGGT --------------------------------- --
`***********************G***********AGTGTCTCACCAATGCGGATATGAAGATATGAGAT
`
`420
`
`Leader
`
`v
`
`V reg1’on_
`
`0490
`L
`0
`V
`0
`S
`L
`----------------------------------------------- --CCTGTCCCAGGTGCAGCTACA
`GCTGCCTCTGATCCCAAGGCTCACTGTGGGTTTCTCTGTTCACAGGGGT*********************
`
`S 560
`G
`6
`Y
`V
`D
`C
`T
`L
`S
`L
`T
`E
`S
`P
`K
`L
`L
`G
`A
`G
`N
`Q
`GCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACTTGCGATGTCTATGGTGGGTCC
`ciifiiiiiiiiftiiiiii-it*iiiiiiiiitiitiiiitttttiticiiticiiiiiTii**ftfiii
`
`I 630
`E
`G
`I
`H
`E
`L
`G
`K
`G
`P
`P
`Q
`R
`I
`H
`S
`H
`Y
`Y
`G
`S
`F
`TTCAGTGGTTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGG-CTGGAGTGGATTGGGGAAATC
`iiiiittiitiiiiiittiiciffiiitit*tti*i*iittiiiitiffA*ii*tiiiitii*fiAt*ii*i
`
`S700
`T
`D
`V
`S
`I
`T
`V
`R
`S
`R
`L
`S
`P
`N
`Y
`N
`T
`S
`G
`S
`H
`N
`AATCATAGTGGAAGCACCAACTACAACCCGTCCCTCAGGAGTCGA--GTCACCATATCAGTAGACACGTC
`**ii**ti*ittiiii****Tiit*tAA*tt****iiAtii**i*TA*iiii*it**iTT*iiiii#*i*
`
`— —— ———
`
`V region
`
`R 770
`A
`C
`Y
`Y
`V
`A
`T
`D
`A
`A
`T
`V
`S
`R
`L
`K
`L
`S
`F
`0
`N
`K
`CAAGAATCAGTTCTCCCTGAAGCTGAGGTCTGTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGA
`iiiiiiciTi*i*ii*iitiiififii*iCiiiiitiitiiiiitiiiiiiiiitfiieiiiiitiiiiiite
`+98
`D reg1'on___jT1°8___:_:J5 region
`Y 840
`G
`L
`V
`M
`F
`6
`R
`G
`I
`M
`H
`N
`Y
`Y
`Y
`M
`D
`V
`H
`G
`GGCTTTAT--GGTTCGG--GGAATTATGTGGAACTACTACTAC---ATGGACGTCTGGGGCAAAGGGACC
`iiiciccicc**GGGi*cTit*tcG*cii*i*-*ifi**t*tiTGGT***ttii*ttit*i*c****tit*
`+124
`
`P
`S
`V
`Y
`V
`Y
`3C4 ACGGTCACCGTCTCCCCAGGTAGGAATGGCCACTTCTAGGGCCTTTGTTTTGTGCAACTGCCTGTGGGGT
`H16 itiiiifitiiitiiiTfi*i****ti*iiii****-itif**it*it*tfiiic§i*TC***T*tticiA*i
`
`910
`
`Fig. 2. Nucleotide sequences and predicted amino acid sequences of the V region of H6-3C4 monoclonal antibody. (a) Nucleotide
`sequences and predicted amino acid sequences of the V region of 3C4VH gene and HIGI gene. HIGI gene was isolated from a human
`plasmacytoma cell line, ARH-77 (Kudo et al., 1985). The V region gene of 3C4VH showed high homology with that of HIGI gene.
`"‘3C4VH gene was identical to HIG1 gene. Dashed lines show deletion. (b) Nucleotide sequences and predicted amino acid sequences of
`3C4VL. The C region of 3C4L2 gene is not shown. But according to the nucleotide sequence, the C region of 3C4L2 was identical to
`germline C/12. Amino acid residues are designated by one letter code.
`
`Genzyme Ex. 1043, pg 952
`
`Genzyme Ex. 1043, pg 952
`
`

`
`A class-switched recombinant monoclonal antibody
`
`511
`
`After packaging, the resulting recombinant phage libraries were
`screened with the “P-labelled human JH probe or with the "P-
`labelled human C12 probe.
`
`Nucleotide sequences
`Selected phage DNA molecules were recloned into pBR322
`vectors and subcloned into the M13 phage vectors, mp18 and
`mpl9. They were sequenced by dideoxy chain termination
`methods (Sanger, Nichklen & Coulson, 1977).
`
`Construction of recombinant lg genes
`A recombinant heavy chain gene was constructed by ligating the
`V“ gene of the H6-3C4 hybridoma to the human Cy. gene, which
`had been isolated from the ARH-77 cells (Kudo et al., 1985). A
`human heavy chain enhancer region (Mlul-Hpal fragment) was
`contained in the C32, gene fragment (Mlul-BamHI) (Fig. 3a). A
`human heavy chain gene enhancer was also ligated upstream of
`
`the cloned /'.-light chain gene as shown in Fig. 3b. The
`recombinant heavy chain gene (ECoRI-BamHI fragment, 15
`kb) was inserted into the EcoRI and BamHI sites of pSV2gpt
`vector (Mulligan & Berg, 1981) (pSV2-SIGl). Through linker
`conversion, the recombinant light chain gene was inserted into
`the EcoRI site of pSV2neo vector (Southern & Berg, 1982)
`(pSV2-SI-A-E).
`
`DNA transfection
`Protoplast fusion (Sandri-Goldin, Goldin & Levine, 1982) and
`electroporation (Potter, Weir & Leder, 1984) were used to
`transfect the recombinant immunoglobulin genes (pSV2-SIGI,
`pSV2-SI-AE) into the mouse myeloma cells, X63Ag8.653 (Kear-
`ney et al., 1979). At first, the pSV2-SlG1 was transfected into
`X63Ag8.653 cells by protoplast fusion. The stable transfor-
`mants selected with mycophenolic acid (Lilly Co., Ltd) (Mulli-
`gan & Berg, 1981). The human y.-heavy chain-producing
`
`(b)
`
`ATCTTGAGAAATTACTCAGAGAAGGCCATCAGGCTCAGGGCTCAGACAAGAACCAGGACAAATGTTTTAG
`
`GGAATGGAGAACAGATTTGCATCCACTGCTCACCAGAGCCACCTAACGACGACACAAGAATAAAGGAAGT
`
`70
`
`140
`
`210
`
`AGATTTGCATGAAGAGACTTCCCTTCCTATGATAAGAGAGGCCTGGAGGTTCCTCCTTAGCTGTGGGCTC
`
`-19
`
`Leader
`
`MAHTPLHLTLFTL280
`AGAAGCAGAGTTCTGGGGTGTCTCCACACCATGGCCTGGACCCCTCTCTGGCTCACTCTCTTCACTCTTT
`
`-5
`
`C
`
`I
`
`GCATAGGTGCTGCCTCCCAGGGCTCAACCCCATATTATCATGCTAGCTGTGCCAACCTGGCCCCGAGCTT
`
`350
`
`420
`
`CGGCTCAACACAGGGAGTAGTGTAGGGTGTGGGACTCTAGGCGTGAAACCCTTATCCTCACCTCTTCTGT
`
`'4__Leader__*1
`
`V region
`
`GSVVSSEL
`QDPVVSVAL G
`0490
`CCTCTTTTGCAGGTTCTGTGGTTTCTTCTGAACTGACTCAGGACCCTGTTGTGTCTGTGGCCTTGGGACA
`TVRI TCQGDSLR TYHASHYQQKP560
`GACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAACCTATCATGCAAGCTGGTACCAGCAGAAGCCA
`
`RQAPVLVIYDEN RPSQIPDRFS630
`AGACAGGCCCCTGTACTTGTCATCTATGATGAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTG
`
`GSTSGNTASLTI TGAQAEDE A
`Y Y700
`D
`GCTCCACCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTA
`
`V region___..__*'97
`
`J region
`
`‘I03
`
`CNSRDSSGNRLV
`FGGGTKLTVL 770
`CTGTAACTCCCGGGACAGCAGTGGTAACCGTCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGT
`
`GAGTCTCTTCTCCCCTCTCCTTCCCCACTCTTGGGACAATTTCTGCTGTTTTTGTTTGTTTCTGTATCTT
`
`840
`
`Fig. 2 (continued)
`
`Genzyme Ex. 1043, pg 953
`
`Genzyme Ex. 1043, pg 953
`
`

`
`Shinji Komori et al.
`
`HIG 1 (ARH77)
`
`(b) Human
`Enhancer
`
`klenow fragment
`4/
`EcoR I linker
`
`Amp’
`
`co—neo
`
`$V400f'l
`
`DBR322
`ori
`
`pSV2—S|G1
`
`Eco-opt
`
`pBR322
`orl
`
`$V40orI
`
`Fig. 3. Structure ofplasmids (a) pSV2-SlGl and (b) pSV2-Slit-E. V, variable region; D, diversity segment; J, joining segment; C, contrast
`region; En, human heavy chain enhancer. (a) The plasmid pSV2-SlGl contains the class-switched heavy chain gene. (b) The plasmid
`pSV2-SI}.-E contains the cloned 3C4L2 gene, which was ligated with a human heavy chain enhancer region. Open boxes indicate exon.
`
`transformants of X63Ag8.653 cells were transfected with the
`pSV2-SI-AE by electroporation, and G418 antibiotics (Gibco
`Laboratories) (1-0 mg/ml) were used for selection (Southern &
`Berg, 1982).
`
`Sperm immobilization test
`A modified micro-sperm immobilization test was used (Isojima
`& Koyama, 1979). Briefly, 10 ,ul of culture supernatants were
`added into each well of Terasaki plate (Falcon, No.3034) and
`the liquid parrafin oil was overlayered. Two microlitres of
`pooled guinea pig serum as complement source and 1 pl of active
`human spermatozoa suspension (2 X 107/ml) were added to the
`supernatants and incubated at 37°C for 60 min. As a comple-
`ment control, 2 pl of heat-inactivated (56°C, 30 min) guinea pig
`serum was used. The S1 titre of the antibodies was calculated as
`
`50% sperm immobilization unit (S150) (Isojima & Koyoma,
`1976).
`
`Immunoblot analysis
`The supernatants (10 al) of the transformants were electrophor-
`esed on a NaDodSO4/polyacrylamide gel
`in the reduced or
`nonreduced condition. Protein bands were transferred to nitro-
`
`cellulose filters by a Bio Rad transblot cell apparatus. To
`minimize the background,
`the filters were treated with a
`masking solution (1% BSA, 01% NaN3 and 0-05% Tween 20)
`for 60 min. Peroxidase-conjugated goat anti-human IgG (y.-
`specific) was diluted in a masking solution (111000) and added to
`the filters. They were incubated for 60 min at room temperature.
`After washing three times in TBS (50 mM Tris HCl (pH 7-5) and
`200 mM NaCl), the visual signal was produced by a substrate
`solution (4-chloro-1-naphthol/methanol and H202) for a few
`minutes at room temperature. To detect }.-light chain, rabbit
`anti-human }.-light chain sera (Miles laboratories Inc. USA)
`were diluted in a masking solution (1:l000) and added to the
`filters. They were incubated for 60 min at room temperature.
`After washing the filters in TBS, peroxidase-conjugated goat
`anti-rabbit IgG (ZYMED laboratories Inc, USA), which was
`diluted in a masking solution (l:l000), was added to the filters.
`They were incubated for 60 min at room temperature. Then the
`same substrate solution was added.
`
`RNA preparation and Northern blot analysis
`Total RNA was extracted from H6-3C4, NS1 or stable transfor-
`mants. RNA (10 pg) was electrophoresed on a 0-75% formalde-
`
`Genzyme Ex. 1043, pg 954
`
`Genzyme Ex. 1043, pg 954
`
`

`
`A class-switched recombinant monoclonal antibody
`
`51
`
`hyde agarose gel, blotted to nitrocellulose filters and hybridized
`with the nick-translated "P-labelled cloned human VH or V;
`gene.
`
`RESULTS
`
`Isolation of H6-3C4 heavy and light chain genes
`Southern blot analysis of the heavy chain genes of the H6-3C4
`hybridoma showed that a rearranged heavy-chain gene was
`contained in 8 kb fragments of HindIII-digested DNA and a
`rearranged light-chain gene was in 5-6 kb fragments of HindIII-
`digested DNA (data not shown)
`A genomic library was constructed as described in Materials
`and Methods. After screening with a human JH (JH3—6) DNA
`probe or with a human C12 DNA probe, one positive clone for a
`heavy chain gene (3C4VH) and two positive clones for a light
`chain gene (3C4L2) were isolated. The clone 3C4VH contained a
`rearranged human heavy chain variable region (VDJ) gene and
`was 8.2 kb long. The clone 3C4L2 contained a rearranged
`human light chain variable region (VJ) gene and a C 1 gene, and
`was 5.6 kb long. The restriction enzyme maps of the both clones,
`3C4VH and 3C4L2, are shown in Fig. 1.
`
`Nucleotide sequences of the 3C4 VH and 3C4L2 genes
`As shown in Fig. 2a, the nucleotide sequences of the V region of
`the 3C4VH gene were highly homologous to that of the HIG1
`gene, which had been isolated from a human IgGl-secreting
`plasmacytoma cell line, ARH-77, and reported by us previously
`
`(Kudo et al., 1985). The V region of the 3C4VH gene differed E
`18 nucleotides from that of the HIGI gene and the nucleotir
`differences were found equally in hypervariable regions ar
`framework regions. The sequences of the 5’ flanking region 4
`the 3C4VH gene were also highly homologous to that of ti
`HIGI gene. These data indicated that the V" gene of the H6-3C
`hybridoma and HIGI gene belonged to the same VH ger
`family. The deduced amino acid sequences of the 3C4VH get
`showed the 73% homology with a human myeloma protei:
`WAH (Takahashi er al., 1982), which was classified as a huma
`heavy chain variable region subgroup II (Kabat et al., 1983
`Since members of the same heavy chain subgroup share the 70‘
`or greater homology in amino acid sequence (Dayhoff, 1972
`the 3C4VH is a member of subgroup II. The D region of tl
`3C4VH gene was composed of 28 nucleotides coding nine amin
`acids. The sequence of the D region showed no homology to th:
`of HIG1 or any known human germ line D regions (Siebenlist.
`al., 1981; Wu & Kabat, 1982), suggesting that it was a novel
`region. The JH gene segment of the 3C4VH gene was J6 (Revetc
`et al., 1981) and it was the same as the case of HIGI gene (Kuc
`et aI., l98S).
`The nucleotide sequence of 3C4L2 coding for the }.-chain 1
`the H6-3C4 hybridoma was also determined (Fig. 2b). Tl
`deduced amino sequences of the 3C4VL gene showed the 87‘
`homology with the V region of SH protein (Titani et al., 1970),
`member of subgroup IV(Yamasaki, Komori & Watanab
`1987). Northern blot analysis with the 3C4VH gene and tr
`3C4L2 variable region as probes showed the 2-8 kb and 1-8 k
`
`r.
`
`3!
`
`[cl
`
`VI-4.
`
`VA
`
`Fig. 4. Northern blot analysis of H6-3C4, NS-l and four stable transfonnants (En34B3, En46A4, En46H 12 and E22Dl I). Total
`cytoplasmic RNA was electrophoresed on a fonnaldehyde agarose gel, transferred onto nitrocellulose filters and hybridized with the V
`region of (a) 3C4VH gene or (b) 3C4L2, as probes. (21) lanes 1 to 6 show a 24 h autoradiograph exposure. In panel (b) lane 1 shows a 24 h
`autoradiograph exposure, while lanes 2 to 6 show a 48 h autoradiograph exposure. Lane 1, H6-3C4; lane 2, NS-1; lane 3, En34B3; lane 4,
`En46A4; lane 5, En46Hl2; lane 6, E22Dl l.
`
`Genzyme Ex. 1043, pg 955
`
`Genzyme Ex. 1043, pg 955
`
`

`
`514
`
`Shinji Komori et al.
`
`hybridization bands with the H6-3C4 hybridoma RNA, respect-
`ively (data not shown). These data indicated that both heavy
`and light chain genes isolated from the H6-3C4 hybridoma were
`functional rearranged genes.
`
`Construction ofnovel human immunoglobulin genes and introduc-
`tion into mouse myeloma cells
`The isolated VH region fragment (EcoRI-Mlul, 1-85 kb, Fig. 1)
`of the 3C4 heavy-chain gene (3C4VH) was ligated to the human
`Cy, gene (Mlul-BamHI, 13 kb) (Kudo et al., 1985), and was
`inserted into EcoRI-BamHI site of pSV2gpt vector, resulting in
`the plasmid pSV2-SIG]
`(Fig. 3a). The Cy. gene fragment
`contained a human heavy chain enhancer region. The cloned
`3C4 /l-light chain gene (3C4L2) fragment (HincII-HindIII, 4-6
`kb, Fig.
`l) was first ligated to a human heavy chain gene
`enhancer region (MluI-Hpal fragment,
`1 kb), and then, after
`linker conversion, inserted into EcoRI site of pSV2neo vector.
`The resultant plasmid was designated as pSV2-SI/I-E (Fig. 3b).
`The plasmid containing the class-switched heavy chain gene was
`introduced into mouse myeloma cells, X63Ag8.653, by proto-
`plast fusion. Several stable transformants were obtained after
`selection with mycophenolic acid. The plasmid containing the
`cloned 3C4 light chain gene with a human heavy chain enhancer
`region was transfected into the above transformants producing
`the class-switched heavy chain gene products. After selection
`
`with G418 antibiotics, the stable transformants containing the
`class-switched heavy chain gene and the cloned 3C4 light chain
`gene were established.
`
`DNA and RNA blot analysis of the transformants
`Southern blot analysis of the DNA of the transformants was
`perfonned using human JH or human V 1. DNA as a probe. The
`results indicated that the introduced class-switched heavy chain
`and light chain genes were completely integrated without any
`deletion into the genomic DNA of mouse myeloma cells (data
`not shown). Transcripts of the introduced genes in the stable
`transfonnants were analysed by Northern blot analysis. As
`shown in Fig. 4a, a band of 1-8 kb in length, which was a
`secretory-type human yl transcript, was obtained with the RNA
`of each transfonnant when the 3C4VH DNA was used as a
`probe. The size of transcripts hybridized with the V region DNA
`of the 3C4L2 gene was the same as that of parental hybridoma
`H6-3C4 (Fig. 4b). The level of heavy chain gene expression of
`the transformants was similar to that of parental hybridoma,
`while the level of light chain gene expression was somewhat less,
`but still very high in the transformants except for clone E22Dl l.
`The transformant E22Dl 1, which is shown in lane 6 of Fig. 4b,
`produced very low amounts of mRNA for A-light chain. In case
`of E22D1 1, a heavy chain gene enhancer region was not ligated
`to the ).-light chain gene, but the other transformants, En34B3,
`
`|‘.'C-n - r {J uucec
`
`Housed
`
`Fig. 5. Analysis of the class-switched antibody by SDS-polyacrylamide gel electrophoresis. The supernatants of the transformants were
`electrophoresed on SDS-polyacrylamide gel in reduced or nonreduced condition. The proteins were transferred onto nitrocellulose
`filters by using a Bio Rad transblot apparatus. The filters (lane 1 to 3 and lane 1’ to 3’) were immunostained with peroxidase-conjugated
`anti-human yl heavy chain (E.Y. laboratories, Inc., USA) as described in Materials and Methods. The filters (land 4 to 6 and lane 4’ to
`6’) were immunostained with rabbit anti-human A light chain serum (Miles laboratories Inc. USA) and peroxidase-conjugated anti-
`rabbit IgG (ZYMED Laboratories Inc. USA) as described in Materials and Methods. Lanes 1, 4, En46Hl2: lanes 2, 5, En46A4; lanes 3,
`6, En34B3; lanes 1’, 4’, En46I-I12; lane 2’, 5’, En46A4; lane 3’, 6’, En34B3. The molecular weight of protein markers is shown in
`kilodaltons.
`
`Genzyme Ex. 1043, pg 956
`
`Genzyme Ex. 1043, pg 956
`
`

`
`A class-switched recombinant monoclonal antibody
`
`515
`
`Table 1. Sperm immobilizing activity of class-
`switched antibodies
`
`Motility of sperm (%)
`
`Complement
`
`Antibodies
`
`Not heated
`
`Heated
`
`H6 3C4
`En46A4
`En46H 12
`En34B3
`En34G5
`En3B7
`Nonnal human
`serum
`Control
`supernatant
`
`agglutinated
`87
`84
`85
`80
`80
`
`80
`
`80
`
`En46E4 and En46Hl2 possessed a heavy chain enhancer region
`ligated to the }.-light chain gene. These results suggested that a
`heavy chain enhancer region played a crucial role in the
`expression of }.-light chain gene in the present experiments.
`
`Analysis of the immunoglobulins secretedfrom the stable trans-
`formants by immunoblotting and micro SI test
`The immunoglobulins secreted from the stable transformants
`were assessed by immunoblotting of the proteins in the culture
`supernatants. The culture supernatants were electrophoresed on
`a SDS-polyacrylamide gel and the proteins were transferred to
`the nitrocellulose filters, followed by staining with peroxidase-
`conjugated anti-human y-chain or }.-chain antibodies. Under
`non-reducing conditions, all transformants secreted the com-
`plete form of human IgG molecules with a molecular weight of
`
`I00
`
`‘
`
`oro
`
`%inhibltion
`
`2
`
`64
`32
`I6
`8
`4
`Dilution of supernatant
`
`128 256 512
`
`Fig. 6. Spenn-immobilization test of the diluted supernatants of
`transfonnants. The supernatants of transformants were diluted with
`10% normal human serum. The spenn-immobilization test was per-
`formed as described in Materials and Methods. S150 titres of the
`supemantants of the transformants were in the ranges of 10-20. (0)
`En46A4; (A) En34B3; (E1) En34G5.
`
`160 kD (Fig. 5). Under reducing conditions, the 54 kD band of
`human y-chain and 25 kD band of human 1.-chain were
`observed. To examine the activity of antibody molecules
`produced by the transformants, a micro sperm-immobilization
`test (micro SI test) was performed (Isojima & Koyoma, 1976).
`The normal human sperm was incubated with the culture
`supernatants in the presence of a guinea-pig complement (Table
`1). The human spennatozoa were completely immobilized in the
`presence of complement. When the guinea pig complement was
`heat-inactivated at 56°C for 30 min, the spermatozoa were not
`immobilized. These results showed that
`the class-switched
`
`human IgG molecules secreted from the transformants fully
`retained the sperm-immobilizing activity of the parental hybri-
`doma 1-I6-3C4. The titres of sperm-immobilizing antibody of the
`culture supernatants of the transformants were in the range of
`10-20 S150 (Fig. 6) and that of parental hybridoma was 5,000
`S150. The lower immobilizing activity of the culture supernatants
`of the transformants may be accounted for by the facts that,
`first,
`the immunoglobulins produced by the human-mouse
`heterohybridoma H6-3C4 were IgM class, whereas the transfor-
`mants produced IgG class antibodies, which possess lower
`complement-dependent-immobilizing activity as compared
`with IgM class antibodies. But, IgG class anti-spenn antibodies
`are known to show the more potent sperm-immobilizing activity
`than IgM antibodies in the vaginal exudates because of the
`presence of Fc-binding proteins(Isojima et al., 1979; Jager et al.,
`1981). Secondly, the amounts of monoclonal antibodies se-
`creted from the transformants were about 0-2-0-5 ug/ml
`whereas the human-mouse heterohybridoma H6-3C4 secreted
`amounts of monoclonal antibodies 5-10 times higher. Affinity
`of the recombinant antibody appeared to be the same as that of
`the original monoclonal antibody.
`
`DISCUSSION
`
`A number of chimeric antibodies, which consist of mouse
`variable (V) region and human constant (C) region, have been
`constructed by a recombinant DNA technique (Morrison et al.,
`1984; Boulianne et al., 1984; Neuberger et a1., 1985; Sahagan et
`al., 1986; Nishimura et al., 1987). These chimeric antibodies
`were shown to retain antigen-binding activity similar to that of
`the parental mouse monoclonal antibodies (Boulianne et al.,
`1984; Neuberger et al., 1985; Sahagan et al., 1986; Nishimura et
`al., 1987). A rearranged V region gene can be joined to difierent
`constant region genes to produce the antibody molecules of
`different isotypes but with the same antigen specificity (class-
`switching). In the present study, we constructed the class-
`switched human IgG molecules which possessed the V region of
`human IgM antibody specific for human sperm-coating antigen.
`The rearranged heavy chain variable region (VDJH) gene was
`ligated to a human yl constant region gene containing a human
`heavy chain enhancer region. The resultant u to y, class-
`switched human antibody molecules retained the binding
`activity to human sperm-coating antigen and they showed the
`sperm-immobilizing activity in the presence of complement.
`These results demonstrated for the first time that the specificity
`of the V region was maintained after an artificial switch
`recombination. It is generally recognized that human-mouse
`heterohybridomas are unstable and will stop the antibody
`production by deletion of human chromosomes. Although the
`H6-3C4 heterohybridoma used in the present study was rather
`
`Genzyme Ex. 1043, pg 957
`
`Genzyme Ex. 1043, pg 957
`
`

`
`516
`
`Shinji Komori et al.
`
`stable and has retained antibody-producing activity for more
`than 1 year, human chromosomes in the hybridoma were
`gradually deleted during the culture. Moreover, it produced
`IgM class antibody. Since most of the anti-sperm antibodies
`found in the clinical cases are IgG antibodies, the IgM anti-
`sperm antibody of the heterohybridoma was class-switched to
`the IgG by the DNA recombinant technology. The stable
`transfonnants have constantly produced recombinant IgG
`antibodies for more than 6 months. The resultant IgG class
`antibody showed similar sperrn-immobilizing activity. We have
`previously reported the establishment of the transforrnants
`secreting the recombinant human-mouse chimeric monoclonal
`antibody (Nishimura et al., 1987) and these transformants also
`have been shown to produce antibody continuously for a long
`period. By applying recombinant DNA technology, we could
`continuously produce the intended human monoclonal anti-
`body molecules of the different immunoglobulin classes in the
`stable transforrnants. These recombinant antibodies may be
`useful for clinical trials.
`
`ACKNOWLEDGMENTS
`
`We thank Miss Y. Tsurusaki for help in preparing the manuscript. This
`work was supported in part by the grant from the Ministry of
`Education, Science and Culture of Japan.
`
`REFERENCES
`
`BANERJI, J., OLSON, L., & SCI-IAFFNER, W. (1983) A lymphocyte-specific
`cellular enhancer is located down stream of the joining region in
`immunoglobulin heavy chain genes. Cell 38, 729.
`BOULIANNE, G.L., HozUMI, N. & SI-IULMAN, M.J. (1984) Production of
`functional chimeric mouse/human antibody. Nature 312, 643.
`DAYHOI-‘F, M.O. (1972) Atlas of Protein Sequence and Structure. Vol 5,
`p.229. National Biomedical Research Foundation, Washington DC.
`GILLIES, S.D., MoRRIsoN, S.L., OI, V.T. & ToNEGAwA, S. (1983) A
`tissue-specific transcription enhancer element is located in the major
`intron of a rearranged immunoglobulin heavy chain gene. Cell 38,
`717.
`
`lsoJIMA, S., LI, T.S. & ASHITAKA, Y. (I968) Immunological analysis of
`spemi immobilizing factor found in sera of women with unexplained
`sterility. Am. J. Obstel. Gynecol. 101, 677.
`ls0JIMA, S. & KOYAMA, K. ([976) Quantitative estimation of sperm
`immobilizing antibody in the sera of women with sterility of unknown
`etiology:
`the 50% sperm immobilization unit
`(S150).
`In: Recent
`Advances in Human Reproduction (ed. A. Campos da Paz, V.A. Drill,
`H. Hayashi, W. Rodrigues & A.V. Schally) p.10. Excerpta Medica,
`Amsterdam.
`IsoJIMA, S. & KOYAMA, K. (1979) Microtechnique of sperm immobiliza-
`tion test. In: Immunology of Reproduction (ed. K. Bratanov, V.H.
`Valchanov, V. Dikov, R. Georgieva & B. Somlev) p.215. Bulgarian
`Academy of Science, Sofia.
`ISOJIMA, S., KOYAMA, K., IKUMA, K. & KUBo'rA, K. (1979) Effect of
`antisperm antibodies on sperm migration through cervical mucusflnz
`International Congress Series, Gynecology and Obstetrics. (ed. S.
`Sakamoto, S. Tojo & T. Nakayama) Vol. 5l2, p.705. Excerpta
`Medica, Amsterdam.
`ISOJIMA, S., KAMEDA, K., Tsun, Y., SHIGETA, M., IKEDA, Y. & KOYAMA,
`K. (I987) Establishment and characterization of human hybridoma
`secreting the monoclonal antibody with a high titers of sperm
`immobilizing and agglutinating activities against human seminal
`plasma. J. Reprod. Immunol. 10, 67.
`JAGER, S., KREMER, J., KUIKEN, J. & MULDER, 1. (1981) The significance
`of the Fc part of antisperrnatozoal antibodies for the shaking
`
`phenomenon in the sperrn-cervical mucus contact test. Fertil. Steril.
`36, 792.
`KABAT, E.A., WU, T.T., BIIDI-‘SKY, H., REID-MILLER, M. & PERRY, H.,
`(1983) In: Sequences of Proteins of Immunological Interest. p. 109.
`National Institutes of Health, Bethesda.
`KEARNEY, J.F., RADBRUCH, A., LIEsEoANG, B. & RAJEWSKY, K. (I979) A
`new mouse myeloma cell
`line that has lost immunoglobulin ex-
`pression but permits the construction of antibody-secreting hybrid
`cell lines. J. Immunol. 123, I548.
`KUDO, A., IsnInARA, T., Nrsr-IIMURA, Y. & WATANAEE, T. (1985) A
`cloned human immunoglobulin heavy chain gene with a novel direct-
`repeat sequence in 5’ flanking region. Gene 33, ISI.
`MoRRrsoN, S.L., JOHNSON, M.J., HERZENEERG, L.A. & OI, V.T. (1984)
`Chimeric human antibody molecules: mouse antigen-binding
`domains with human constant region domains. J. Immunol. 81, 6851.
`MULLIGAN, R.C. & BERG, P. (1981) Selection for animal cells that
`express the Escherichia coli gene coding for xanthine-guanine phos-
`phoribosyltransferase. Proc. natn Acad. Sci.