ISSN 0006-291 X
`Volume 259. Number 2. June 7.1999
`
`Blocllcllliclll
`
`and Bnl
`
`l.,..,,_ ,, ,,.....,_
`Bllrlnellnal
`UII-‘W
`
`,
`
`I\L‘.SL‘L11‘C11
`.
`.
`lllllllllllcalllolls
`
`EDI'l‘Ol\‘_\‘
`El‘llc‘<tn L‘;ll‘lll‘o1l
`I. C. GlH1.,\'.'l11lR
`Akilul ]l"lll'll:ll1l
`
`Jzllllc-5. I7. _I.lllliusull
`’z1sllo I\':l;;;lw:l
`M. Délllicl LLIHL’
`
`Wllllzllll _l. I.L‘HH‘.ll"/.
`Mzlsllllli Mlll';lllll1l::ll
`
`Stcll Ol‘l'cllill.>
`
`7
`.lflCq“C3
`wmmm 34
`
`,.
`
`‘
`
`”
`
`—
`
`A
`
`Acad'3“‘\l\\\
`°"’‘"B “°‘
`
`.\
`
`C(11))KZ
`
`ACADEMIC PRESS
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Biochemical and Biophysical Research Communications 259, 436-442 (1999)
`Article ID bbrc.1999.0696, available online at http://wwV.r.idealibrary.com on IDE ~l ®
`
`Posttranscriptional Regulation of Mammalian
`1
`Methionine Synthase by 812
`
`Sumedha Gulati, *'2 Lawrence C. Brody, t and Ruma Banerjee*'3
`*Biochemistry Department, University of Nebraska, Lincoln, Nebraska 68588-0664; and tGenetics and
`Molecular Biology Branch, National Human Genome Institute, NIH, Bethesda, Maryland 20892-4442
`
`Received April 12, 1999
`
`Methionine synthase is one of two key enzymes in(cid:173)
`volved in the removal of the metabolite, homocysteine.
`Elevated homocysteine levels constitute a risk factor
`for cardiovascular diseases and for neural tube de(cid:173)
`fects. In cell culture, the activity of methionine syn(cid:173)
`thase is enhanced several-fold by supplementation
`with its cofactor, B 12• The mechanism of this regula(cid:173)
`tion is unknown, although it has been ascribed to a
`shift from apoenzyme to holoenzyme. Using sensitive
`assay techniques as well as a combination of Northern
`and Western analyses, we demonstrate that the effect
`of B 12 on induction of methionine synthase activity is
`paralleled by an increase in the level of the enzyme.
`These studies exclude conversion of apoenzyme to ho(cid:173)
`loenzyme as a basis for activation that had been de(cid:173)
`scribed previously. Since the mRNA levels do not
`change during the same period that the methionine
`synthase levels increase, regulation of this protein by
`its cofactor must be exerted posttranscriptionally.
`© 1999 Academic Press
`
`Methionine synthase is one of two key enzymes at
`the homocysteine metabolic junction in mammalian
`cell physiology. Its action converts homocysteine, a
`toxic metabolite to methionine, and concomitantly
`releases the circulating form of folic acid, methyl(cid:173)
`tetrahydrofolate (CH 3-H 4folate), to tetrahydrofolate
`(H4folate), that is then available for supporting DNA
`biosynthesis (1,2). Elevated levels of homocysteine con-
`1 This work was supported by a grant from the National Institutes
`of Health (DK45776) to R.B. and a Predoctoral Fellowship to S.G.
`from the American Heart Association (Nebraska Affiliate).
`2 Present address: 638C, Guggenheim, Mayo Clinic and Founda(cid:173)
`tion, Rochester, MN 55905.
`3 Corresponding author. Fax: (402) 472-7842. E-mail: rbaneije@
`unlinfo2. unl.edu.
`Abbreviations used: CH3-H4folate, methyltetrahydrofolate; H 4folate,
`tetrahydrofolate; SSC, saline sodium citrate; PBS, phosphate buffered
`saline; EMEM, Eagle's minimum essential medium; DEPC, diethylpy(cid:173)
`rocarbonate; OHB12, hydroxycob(lll)alamin; SDS, sodium dodecyl sul(cid:173)
`fate; MOPS, N-morpholinosulfonic acid.
`
`stitute an independent and significant risk factor for
`cardiovascular diseases (3). In addition, elevated levels
`of homocysteine and low maternal levels of B 12 are
`correlated with neural tube defects (4,5). Methionine
`synthase is thus an important housekeeping enzyme at
`the intersection of sulfur and one-carbon ·metabolism,
`and its regulation influences intracellular homocys(cid:173)
`teine and folate pools. The consequences of lowering
`homocysteine with vitamins are being measured in
`clinical intervention studies. Thus, elucidating the
`mechanism by which B 12 induces methionine synthase
`activity and thereby affects homocysteine pools may
`have an important bearing on these intervention
`studies.
`Studies by Mangum and North almost thirty years
`ago on the regulation of mammalian methionine syn(cid:173)
`thase in HEp-2 cells in culture revealed that supple(cid:173)
`mentation of the medium with B 12 resulted in a thirty(cid:173)
`fold elevation of enzyme activity (6). This was later
`extended to several other cell lines in which the B 12-
`induced activation of methionine synthase ranged from
`10- to 30-fold (7). In the initial experiments, homocys(cid:173)
`teine and vitamin B 12 replaced methionine and choline
`in the medium. Homocysteine was however found to
`have no effect on the activation of methionine syn(cid:173)
`thase, since B 12 in the presence or absence of homocys(cid:173)
`teine yielded the same extent of stimulation (7). The
`activity of the only other mammalian B 12-dependent
`enzyme, methylmalonyl-CoA mutase, was unchanged
`upon supplementation of the medium with B 12 (8).
`Several alternative hypotheses can be considered to
`explain induction of methionine synthase activity by
`its cofactor, B 12 • First, if intracellular B 12 concentration
`is limiting, increase in enzyme activity could be due to
`conversion of apoenzyme to holoenzyme. Second, B 12
`may exert its regulation at the methionine synthase
`promoter resulting in increased transcription. Third,
`B 12 may enhance translation of the methionine syn(cid:173)
`thase mRNA, either by affecting the stability of the
`message or by increasing access of the message to the
`translation apparatus. Fourth, B 12 may enhance the
`
`0006-291X/99 $30.00
`Copyright © 1999 by Academic Press
`All rights of reproduction in any form reserved.
`
`436
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Vol. 259, No. 2, 1999
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`stability of methionine synthase thereby affecting its
`turnover in the cell. Finally, B 12 may induce one or
`more genes that in turn increases the level of methio(cid:173)
`nine synthase either at a transcriptional or post(cid:173)
`transcriptional level.
`The recent cloning of the human methionine syn(cid:173)
`thase eDNA (9-11) and the development of sensitive
`assays to measure the relative apo- and holoenzyme
`content of the enzyme (12-14) now permit evaluation
`of these alternative hypotheses. In this study, we have
`examined whether the induction of methionine syn(cid:173)
`thase by B 12 is correlated with changes in the mRNA
`levels, protein levels or the per.cent holoenzyme. Our
`studies clearly point to a post-transcriptional mecha(cid:173)
`nism of activation of methionine synthase that is de(cid:173)
`pendent on the synthesis of new enzyme.
`
`MATERIALS AND METHODS
`
`Materials. EMEM and hydroxocobalamin were purchased from
`Sigma. Fetal calf serum was from Calbiochem. The RN easy kit was
`from Qiagen and Hybond N + membrane was from Amersham.
`RNase free reagents (MOPS, SSC) were molecular biology grade and
`were purchased from 5 Prime-?3 Prime. DEPC treated water was
`used for making up solutions for RNA studies. Cell lines, Cos-7
`(SV40-transformed African Green Monkey kidney cells), HeLa (hu(cid:173)
`man cervical carcinoma cells), HepG2 (human hepatoblastoma cells),
`and 293 (transformed human kidney cells) cells were from ATCC,
`and 293 t+ (derivative of 293 expressing the T antigen) was from
`Mike Fudos (NIH). The actin probe was from an in vitro transcrip(cid:173)
`tion kit from Ambion.
`Cell culture. Cells were cultured in EMEM supplemented with
`10% fetal bovine serum and maintained at 37°C, 5% C0 2 • The con(cid:173)
`centration of folic acid and methionine in this medium are 2.3 p,M
`and 100 p,M respectively. The estimated concentration of B 12 in the
`unsupplemented medium is ~ 125 pM, and is derived from the serum
`(15). For studies involving RNA isolation, confluent cells from 4 or 5
`petri dishes (150 mm) were harvested and frozen in lysis solution
`and stored at -80°C until further processing.
`For studies involving protein analysis (enzyme assays or Western
`blots) cell monolayers were washed with PBS, collected by centrifu(cid:173)
`gation and the pellet was washed twice with PBS prior to freezing at
`-80°C. For B 12 induction studies, cells were grown to subconfluency
`before replacement of the medium with fresh EMEM supplemented
`with OHB 12 at a concentration of 5 mg/L. The B 12 concentration was
`chosen based on the dose response for methionine synthase activity
`that has been reported previously (15). For experiments in which
`methionine synthase activity, and protein and RNA levels were
`being determined simultaneously at fixed time points following B 12
`addition (0, 24, and 48 h), a large number of plates were cultured in
`parallel. Cells from 3 or 4 petri dishes were used per time point for
`each of the protein and RNA determinations.
`Methionine synthase assay using cell extracts. The cell extracts
`were prepared and anaerobic assays were performed essentially as
`described previously (13). The cell extracts for the assays were
`thawed immediately prior to their use. They were made anaerobic by
`gently passing N 2 for 30 min over the extracts in 1.5 ml eppendorf
`tubes sealed with red rubber septa. The amount of protein used in
`the assays ranged from 0.3 mg to 0.6 mg. Protein concentrations
`were determined using the Bradford assay (BioRad) with bovine
`serum albumin as standard. One unit of activity is defined as the
`amount of protein required to synthesize one pmol of methionine h -l
`at 37°C.
`
`RNA isolation. RNA was isolated using the RN easy kit as per the
`vendor's protocol (Qiagen). Aliquots (20-30 p,l) ofRNA were stored at
`-80°C until needed.
`Northern analysis. RNA samples (10-15 p,g) were heated at 65°C
`for 5 min and then cooled immediately on ice prior to loading onto a
`1% formaldehyde agarose gel. The gel was electrophoresed in RN ase
`free lX MOPS (25 volts for ~20 hat 4°C), equilibrated with lOX SSC
`and transferred to a Hybond N + membrane in the same buffer. After
`overnight transfer, RNA was UV-linked to the membrane. Prehy(cid:173)
`bridization and hybridizations were performed in Church and Gil(cid:173)
`bert hybridization buffer. Hybridization was conducted overnight at
`65°C for 12 h (with 3 X 106 dpm per ml radiolabeled probe). An
`Ncoi-EcoRI fragment containing the homocysteine-binding domain
`in plasmid SGHcy-28a (described below) was used as one of the
`probes. Probes (for methionine synthase and actin) were radiolabeled
`with 32P (Rediprime kit from Amersham Life Science). Following
`hybridization, the membrane was washed at 65°C for 3 X 20 min
`with 2X SSC and 0.1% SDS. The membrane was exposed to a phos(cid:173)
`phoimager screen for 2-3 days at room temperature and then
`scanned.
`Cloning and expression of homocysteine binding domain of human
`MS. TheN-terminal region of human methionine synthase extend(cid:173)
`ing from amino acids 1 to 368 is homologous to the homocysteine
`binding domain of the E. coli protein ranging from residues 2-353
`(16,17). The segment of the human eDNA encoding this fragment
`was amplified by PCR and cloned using the primers described below.
`An Nco! site and an EcoRI site were engineered into the 5' sense and
`3' antisense primers respectively and are indicated in bold letters in
`the primer sequences shown below. 5' sense: 5' CATGCCATGG(cid:173)
`CTCCGGCGCTGCAGGACCTGTCGC 3'. 3' antisense: 5' GMTTC(cid:173)
`AATGTTAACAAATTACTAGTACGGTCCAATCCT 3'. In the 5' primer,
`the E. coli codon preference was employed at some locations to
`potentially enhance translation efficiency. The codon preference for
`amino acids following the initiator methionine codon located within
`the Nco! site (underlined in primer sequence) are indicated in pa(cid:173)
`rentheses: Met-Ala (E. coli)-Pro (E. coli)-Ala (human)-Leu (E. coli)(cid:173)
`Gln (E. coli)-Asp (human)-Leu (human)-Ser (human). In the 3'
`primer, two tandem stop codons (underlined) were engineered into
`the sequence after residue 368 encoding tyrosine. A 1.1 kb fragment
`was amplified by PCR using Klentaq polymerase (Clonetech) and
`eDNA from human pancreas (Clonetech) as template. The amplified
`band was initially cloned into theTA vector, PCR 2.1, from Invitro(cid:173)
`gen, and the ligation mixture was used to transform E. coli ToplO F'
`cells (Invitrogen). DNA from a single colony was digested with Nco!
`and EcoRI and the fragment was cloned into the pet 28 a expression
`vector (Novagen) to create SGHcy-28a, and transformed into BL21
`DE3. The DNA sequence of the insert in SGHcy-28a was determined.
`Expression of homocysteine binding domain of human methionine
`synthase. A colony containing plasmid SGHcy-28a with the 1.1 kb
`insert, was grown overnight in 2 ml LB medium (containing 50 p,g/ml
`kanamycin) which was used to inoculate a 50 ml LB/kanamycin
`culture the next day. The culture was grown at 37oC to an O.D 600 of
`0.5-0.6 ( ~3 h) and expression was induced with 0.8 mM IPTG for 3 h.
`Cells were collected by centrifugation and the pellet was resus(cid:173)
`pended in 3 ml of 50 mM Tris-HCl pH 8.0, 2 mM EDTA. The soluble
`and insoluble cell fractions· were obtained using a protocol from
`Novagen. Lysozyme at a concentration of 100 p,g/ml and 0.1 volume
`of 1% Triton X-100 (Bio-Rad) were added to the resuspended pellet
`and incubated at 30°C for 15 min. This was followed by centrifuga(cid:173)
`tion at 12,000 X g for 15 min at 4°C. The soluble (supernatant) and
`insoluble (pellet) fractions were resuspended in a lX SDS sample
`loading buffer (Bio-Rad) containing {3-mercaptoethanol, and sepa(cid:173)
`rated by electrophoreses on a 10% SDS polyacrylamide gel (Figure
`3A). The identity of the recombinant 37 kDa band was confirmed by
`N-terminal amino acid sequence analysis and by Western analysis
`using antibodies generated against porcine methionine synthase
`(12). DNA and N-terminal sequence analyses revealed that Glu 12
`
`437
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Vol. 259, No. 2, 1999
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`TABLE I
`Induction of Methionine Synthase Activity by B12 in Cell Culture
`
`Medium:
`
`EMEM
`
`EMEM + B12
`
`Specific activity
`
`Specific activitya
`
`Cell line
`
`-B12
`
`+B12
`
`%Holo
`
`-B12
`
`+B12
`
`%Holo
`
`Fold increase6
`
`72 ± 5
`163 ± 12
`149 ± 1
`15 ± 2
`119±1
`
`67
`86
`35
`80
`83
`
`.
`
`Cos7
`48 ± 6
`He La
`140 ± 21
`293t+
`52± 9
`HepG2
`12 ± 2
`99 ± 6
`293
`a Specific activity is expressed in pmol methionine formed min -1 mg-1 at 37°C .
`6 The fold increase was estimated by comparing the values for specific activities measured in the presence of added B12.
`
`179 ± 28
`237 ± 40
`883 ± 1
`167 ± 9
`218 ± 6
`
`271 ± 4
`320 ± 6
`860 ± 14
`205 ± 6
`299 ± 28
`
`66
`74
`103
`81
`73
`
`3.8
`2.0
`5.8
`13.7
`2.5
`
`was deleted. This could have resulted from a polymorphism at this
`position that was present in the eDNA library or, more likely, from a
`PCR error.
`Generation of antibodies against the human methionine synthase.
`The pellet containing the insoluble N-terminal domain of human
`methionine synthase was washed extensively with 50 mM Tris, pH
`8.0 containing 2 mM EDT A. The washed pellet ( -1.5 mg) was sep(cid:173)
`arated on a preparative 7% SDS polyacrylamide gel and the band of
`interest was excised after staining with Coommasie brilliant blue
`R-250 (Bio-Rad) followed by extensive destaining. The excised band
`was sent to a commercial antibody facility (Alpha Diagnostics,
`Texas) for generation of polyclonal antibodies in rabbits.
`Western analysis of human methionine synthase in cells cultured in
`medium ± B 12• Extracts (50 f.Lg protein), from cells grown in EMEM
`medium supplemented with B12 for 0, 24 and 48 h, were separated on
`a 5% SDS polyacrylamide gel. The proteins were transferred to a
`PVDF membranes using a tank electroblotter for 6 h at 100 V.
`Western analysis was performed using a 1:100 dilution of the first
`antibody and a 1:5000 dilution of the second antibody, anti-rabbit
`IgG/alkaline phosphatase conjugate (BioRad), followed by chemilu(cid:173)
`minescent detection using the CDP-Starr kit (Tropix). Chemilumi(cid:173)
`nescent signals were quantitated using a Molecular Dynamics den(cid:173)
`sitometer.
`
`RESULTS
`
`Induction of methionine synthase activity by B 12 is
`not due to apoenzyme to holoenzyme conversion.
`In
`order to examine whether or not activation by B12 is
`due to conversion of apoenzyme to holoenzyme, the
`effect of B12 addition to the cell culture medium was
`examined in five different cell lines (Table I). Enzyme
`activity was measured in the anaerobic titanium ci(cid:173)
`trate assay either in the presence or absence of exoge- ·
`nous B12. Activity determined in the presence of B12
`represents total· methionine synthase activity. In the
`absence of B 12, only holoenzyme activity is measured.
`Thus the ratio of activity observed in the absence to
`that in the presence of additional cofactor represents
`the proportion of holoenzyme present. As shown in
`Table I, all five cells lines showed stimulation of me(cid:173)
`thionine synthase activity when the medium was sup(cid:173)
`plemented with BI2· The fold increase varied with the
`cell line, ranging from 2-fold in HeLa cells to ~ 14-fold
`
`in HepG2 cells. Increasing the concentration of the
`cofactor ten-fold did not further increase the fold(cid:173)
`induction (data not shown). Comparison of enzyme ac(cid:173)
`tivity from cells that had been supplemented with B12
`with those grown in unsupplemented media show that
`the proportion of holoenzyme remained the same,
`within experimental error. The only exception was
`293t + cells where the holoenzyme content increased
`from 34% to 100%. However, the 3-fold increase in
`percent holoenzyme does not account for the almost
`6-fold increase in methionine synthase activity result(cid:173)
`ing from B12 supplementation. 293 cells were employed
`for the remainder of the studies described below be(cid:173)
`cause of their high holoenzyme content and rapid
`growth rate.
`
`Kinetics of methionine synthase induction by B 12•
`The time course for the activation of methionine syn(cid:173)
`thase was examined next. As shown in Figure 1, in(cid:173)
`crease in methionine synthase activity could be ob(cid:173)
`served as early as two hours following B12 addition. The
`activity increased rapidly during the first six hours
`reaching a plateau in ~24 to 48 hand was sustained
`until 72 h.
`
`B 12 supplementation does not change methionine syn(cid:173)
`thase RNA levels. To examine whether the B 12 effect
`is due to transcriptional activation of the methionine
`synthase gene, mRNA levels were analyzed 0, 24 and
`48 h after addition of the cofactor (Figure 2A). Two
`methionine synthase mRNA's of ~10 and 7.5 kb sizes
`were observed by Northern analysis as has been re(cid:173)
`ported previously (9,11). However, the level of methio(cid:173)
`nine synthase mRNA remained unchanged during the
`same period that a 2.5-fold increase in enzyme activity
`was observed. Equal loading of RNA in the three lanes
`was confirmed by probing for the actin message (Figure
`2B). Northern analysis of three other cell lines (Cos 7,
`HepG2 and 293t+) also revealed that the methionine
`synthase mRNA levels do not change upon B12 supple(cid:173)
`mentation (data not shown).
`
`438
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Vol. 259, No. 2, 1999
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`bJ)
`
`s
`I::
`"§
`::0
`ill
`§
`.8
`ill
`·§
`~
`s
`0 s 0.
`
`I
`
`~
`
`0
`
`A
`
`B
`
`MS
`
`actin
`
`600
`
`500
`
`400
`
`0 2
`
`0
`
`0
`
`0 t t
`
`300 ~
`
`200
`
`0
`
`10
`
`20
`
`30 40 50
`Time, h
`
`60
`
`70
`
`80
`
`FIG. 2. Northern blot analysis of RNA from 293 cells, 0, 24, and
`48 h after addition ofB 12 • RNA was isolated and detected by North(cid:173)
`ern blot analysis as described under Materials and Methods. (A) Two
`bands corresponding to the~ 10 kb and 7.5 kb methionine synthase
`eDNA forms were observed. (B) To confirm equal loading of RNA in
`the lanes, the blot was later probed for the actin message.
`
`FIG. 1. Kinetics of methionine synthase induction in 293 cells by
`B 12 • Cells were grown to subconfluency in 150 mm petridishes as
`described under Materials and Methods. The medium was aspirated
`off and replaced with fresh EMEM with either± B 12 • The cells were
`harvested by scraping at the indicated time points and frozen until
`further analysis. Methionine synthase activity was determined in
`the anaerobic titanium citrate assay in the absence of additional
`cobalamin. The time points were repeated in either duplicate or
`triplicate, and standard errors are indicated.
`
`number of nutrients function as cofactors or substrates at
`the homocysteine metabolic junction. Cystathionine
`{3-synthase is a vitamin B 6- and heme-dependent enzyme
`whereas methionine synthase requires both B 12 and a
`folate derivative, CH3-H4folate, for activity. This has re(cid:173)
`cently led to the promotion of a multivitamin tablet con(cid:173)
`taining B 6 , B 12, and folic acid as a "homocysteine defense"
`
`Western analysis of methionine synthase levels in cell
`cultures exposed to B 12• Cell extracts from the 0, 24
`and 48 h time points were analyzed by Western blot(cid:173)
`ting. As shown in Figure 3B, an increase in methionine
`synthase level is observed between the 0 and 24 h time
`points, while the difference between the 24 and 48 h
`time points is negligible. To ensure equal loading, the
`membrane was also exposed to antibody generated
`against the P. shermanii methylmalonyl-CoA mutase.
`As expected, the levels of this protein did not exhibit a
`time dependent change (Figure 3B lower panel). An
`additional lower band also crossreacted with the mu(cid:173)
`tase antibody. Although its identity is unknown (it may
`be a proteolytic form), it serves as an additional control
`to demonstrate that a specific increase in methionine
`synthase levels is observed on supplementation of the
`medium with B12·
`
`DISCUSSION
`
`1
`
`2
`
`3
`
`4
`
`A
`
`97-
`
`66-
`
`45-
`
`B
`
`A
`
`B
`
`I Oh 24h 48h I
`
`MS
`
`-Mutase
`
`Elevated concentrations of homocysteine are corre(cid:173)
`lated with risk for two apparently unrelated pathologies:
`cardiovascular diseases (3) and neural tube defects (5). In
`mammalian cells, two major enzymatic routes detoxifY
`homocysteine. Transmethylation, catalyzed by either me(cid:173)
`thionine synthase or betaine homocysteine methyltrans(cid:173)
`ferase, salvages homocysteine to the AdoMet-dependent
`methylation cycle. Transsulfuration, catalyzed by cysta(cid:173)
`thionine {3-synthase converts homocysteine to cystathi(cid:173)
`onine, and represents the first step in its catabolic re(cid:173)
`moval. Due to the limited tissue distribution of betaine
`homocysteine methyltransferase in the liver and kidney
`(18), methionine synthase is the major transmethylase. A
`
`FIG. 3. Overexpression of human methionine synthase fragment
`and Western analysis of methionine synthase at various time points
`following addition of B 12 • (A) Overexpression of the homocysteine(cid:173)
`binding domain of human methionine synthase. Cell extracts con(cid:173)
`taining SGHcy-28a were prepared as described under Materials and
`Methods. Lane 1 has low molecular weight markers, lane 2 has cell
`extract after sonication, lanes 3 and 4 have the soluble and insoluble
`fractions respectively separated from the cell extract. (B) Western
`analysis of methionine synthase levels in the 293 cell extracts at the
`indicated time points. As a control, the membrane was also probed
`with antibodies generated against methylmalonyl-CoA mutase from
`Propionibacterium shermanii. The band indicated by an arrow cor(cid:173)
`responds to the human mutase. MS refers to methionine synthase.
`The sizes of the molecular weight markers (in kDa) are indicated on
`the left.
`
`439
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Vol. 259, No. 2, 1999
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`formula, and to folic acid fortification of flour in the U.S.
`in an effort to reduce the incidence of neural tube defects.
`Homocysteine lowering intervention studies using differ(cid:173)
`ent vitamin regimens are either imminent or ongoing in
`several countries.
`Understanding the role of cofactors in regulating the
`activities of enzymes at the homocysteine metabolic
`junction is therefore of importance from a clinical
`standpoint. One of these cofactors, B 12 , was described
`thirty years ago, to induce activity of methionine syn(cid:173)
`thase in cell culture (6). In this study we have also
`observed that B 12-induces a 2 to 14-fold increase in
`methionine synthase activity in different cell lines. The
`mechanism by which exogenous B 12 'in the cell culture
`medium causes an increase in methionine synthase
`activity was previously unknown, although it had been
`ascribed to conversion of preexisting apoenzyme to ho(cid:173)
`loenzyme (8,15).
`However, evaluation of the percent holomethionine
`synthase is complicated by its existence in multiple
`oxidation states, containing B 12 as methylcob(III)(cid:173)
`alamin, hydroxycob(III)alalmin or cob(II)alamin. Of
`these, only the first is active under in vitro assay con(cid:173)
`ditions, and then only, for a limited number of turn(cid:173)
`overs (100-2000 depending on the degree of anaerobio(cid:173)
`city (19,20)). This results from the oxidative sensitivity
`of the cofactor intermediate, cob(I)alamin, under cata(cid:173)
`lytic turnover conditions. The oxidized forms of the
`enzyme can be reactivated in the presence of a one
`electron donor and S-adenosylmethionine. The stan(cid:173)
`dard in vitro assay employs dithiothreitol and OHB 12
`as a source of electrons. In the absence of OHB 12 , di(cid:173)
`thiothreitol is unable to transfer electrons to methio(cid:173)
`nine synthase (21). The problem with this assay arises
`from its dependence on OHB 12 , which serves both to
`transfer electrons from dithiothreitol to activate oxi(cid:173)
`dized holoenzyme and binds to apoenzyme, eventually
`converting it to holoenzyme (12). Thus, the complexity
`of the methionine synthase assay has resulted in sig(cid:173)
`nificant underestimation of the holoenzyme content in
`the literature.
`This problem is addressed by employing titanium
`citrate as the electron donor since it can directly reduce
`methionine synthase (12). Under these assay condi(cid:173)
`tions, the relative content of apo- and holoenzyme can
`be evaluated by measuring activity in the presence and
`absence of exogenous OHB 12 • Using this assay, we
`demonstrate that the increase in methionine synthase
`activity is not correlated with conversion of apoenzyme
`to holoenzyme (Table I). In fact in four of the five cell
`lines, addition of B 12 to the cell culture medium does
`not affect the level of holomethionine synthase at all.
`One exception, 293t+ cells, show a 3-fold increase in
`holoenzyme under these conditions, although this is
`insufficient to account for the 5. 7 -fold increase ob(cid:173)
`served in methionine synthase activity. These results
`necessitate evaluation of alternative mechanisms to
`
`3.0
`
`2.5
`
`0 2.0
`'fil
`0:::
`B
`.E
`~ 1.5
`'J:l
`cd
`Q3
`~
`
`1.0
`
`0.5
`
`o:::o
`'§:~ <
`£~ ~
`
`Oh
`
`24h
`
`48h
`
`FIG. 4. Comparison of the methionine synthase activity and
`RNA and protein levels at the indicated time points following addi(cid:173)
`tion of B 12 to the medium.
`
`induction of methionine synthase
`
`account for B 12
`activity.
`The recent cloning of the human methionine syn(cid:173)
`thase eDNA permits direct evaluation of the mRNA
`levels as a function of time following exposure to B 12 • In
`order to choose appropriate time points for this analy(cid:173)
`sis, the kinetics of methionine synthase induction were
`studied in the 293 cell line. As shown in Figure 1,
`maximal activation is observed in ~24 h, and this level
`is sustained up to 72 h. This is very similar to the
`kinetics reported in cultured BHK cells (15). Based on
`these data, we compared the mRNA and protein levels
`at 0, 24 and 48 h following B 12 addition to the cell
`culture medium (Figure 3). Comparison of the ratio of
`methionine synthase mRNA to actin mRNA indicates
`that the level of the methionine synthase mRNA re(cid:173)
`mains fairly constant over 48 h (Figure 4) during which
`time enzyme activity increases 2.5-fold. The two RNA
`bands that hybridize to the methionine synthase probe
`have been observed previously (9,11). The shorter
`eDNA has been sequenced completely (9). The 10 kb
`band is apparently a preprocessed form of the 7.5 kb
`message, since it hybridizes to a probe complementary
`to intron 5 (11).
`Since activation of methionine synthase levels was
`reported to be due to conversion of apoenzyme to ho(cid:173)
`loenzyme we have directly estimated the relative levels
`of methionine synthase protein in the presence and
`absence of added B 12 • As seen in Figures 3B and 4, an
`increase in the steady-state concentration of methio(cid:173)
`nine synthase parallels the increase in its activity. It
`was previously reported that B 12 induction of methio(cid:173)
`nine synthase activity was not affected by the presence
`of the translation inhibitor, puromycin, added simulta(cid:173)
`neously with B 12 to the cell culture medium (15). How(cid:173)
`ever, these results were inconsistent with the kinetics
`of B 12 activation in the BHK cell lines reported in the
`same paper, since in the presence of puromycin, full
`activation was observed in 12 h rather than in 24 h.
`
`440
`
`Lilly Ex. 2038
`Sandoz v. Lilly IPR2016-00318
`
`

`
`Vol. 259, No. 2, 1999
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`Additionally, B12 has a very high affinity transport
`system, it is possible that the rate of B12 import was
`more rapid than that of puromycin, resulting in a de(cid:173)
`layed effect of purmnycin. In contrast, western analysis
`permits a more direct evaluation of methionine syn(cid:173)
`thase levels, and demonstrates unambiguously that a
`new protein synthesis is required for activation by B12.
`At least two alternative hypotheses can be consid(cid:173)
`ered to explain the mechanism of B12 induced activa(cid:173)
`tion of methionine synthase. First, the intracellular B 12
`pool increases upon supplementation of the medium
`and a higher proportion of newly synthesized methio(cid:173)
`nine synthase is stabilized by binding cofactor. While
`our data do not rule this out, it seems unlikely since the
`levels of holoenzyme do not change significantly in
`most cell lines. For example 66% of methionine syn(cid:173)
`thase in Cos7 cells is present in the holoenzyme form
`regardless of whether or not the medium is supple(cid:173)
`men ted with the cofactor. If stabilization of methionine
`synthase by an increased intracellular B12 pool re(cid:173)
`sulted in the increase in its steady-state levels, the
`percentage of holoenzyme would have been expected to
`be increased.
`Alternatively, methionine synthase could be transla(cid:173)
`tionally regulated by its cofactor. Two other folate(cid:173)
`dependent enzymes, dihydrofolate reductase and thy(cid:173)
`midylate synthase (22-24), bind to their own mRNAs.
`This represses translation and represents a form of
`autoregulation. Binding of the nucleotide substrate
`(dUMP in thymidylate synthase) or cofactor (NADPH
`in dihydrofolate reductase) competes with binding for
`mRNA and alleviates translation inhibition. This has
`led to the suggestion that the nucleotide binding do(cid:173)
`mains of RNA-binding proteins may have acquired en(cid:173)
`zymatic activity (or the converse) during evolution (25).
`It is interesting to note that B12 also has a nucleotide
`moiety, with an unusual base, dimethylbenzimidazole,
`that is appended from ring D of the corrin macrocycle.
`Vitamin B12 has been shown to mediate repression of
`gene expression in E. coli and in Salmonella typhi(cid:173)
`murium. In the latter organism, expression of the cob
`operon involved in the de novo biosynthesis of B 12 is
`repressed (26-28). In both E. coli and in S. typhi(cid:173)
`murium, B 12 represses the btuB gene product encoding
`an outer membrane B12 transport protein (29,30). Stud(cid:173)
`ies on the mechanism of this repression reveal that it is
`mediated postranscriptionally (31). A 25 bp long regu(cid:173)
`latory sequence designated as the B 12 box is located
`~80-110 bp upstremn of the initiation codon, and has
`been suggested to constitute the binding site of B12
`itself or a B 12 responsive protein (27). In addition, a
`second common element observed in these transcripts
`is the presence of sequences in the leader with the
`potential to form an RNA hairpin which sequesters the
`RNA binding site. In the presence ofB 12 an RNA hair(cid:173)
`pin forms with inhibits translation initiation of the
`cbi