© 2000 Nature America Inc. • http://medicine.nature.com
`
`A R T I C L E S
`
`Glucocorticoids can promote androgen-independent growth
`of prostate cancer cells through a mutated androgen receptor
`
`XIAO-YAN ZHAO1, PETER J. MALLOY1, ARUNA V. KRISHNAN1, SRILATHA SWAMI1,
`NORA M. NAVONE2, DONNA M. PEEHL3 & DAVID FELDMAN1
`
`Departments of 1Medicine and 3Urology, Stanford University School of Medicine, Stanford, California 94305, USA
`2Department of Genito-Urinary Medical Oncology, University of Texas M.D. Anderson Cancer Center,
`Houston, Texas 77030, USA
`Correspondence should be addressed to D.F.; email: feldman@cmgm.stanford.edu
`
`The androgen receptor (AR) is involved in the development,
`growth and progression of prostate cancer1 (CaP). CaP often
`progresses from an androgen-dependent to an androgen-inde-
`pendent tumor, making androgen ablation therapy ineffective.
`However, the mechanisms for the development of androgen-
`independent CaP are unclear. More than 80% of clinically an-
`drogen-independent prostate tumors show high levels of AR
`expression1. In some CaPs, AR levels are increased because of
`gene amplification2 and/or overexpression, whereas in others,
`the AR is mutated3–5. Nonetheless, the involvement of the AR in
`the transition of CaP to androgen-independent growth and the
`subsequent failure of endocrine therapy are not fully under-
`stood. Here we show that in CaP cells from a patient who failed
`androgen ablation therapy, a doubly mutated AR functioned as
`a high-affinity cortisol/cortisone receptor (ARccr). Cortisol, the
`main circulating glucocorticoid, and its metabolite, cortisone,
`both equally stimulate the growth of these CaP cells and in-
`crease the secretion of prostate-specific antigen in the absence
`of androgens. The physiological concentrations of free cortisol
`and total cortisone in men6,7 greatly exceed the binding affinity
`of the ARccr and would activate the receptor, promoting CaP cell
`proliferation. Our data demonstrate a previously unknown
`mechanism for the androgen-independent growth of advanced
`CaP. Understanding this mechanism and recognizing the pres-
`ence of glucocorticoid-responsive AR mutants are important for
`the development of new forms of therapy for the treatment of
`this subset of CaP.
`
`Two CaP cell lines with different karyotypes, MDA PCa 2a and 2b,
`recently established from a bone metastasis from a patient whose
`CaP showed androgen-independent growth, have been character-
`ized8,9. Here, we investigated the mechanism of androgen-
`independent growth of the MDA PCa 2b cells. Initial experiments
`using radioligand binding assays with tritiated dihydrotestos-
`terone (DHT), the main prostatic androgen, showed decreased
`binding by the androgen receptor (AR). Scatchard analyses of the
`binding of 3H-DHT (Fig. 1a) showed that MDA PCa 2b cells ex-
`pressed ARs at levels similar to those seen in LNCaP cells (a well-
`characterized, AR-expressing human CaP cell line derived from a
`lymph node (LN) metastasis10), but had a reduced affinity for
`DHT, to about 2% (dissociation constant (Kd) = 23.3 ± 3.3 nM (n =
`3) for MDA PCa 2b; Kd = 0.5 nM for LNCaP). Correspondingly,
`MDA PCa 2b cells required higher concentrations of DHT for
`growth stimulation (Fig. 1b) than did LNCaP cells, which typi-
`cally have a bi-phasic growth response to androgens10. DHT also
`induced secretion of prostate-specific antigen (PSA) in MDA PCa
`
`NATURE MEDICINE • VOLUME 6 • NUMBER 6 • JUNE 2000
`
`2b cells, with an effective concentration for half-maximum re-
`sponse (EC50) of 100 nM DHT (compared with 0.5 nM in LNCaP
`cells) (data not shown). These findings demonstrate that MDA
`PCa 2b cells express a low-affinity AR that is less responsive to
`DHT than the AR in LNCaP cells in promoting growth and
`secretion of PSA.
`Sequencing of the entire coding region of the AR gene from
`MDA PCa 2b cells demonstrated two missense mutations in the
`ligand-binding domain that changed leucine at position 701 to
`histidine (L701H) and threonine at position 877 to alanine
`(T877A). As the AR gene is on the X chromosome and as these
`cells contain only a single X chromosome9, the two mutations
`must be on the same allele. Consistently, sequencing analyses of
`RT–PCR products showed that these two mutations were in the
`same AR mRNA molecule. Thus, this case differs from a pub-
`lished case in which the two mutations were not found in the
`same tissue11.
`The AR T877A mutation has been identified in LNCaP cells13
`and in some advanced CaP cases3–5. The effects of this mutation
`on AR function have been well documented13. Although the AR
`L701H mutation has also been identified in metastatic CaP spec-
`imens11,12, the biological consequences of this mutation, like
`those of most AR mutations discovered in metastatic CaP, have
`not been characterized mainly because of a limited supply of
`tumor tissue and the difficulty in establishing CaP cell lines.
`To determine the individual and combined effects of these
`mutations on AR function, we recreated the singly mutated AR
`cDNAs L701H and T877A and AR cDNA with both mutations,
`L701H&T877A. We expressed the wild-type and mutant AR pro-
`teins in COS-7 and CV-1 cells and assessed their 3H-DHT-bind-
`ing and transactivation properties. The T877A mutant bound
`DHT with high affinity (Kd = 0.38 ± 0.04 nM), similar to the
`wild-type AR (Kd = 0.20 ± 0.07 nM) (Fig. 1c). In contrast, the
`L701H mutant failed to show substantial DHT binding. The
`L701H&T877A double mutant, however, had an affinity for
`DHT of 2% (Kd =11.80 ± 2.00 nM) that of wild-type AR. In trans-
`activation assays using the androgen-responsive luciferase (Luc)
`reporter pMMTV–Luc, the T877A mutant had an EC50 of 0.04
`nM DHT, similar to that of the wild-type AR (Fig. 1d), whereas
`the L701H mutant had an EC50 of 10 nM, and the
`L701H&T877A mutant had an EC50 of 0.4 nM. Western blot
`analyses showed that the expression levels of each mutant AR in
`transfected cells were similar (data not shown). The luciferase
`assay (Fig. 1d) is more sensitive than the radioligand binding
`assay (Fig. 1a and c). Both assays indicate that the L701H muta-
`tion decreases the ability of AR to bind and respond to DHT,
`
`Amerigen Exhibit 1138
`Amerigen v. Janssen IPR2016-00286
`
`703
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`

`
`A R T I C L E S
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`The doubly mutated AR shows decreased androgen binding and
`Fig. 1
`responsiveness. a, Scatchard analysis of 3H-DHT binding in LNCaP cells
`(쑗; Kd = 0.5) and MDA PCa 2b cells (쎲; Kd = 23). b, Growth response to
`DHT. Control levels (100%) correspond to 8.25 µg and 2.96 µg DNA per
`well for LNCaP cells (쑗) and MDA PCa 2b cells (쎲), respectively. Data rep-
`resent means ± s.e.m. (n = 3). c, Scatchard analysis of 3H-DHT binding to
`wild-type AR (쏔), AR T877A (왖) and AR L701H&T877A (쐽) expressed in
`COS-7 cells. d, Transactivation assays. CV-1 cells were transiently trans-
`fected with pMMTV–Luc and AR expression vectors, as well as pRL–SV40
`(Renilla luciferase) to normalize for transfection efficiency. Cells were then
`treated with DHT and relative luciferase activity (RLA) was determined. 쏔,
`wild-type; 왖, T877A; 쏆, L701H; 쐽, L701H&T877A. Data represent ‘fold
`induction’ over control (no added ligand). The s.e.m. did not exceed 10%
`for each treatment.
`
`a
`
`b
`
`c
`
`d
`
`tion response was with cortisol, and the response of the
`L701H&T877A mutant to cortisol was much greater (300%)
`than that of the L701H mutant. Thus, the L701H mutation con-
`fers cortisol responsiveness to the AR, and the unique profile of
`hormone response by the L701H&T877A mutant reflects the
`combined effects of the two mutations.
`As the L701H&T877A mutant showed a greater response to
`cortisol than to DHT in the transactivation assays (Fig. 2a), we re-
`examined the binding properties of this mutant using 3H-cortisol
`as the ligand. The L701H&T877A mutant had a specific, sat-
`urable and high-affinity binding site for cortisol with a Kd of 4.8
`± 0.1 nM (Fig. 2b). This binding affinity was 1,000% greater than
`the affinity showed by the human glucocorticoid receptor α for
`cortisol (Kd = 50 nM), which we assayed at the same time. Our
`value is consistent with the Kd reported before14. In transactiva-
`tion assays using the pMMTV–Luc reporter (Fig. 2c), the
`L701H&T877A mutant had an EC50 of about 1 nM cortisol, and
`the L701H mutant had a substantial response to cortisol at a con-
`centration of 10–50 nM. Neither the T877A mutant nor the wild-
`type AR was responsive to cortisol.
`In competition binding assays using 3H-cortisol as the ligand,
`
`Fig. 2 The recreated AR mutants show broadened ligand specificity. a, CV-1
`cells were transfected with AR expression vectors (above graphs), the
`pMMTV–Luc reporter and pRL–SV40 (Renilla luciferase), and were treated with
`1 nM or 10 nM DHT (DHT1 and DHT10), or 10 nM hydroxyflutamide (Flu),
`progesterone (P4), 17β-estradiol (E2), aldosterone (Aldo) or cortisol. Relative
`luciferase activity (RLA) was assayed. WT, wild-type. b, Specific 3H-cortisol
`binding (left) and Scatchard analysis (right) of the L701H&T877A mutant ex-
`pressed in COS-7 cells, showing total binding (쎲), specific binding (open cir-
`cles) and nonspecific binding (왖). The calculated Kd is 4.7 nM (r2 = 0.969).
`c, Transfected CV-1 cells were treated with cortisol, and relative luciferase ac-
`tivity (RLA) was determined. 쏔, wild-type; 왖, T877A; 쏆, L701H; 쐽,
`L701H&T877A. d, CV-1 cells were co-transfected with pMMTV–Luc and ex-
`pression vectors for human glucocorticoid receptor α pSG5-GRα (cross-
`hatched bars) or the L701H&T877A mutant AR (쐽) along with pRL-SV40. Cells
`were then treated with 10 nM cortisol, cortisone or dexamethasone (DEX).
`Data represent relative luciferase activity (RLA; means ± s.e.m.; n = 3) due to
`cortisone or DEX, as a percent of the cortisol-induced activity (set as 100%).
`
`and that ligand binding and androgen responsiveness can be
`partially restored by the acquisition of the T877A mutation.
`As the T877A mutant has a much broader ligand binding pro-
`file than the wild-type AR (ref. 13), we examined the transacti-
`vation response of each mutant AR to ligands of the class I
`nuclear receptors, including DHT, progesterone, 17β-estradiol,
`aldosterone and hydrocortisone (cortisol), as well as an anti-
`androgen hydroxyflutamide. As predicted from the earlier stud-
`ies13, the T877A mutant had substantial transactivation
`responses to progesterone, 17β-estradiol and hydroxyflutamide
`(Fig. 2a). The L701H mutant responded to DHT and, unexpect-
`edly, to cortisol. The L701H&T877A mutant, however, was acti-
`vated by all of the ligands except aldosterone. Correspondingly,
`aldosterone had low binding affinity for the L701H&T877A mu-
`tant in competition binding assays. The maximum transactiva-
`
`a
`
`b
`
`c
`
`d
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`704
`
`NATURE MEDICINE • VOLUME 6 • NUMBER 6 • JUNE 2000
`
`

`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`A R T I C L E S
`
`a
`
`b
`
`c
`
`Fig. 3 Glucocorticoids promote growth and secretion of PSA in MDA
`PCa 2b cells. a, Western blot analyses. MCF-7 cells express both gluco-
`corticoid receptors α and β (ref. 20). Above blot, cell lines. Right mar-
`gin, expected proteins and sizes. GR, glucocorticoid receptor. b and
`c, Cells were grown in the presence of 0, 1, 10 or 100 nM cortisol (0, F1,
`
`F10 and F100) or 10 nM cortisone (E10) in media ‘stripped’ of endoge-
`, LNCaP; 쐽, MDA PCa 2b. b, Growth, measured by de-
`nous steroids.
`termining the DNA content in each sample. c, PSA levels in the
`conditioned media. Data represent means ± s.e.m. (n = 3). *, P < 0.05,
`compared with control.
`
`the L701H&T877A mutant had the highest affinity for cortisol
`(100%) and cortisone (100%), followed by R1881 (a synthetic
`androgen; 65%), DHT (41%), dexamethasone (18%), hydrox-
`yflutamide (16%), 17β-estradiol (11%), progesterone (8%), aldos-
`terone (less than1%) and bicalutamide (an anti-androgen; less
`than1%). Its binding profile for glucocorticoids differs from that
`of the human glucocorticoid receptor α in that the latter had a
`higher affinity for dexamethasone, a synthetic glucocorticoid (Kd
`= 2.2 nM) than cortisol, the natural glucocorticoid. The
`L701H&T877A mutant also responded to many C19 and C21
`steroids that circulate in the human bloodstream (data not
`shown), which further distinguishes it from other nuclear hor-
`mone receptors. Cortisone, which is a natural metabolite of cor-
`tisol and is inactive for human glucocorticoid receptor α,
`activated the L701H&T877A mutant as efficiently as cortisol
`(Fig. 2d). This experiment used CV-1 cells, which are deficient in
`11β-hydroxysteroid dehydrogenase15, the enzyme that converts
`cortisone to cortisol. Thus, the combination of the L701H
`and T877A mutations effectively transforms the AR into a corti-
`sol/cortisone receptor (ARccr), allowing glucocorticoids to acti-
`vate androgen-responsive genes in CaP.
`To test the effects of cortisol and cortisone on MDA PCa 2b
`cells, we first determined whether these cells express glucocorti-
`coid receptor, by western blot analysis. Glucocorticoid receptor
`α was undetectable in MDA PCa 2b cells (Fig. 3a); however, these
`cells did express glucocorticoid receptor β (Fig. 3a), a truncated
`form of glucocorticoid receptor that does not bind glucocorti-
`coids or mediate transactivation16. In growth studies using
`androgen-free media (Fig. 3b), both cortisol and cortisone stimu-
`lated MDA PCa 2b cell proliferation in a dose-dependent man-
`ner. In contrast, neither hormone had any growth-stimulatory
`effect on LNCaP cells (Fig. 3b), which do not express glucocorti-
`coid receptor α and do not respond to dexamethasone17.
`Furthermore, secretion of PSA, a marker of androgen action, was
`increased by both cortisol and cortisone in MDA PCa 2b cells but
`not in LNCaP cells (Fig. 3c). MDA PCa 2a cells also responded
`to cortisol and cortisone stimulation (data not shown). Our
`results show that in these CaP cells, cortisol and cortisone, acting
`the doubly mutated ARccr, promote androgen-
`through
`independent growth and PSA secretion.
`Glucocorticoid activation of a mutated AR may be one of
`
`many potential pathways by which CaP cells escape androgen
`dependence. The mutations described here, L701H by itself or
`in combination with T877A, convert the AR into a receptor that
`responds to glucocorticoids by stimulating cell growth and acti-
`vating androgen-responsive genes, including PSA. PSA is an an-
`drogen-dependent marker of CaP progression, and serum PSA
`levels positively correlate with tumor burden in patients18. Our
`findings indicate the possibility that PSA secretion in some an-
`drogen-independent CaPs may reflect glucocorticoid or other
`hormone stimulation instead of androgen stimulation of the
`AR. Glucocorticoids circulate at high levels with most cortisol
`bound to transcortin. In men, the circulating levels of free corti-
`sol (15–45 nM) and total cortisone (39–63 nM) do not decline
`with age6,7. These concentrations exceed the Kd (4.8 nM) of the
`ARccr receptor and are high enough to sufficiently activate both
`the L701H mutant and the double-mutant ARccr in transactiva-
`tion assays. Therefore, these circulating glucocorticoids could
`substantially activate mutant ARs in vivo and promote andro-
`gen-independent growth of CaP. We are now testing this using
`animal models.
`To appreciate the frequency with which glucocorticoids pro-
`mote androgen-independent CaP growth in patients, the preva-
`lence of these AR mutations in metastatic CaP needs to be
`determined. Although the cells in distant metastases, after andro-
`gen ablation fails, often contain AR mutations1–5, metastatic
`tissues are not routinely biopsied, and therefore are not
`readily available.
`In conclusion, we have characterized mutations in the AR that
`may account for a previously unknown mechanism for andro-
`gen-independent growth of CaP. Although AR mutants with a
`variety of ‘promiscuities’ exist, the recognition of these glucocor-
`ticoid-responsive ARs (L701H or L701H&T877A) is an important
`step in the development of new forms of therapy for the treat-
`ment of this subset of androgen-independent CaP.
`
`Methods
`Cell culture, cell proliferation and PSA assays. LNCaP and MDA PCa 2b
`cells were maintained as described8,9. Cell proliferation assays were done 6 d
`after 5 × 104 cells were seeded per 35-mm well and cultured in RPMI-1640
`medium supplemented with 5% charcoal-stripped fetal bovine serum and
`the steroids being studied. Determination of DNA content/well was used as
`an index of cell proliferation, as described8. PSA levels in the conditioned
`
`NATURE MEDICINE • VOLUME 6 • NUMBER 6 • JUNE 2000
`
`705
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`

`
`A R T I C L E S
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`media were determined by the TOSOH assay, an automated immunoenzy-
`mometric assay system (TOSOH Medics, Foster City, California).
`
`Sequencing of genomic DNA. Genomic DNA was isolated from MDA PCa
`2b cells, and each exon of the AR gene was amplified by PCR using intronic
`primers19. The PCR products were cloned and DNA was sequenced by the
`core facility at Stanford University. The data were analyzed using the GCG
`software (GCG, Madison, Wisconsin). Three independent clones from two
`preparations of DNA were tested, and the same mutations were found
`each time.
`
`Sequencing of cDNA after RT–PCR. Total RNA was isolated from MDA PCa
`2b cells and cDNA was made using the MuLV reverse transcriptase and an
`oligo-dT16 primer (Roche Molecular Systems, Branchburg, New Jersey). Two
`gene-specific primers (AR2401, 5′–ACTCTGGGAGCCCGGAAGCTG–3′; and
`AR3294, 5′–AATGCTTCACTGGGTGTGGAA–3′) were used to amplify an in-
`tact AR ligand binding domain (exons D–H) by PCR. The RT–PCR product
`was an 893-base-pair fragment encompassing the AR coding sequence, nu-
`cleotides 2401–3294. The RT–PCR products were inserted into a cloning
`vector, TA-vector (Invitrogen, San Diego, California). A total of 36 clones
`were screened, and 15 had the 893-base-pair insert. Each positive clone was
`sequenced in both directions. Every clone contained both L701H and
`T877A mutations.
`
`Site-directed mutagenesis. Mutations were recreated in the AR cDNA
`in pSG5-AR (from Z. Culig). pSG5–GR was provided by P. Kushner. The
`mutants were generated using the GeneEditor in vitro Site-Directed
`Mutagenesis System (Promega). The mutagenic oligonucleotides (Operon
`Technologies, Alameda, California) used were 5′–GCAGCCTTGCACTC-
`for L701H and 5′–GCATCAGTTCGCTTTTGACCT–3′
`TAGCCTC–3′
`for
`T877A (mutated bases are underlined). Final constructs were sequenced to
`confirm the mutations.
`
`Transfection and luciferase assay. Plasmids were transfected into CV-1
`(for transactivation) or COS-7 (for ligand binding) monkey kidney cells
`using lipofectamine (Life Technologies). After this transfection, the CV-1
`cells were treated with various ligands for 24 h and luciferase activity was
`measured using the dual-luciferase assay system (Promega). The experi-
`ment was done three times using triplicate wells for each treatment.
`Triplicate wells contained 1.25 µg pMMTV–Luc (from R. Evans), 0.625 µg
`expression vectors for AR or glucocorticoid receptor α, and 5 ng pRL-SV40
`(as a control for transfection efficiency).
`
`Radioligand binding, Scatchard analysis and competition binding as-
`says. The recreated AR L701H&T877A mutant was expressed in COS-7
`cells. Binding assays using 3H-DHT, 3H-cortisol and 3H-dexamethasone, as
`well as Scatchard analyses using these steroids, were done as described8.
`High-salt extracts (200 µl at a concentration of 0.5–1 mg protein/ml) were
`incubated with 0–100 nM labeled ligand for 16–20 h at 0 °C. Bound and
`free hormones were separated by hydroxylapatite. Specific binding was cal-
`culated by subtracting nonspecific binding obtained in the presence of a
`250-fold excess of unlabeled ligands from the total binding measured in the
`absence of unlabeled ligands. Competition binding analyses of the double-
`mutant AR were done in the presence of 20 nM 3H-cortisol with unlabeled
`ligands at an excess of 1-fold to 100-fold. The relative ability of various
`compounds to inhibit 50% of 3H-cortisol binding is expressed as the relative
`binding affinity value, with cortisol set at 100%.
`
`Western blot analysis. Cell extracts containing 50 µg of protein were sep-
`arated by 4–12% gradient SDS–PAGE and transferred to nitrocellulose
`
`membranes. The blots were probed with polyclonal antibodies against AR,
`glucocorticoid
`receptors
`(Santa Cruz Biotechnology, Santa Cruz,
`California), and actin (Sigma). Peroxidase-conjugated goat antibody
`against rabbit IgG (Zymed, South San Francisco, California) was used as
`secondary antibody. The signal was detected using enhanced chemilumi-
`nescence (ECL; Amersham).
`
`Statistical analysis. For Fig. 3b and c, the ANOVA Scheffe’s F test was used
`to assess statistical significance of differences between the treated group and
`the untreated controls, using the StatView 4.5 program (Abacus Concepts,
`Berkeley, California). P < 0.05 was considered statistically significant.
`
`Acknowledgments
`We thank A. Hoffman and T. Stamey for critical reading of the manuscript.
`This work was supported by grants from the National Institutes of Health, the
`American Institute for Cancer Research and the US Army Medical Research
`Acquisition Activity (to D.F.).
`
`RECEIVED 9 DECEMBER 1999; ACCEPTED 24 APRIL 2000
`
`1. Trapman, J. & Brinkmann, A.O. The androgen receptor in prostate cancer. Path. Res.
`Pract. 192, 752–760 (1996).
`2. Visakorpi, T. et al. In vivo amplification of the androgen receptor gene and progres-
`sion of human prostate cancer. Nature Genet. 9, 401–404 (1995).
`3. Taplin M.E. et al. Mutation of the androgen-receptor gene in metastatic androgen-
`independent prostate cancer. N. Engl. J. Med. 332, 1393–1398 (1995).
`4. Gaddipati, J. et al. Frequent detection of codon 877 mutation in the androgen re-
`ceptor gene in advanced prostate cancers. Cancer Res. 54, 2861–2866 (1994).
`5. Gottlieb, B., Beitel, L.K., Lumbroso, R., Pinsky, L., & Trifiro, M. Update of the andro-
`gen receptor gene mutations database. Hum. Mutat. 14,103–114 (1999).
`6. Van Cauter, E., Leproult, R. & Kupfer, D.J. Effects of gender and age on the levels and
`circadian rhythmicity of plasma cortisol. J. Clin. Endocrinol. Metab. 81, 2468–2473
`(1996)..
`7. Walker, B.R., Best, R., Noon, J.P., Watt, G.C. & Webb, D.J. Seasonal variation in glu-
`cocorticoid activity in healthy men. J. Clin. Endocrinol. Metab. 82, 4015–4019 (1997).
`8. Zhao X.Y. et al. Two mutations identified in the androgen receptor of the new
`human prostate cancer cell line MDA PCa 2A. J. Urology 162, 2192–2199 (1999).
`9. Navone, N.M. et al. Establishment of two human prostate cancer cell lines derived
`from a single bone metastasis. Clin. Cancer Res. 3, 2493–2499 (1997).
`10. Horoszewicz, J.S, et al. LNCaP model of human prostatic carcinoma. Cancer Res. 43,
`1809–1818 (1983).
`11. Suzuki, H. et al. Androgen receptor gene mutations in human prostate cancer. J.
`Steroid Biochem. Mol. Biol. 46, 759–765 (1993).
`12. Watanabe, M. et al. Genetic alterations of androgen receptor gene in Japanese
`human prostate cancer. Jpn. J. Clin. Oncol. 27, 389–393 (1997).
`13. Veldscholte, J. et al. A mutation in the ligand binding domain of the androgen re-
`ceptor of human LNCaP cells affects steroid binding characteristics and response to
`anti-androgens. Biochem. Biophy. Res. Commun. 173, 534–540 (1990).
`14. Roux, S. et al. Mutation of isoleucine 747 by a threonine alters the ligand responsive-
`ness of the human glucocorticoid receptor. Mol. Endocrinol. 10,1214–1226 (1996).
`15. Warriar, N., Page, N. & Govindan, M.V. Transcription activation of mouse mammary
`tumor virus-chloramphenicol acetyltransferase: a model to study the metabolism of
`cortisol. Biochemistry 33, 12837–12843 (1994).
`16. Hollenberg, S.M. et al. Primary structure and expression of a functional human glu-
`cocorticoid receptor cDNA. Nature 318, 635–641 (1985).
`17. Cleutjens, C.B. et al. Both androgen receptor and glucocorticoid receptor are able to
`induce prostate-specific antigen expression, but differ in their growth-stimulating
`properties of LNCaP cells. Endocrinology 138, 5293–5300 (1997).
`18. Stamey, T.A. et al. Prostate-specific antigen as a serum marker for adenocarcinoma
`of the prostate. New Engl. J. Med. 317, 909–916 (1987).
`19. Lubahn, D. et al. Sequence of the intron/exon junctions of the coding region of the
`human androgen receptor gene and identification of a point mutation in a family
`with complete androgen insensitivity. Proc. Natl. Acad. Sci. USA 86, 9534–9538
`(1989).
`20. Oakley, R.H., Webster, J.C., Sar, M., Parker, C.R.Jr., & Cidlowski, J.A. Expression and
`subcellular distribution of the beta-isoform of the human glucocorticoid receptor.
`Endocrinology 138, 5028–5038 (1997).
`
`© 2000 Nature America Inc. • http://medicine.nature.com
`
`706
`
`NATURE MEDICINE • VOLUME 6 • NUMBER 6 • JUNE 2000